Introduction
Osteoporosis is a systemic bone disorder characterized by low bone mass and increased brittleness, which can easily lead to fractures, particularly in older individuals [
1,
2]. More than 2,000,000 osteoporosis-related fractures occur each year according to the National Osteoporosis Foundation of America [
3]. An imbalance between osteoblasts and osteoclasts in healthy bone tissues is the main cause of low bone mass which directly leads to osteoporosis [
4]. Hence, it is of great significance to find the potential molecular mechanisms that maintain the osteoblast-osteoclast balance in bone cells.
Differentially expressed genes (DEGs) which were identified by gene microarray analysis has been reported to play regulatory roles in various diseases [
5‐
7]. The reanalysis of these data and the prediction of targets can help to develop new diagnostic and therapeutic strategies [
8]. For instance, 496 and 291 DEGs were identified in osteoporotic rats before and after astragalus polysaccharide (APS) treatment, respectively, indicating that APS may play a role in the treatment of osteoporosis by reversing the expression of 53 DEGs [
9]. Similarly, Yu T et al. conducted enrichment and protein-protein interaction network analyses of DEGs identified from three datasets, and found three hub genes that promote osteoporosis [
7]. Hence, it is feasible to screen for potential genes associated with osteoporosis and to verify these genes through comprehensive follow-up experimental studies.
Bone mesenchymal stem cells (MSCs), as the main source of osteoblasts, have weakened osteogenic differentiation ability and enhanced adipogenic differentiation ability in patients with osteoporosis [
10,
11]. Application of MSCs therapy is one of the promising treatment to renew bone tissue in the body, so the regulation of MSCs osteogenic differentiation will be helpful for the treatment of osteoporosis. The UL-16 binding protein 1 (
ULBP1) gene is a ligand of natural killer group 2 member D (NKG2D), mediates natural killer (NK) cell cytotoxicity [
12,
13]. Earlier bioinformatics analysis results suggested that ULBP1 may be a regulatory DEGs in osteoporosis, which was also verified in this study [
14]. Therefore, this study aims to evaluate the role of ULBP1 in osteoblast differentiation and the underlying mechanisms of influencing potential signaling pathways. These findings may help to uncover novel diagnostic biomarkers.
Materials and methods
Microarray expression profiling
Microarray profile GSE100609 of osteoporosis related genes of Indian post menopausal females and non-osteoporotic post menopausal females were downloaded from the Gene Expression Omnibus (GEO) database (
http://www.ncbi.nlm.nih.gov/geo). All differentially expressed genes (DEGs) of two groups were analyzed by an online analysis program Geo2R provided by GEO database.
P < 0.05 and |log
2FC| ≥ 1.5 is the standard of screening DEGs. Pearson correlation was used to analysis the correlation between DEGs, and the KEGG analysis was applied to analyze the related-pathways of enriched genes.
Patients
44 postmenopausal women diagnosed as osteoporosis in Huadu District People’s Hospital of Guangzhou and 40 healthy postmenopausal women were included in this research under the approval of Ethics Committee of Huadu District People’s Hospital of Guangzhou. Fasting blood (5 mL) was obtained from all subjects who have signed the informed consents,and was centrifuged within 15 min after collection with a relative centrifugal force of 1200×g for 10 min. Total serum RNA was then collected using the Trizol reagent (Invitrogen, CA, USA) under the guidance of the manufacturer.
Cell culture
The human mesenchymal stem cells (hMSCs) were purchased from American Type Culture Collection (ATCC, MD, USA) and cultured in mesenchymal stem cell basal medium (Gibco, CA, USA) at 37 °C in a 5% CO2 incubator.
Osteogenic inductive medium (OIM) for osteoblast differentiation
The hMSCs at concentration of 2 × 104 /well were seeded in 6-well plates (Thermol Fisher, CA, USA) and cultured in original α-MEM medium (Gibco, CA, USA). After 24 h, 10% foetal Bovine Serum (FBS; Gibco, CA, USA), 50 µM l-ascorbic acid (Gibco, CA, USA), 10 mM β-glycerophosphate (Gibco, CA, USA), as well as 100 nM dexamethasone (Gibco, CA, USA) were then added. The medium was changed every another day. The hMSCs before osteogenic differentiation induction were classified as control group, and the hMSCs after osteogenic differentiation were classified as OMI group.
Alkaline phosphatase (ALP) activity detection
ALP activity was detected to distinguish osteoblasts by determining early mineralization level of differentiated hMSCs [
15]. ALP activity was measured by a fluorescence detection kit in accordance with the manufacturer’s protocol (Nanjing Jiancheng Institute, Nanjing, China).
Alizarin Red S (ARS) staining
ARS staining was conducted to detect the later mineralization state of differentiated hMSCs [
15]. Briefly, differentiated hMSCs were fixed in 4% formaldehyde (aladdin, Shanghai, China) for 15 min, then stained with 2% alizarin red solution (Beyotime, Nantong, China) at room temperature. After washed by distilled water, stained hMSCs were observed by a microscope (Dynex Technologies, VA, USA) at 450 nm.
Lentivirus construction and viral infection
Cell infection was carried out after the hMSCs were successfully differentiated. All plasmids used were purchased from GenePharma Company (Shanghai, China) and were listed below: UL-16 binding protein 1 (ULBP1) short-hairpin RNAs (shRNAs): 5’-GCAGCTTTATAAACAGCCGTG-3’ (1#), 5’-GCCGTGGTGTGAGCCTCGAAG-3’ (2#). mothers against decapentaplegic homolog 2 (SMAD2) shRNA: 5’-GGTGAAGAATTGGAGCCTTAA-3’. In brief, the differentiated hMSCs were infected with sh-NC, sh-ULBP1, or sh-SMAD2 supplemented with 6 µg/mL polybrene (Gibco, CA, USA) for 12 h, and then the transfection medium was replaced. After 72 h, the infected cells were screened with 1 µg/mL purinomycin (Gibco, CA, USA) for subsequent experiments. We used RT-PCR to analyze the transfection efficiency.
qRT-PCR
The expression of genes were detected including ULBP1, bone morphogenetic protein 2 (BMP2), osteocalcin (OCN), Osterix, inhibin beta A chain (INHBA), repulsive guidance molecule A (RGMA), growth/differentiation factor 5 (GDF5) and SMAD2. After the hMSCs were differentiated or transfected successfully, total RNA was collected by Trizol (Invitrogen, CA, USA) and then transcribed into cDNA via PrimeScript RT reagent kit (TaKaRa, Tokyo, Japan). Quantification of all gene transcripts was performed by qRT-PCR using THUNDERBIRD SYBR® qPCR Mix (Toyobo life science, Osaka, Japan). The relative expressions of genes were calculated using the 2
−ΔΔCt method. The primer sequences were shown in Table
1.
ULBP1 | TAAGTCCAGACCTGAACCACA | TCCACCACGTCTCTTAGTGTT |
BMP2 | ACCCGCTGTCTTCTAGCGT | TTTCAGGCCGAACATGCTGAG |
OCN | CACTCCTCGCCCTATTGGC | CCCTCCTGCTTGGACACAAAG |
Osterix | CCTCTGCGGGACTCAACAAC | AGCCCATTAGTGCTTGTAAAGG |
INHBA | CCTCCCAAAGGATGTACCCAA | CTCTATCTCCACATACCCGTTCT |
RGMA | CCTCAGGACTTTCACCGACC | CGTTCTTAGAGCCATCCACGAA |
GDF5 | GCTGGGAGGTGTTCGACATC | CACGGTCTTATCGTCCTGGC |
SMAD2 | CGTCCATCTTGCCATTCACG | CTCAAGCTCATCTAATCGTCCTG |
Western blot assay
hMSCs of each group were lysed to to obtain total protein extracted by RIPA reagent (Sigma, NJ, USA). Protein quantification was carried out by a BCA protein assay (Thermol Fisher, CA, USA). Subsequently, proteins were isolate by 10% SDS-PAGE and electrotransferred to polyvinylidene fluoride membranes (Millipore, MA, USA). Afterwards, the membranes were blocked before incubation by primary antibodies including anti-BMP2 (ab214821, 1/1000), anti-OCN (ab133612, 1/1000), anti-Sp7/Osterix (ab227820, 1/1000), anti-SMAD2 (ab40855, 1/2000), anti-SMAD3 (ab40854, 1/2000), anti-p-SMAD2 (ab280888, 1/1000), and anti-p-SMAD3 (ab52903, 1/2000) overnight at 4 °C. Then the membranes were washed by Tris buffered saline with Tween 20 (Gibco, CA, USA), followed by secondary antibody (ab205718; 1/10,000) for 2 h. Finally, the protein band grayscale value was analyzed by Image Lab software (Bio-Rad, Hercules, USA).
Ovariectomized (OVX) mouse model of osteoporosis establishment
Female C57BL/6 mice (10 weeks of age) were randomly divided into 4 groups with 6 mice per group. Ovariectomy or sham surgery is performed under general anesthesia. Both ovaries were removed under sterile conditions. In the sham group, only part of the adipose tissue around the ovaries was removed. Lentivirus intramedullary injection was given 4 weeks after ovariectomy. Specifically, a 5-mm longitudinal incision was made along the medial side of the quadriceps femoris patella complex. Lateral dislocation of the patella was performed to expose the intercondylar sulcus. A fine Kirschner wire was drilled in, a 26-gauge needle was inserted, and 15 µL of sh-ULBP1 lentivirus (5 × 107 /mL) was injected into the medullary cavity. The quadriceps femoris patella complex was then resutured. All mice were anesthetized with sodium pentobarbital (P276000, 100 mg/kg, i.p. AmyJet Scientific, Wuhan, China) two months later, and the femurs were removed after the last injection.
Bone loss evaluation
A Scanco vivaCT 40 (Scanco Medical AG, Bassersdorf, Switzerland) was employed for micro-computed tomography (µCT). Using 6-µm pixel size, we set an X-ray source at 60 kV and scanned the excised left distal metaphysis of the femurs. We focused on a ~ 0.5 mm proximal region in the most distal part of the growth plate. The femurs of mice were fixed with 4% paraformaldehyde for 24 h and then scanned by a Scanco vivaCT 40 (Scanco Medical AG, Bassersdorf, Switzerland). An X-ray source at 60 kV was set, the femurs were then scanned. Several bone-related parameters were analyzed, including the trabecular separation (Tb.Sp, mm), trabecular thickness (Tb.Th, µm), bone volume/total volume (BV/TV, %), bone surface-to-volume ratio (BS/BV, mm− 1), and trabecular number (Tb.N, mm− 1). For bone mineral density (BMD, g/cm3) determination, Brukermicro-CT BMD calibration phantoms were used with calcium hydroxyapatite concentrations of 0.25 and 0.75 g/cm3.
Statistical analysis
Statistical analyses were performed using the GraphPad Prism8.3 software (GraphPad, San Diego, USA). Each experiment was performed at least 3 times. All data were expressed as mean ± SD, and Student’s t-test was used to analyze the differences between the two groups while one-way ANOVA was for multiple groups analysis. Meanwhile, Turkey test was used to verify ANOVA for pairwise comparisons. Pearson correlation was used to analysis the correlation between expression of DEGs. P < 0.05 was regarded as statistically significant.
Discussion
Osteoporosis is a multifactorial disease with genetic and strong epigenetic components [
4]. Although there is a large number of candidate genes association studies [
16,
17], the etiology and molecular mechanisms of the disease are not fully understood. In this study, ULBP1 gene has been identified to be overexpressed in osteoporosis patients whereas was down-regulated in differentiated hMSCs. Suppression of ULBP1 promoted osteoblast differentiation capacity via activating TNF-β signaling pathway.
ULBP1 is one of the ligands of natural killer group 2 member D (NKG2D) and mediates natural killer (NK) cell cytotoxicity [
12,
13], and has been identified to be a DEGs in osteoporosis. Overexpressed ULBP1 could activate NK cells to regulate disorders including tumors and preeclampsia [
18,
19]. However, the effects of ULBP1 in osteoporosis remain unreported. Interestingly, a sub-type of NK cells were reported to function as a regulator in maintaining bone homeostasis in osteoporosis [
20,
21]. Hence, we speculated that aberrant expressed ULBP1 negatively related to NK cells may play a regulatory role in maintaining balance between osteoblasts and osteoclasts. Our data suggested that ULBP1 presented to be upregulated in serum of osteoporosis, while downregulated in hMSCs with higher osteoblast differentiation. Then, ULBP1 suppression decreased capacity of osteoblast differentiation in hMSCs, indicating that ULBP1 may inhibit osteoblast differentiation.
Transforming growth factor-β (TGF-β) signaling pathway plays an important role in maintaining bone homeostasis [
22,
23]. Phosphorylation of TGF-β receptors has the ability to recruit and phosphatize serine sites at the the C-terminal of SMAD2/3 [
24,
25]. TGF-β activates classical SMAD-dependent signaling pathway to modulate related transcription factors to regulate osteogenic and adipogenic differentiation of mesenchymal stem cells [
26]. For instance, Activated TGF-β1/SMADs signaling pathway induced by abnormally expressed miR-497 or LRG1 promoted osteoblastic activity and collagen synthesis [
27]. Likewise, MOTS-c activated TGF-β/SMAD pathway to promoted the synthesis of type I collagen in osteoblasts, thereby improving osteoporosis [
28]. In this research, results of pearson analysis along with KEGG analysis of DGEs demonstrated that ULBP1 could suppressed osteoblast differentiation by inactivating TNF-β signaling pathway, which was in line with previous studies [
27,
28]. Furthermore, suppressed TNF-β signaling pathway induced by inactivating SMAD2 significantly attentuated osteoblast differentiation promoted by deficiency of ULBP1.
There are some limitations in this study. The ULBP1 gene has been identified in the osteoclast precursor cells sorted from the circulating monocytes of patients with osteoporosis and normal controls according to the bioinformatic analysis. The role of ULBP1 gene in regulating the osteoclastic differentiation should be studied in the future.
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit
http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (
http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.