Introduction
Nasopharyngeal carcinoma (NPC) is one of the most frequent malignant tumors with extremely high occurrence in Southern China, Northern Africa and parts of the Mediterranean basin [
1]. Most NPC is moderately sensitive to radiation therapy, which has been the preferred treatment thus far [
2]. However, NPC is featured as a type of poor or undifferentiated carcinoma with only 41–63% overall survival rate in patients at the advanced stage [
3,
4]. Therefore, deeper insights into the molecular mechanisms that underlie NPC development and progression warrant the better therapeutic strategies targeting the disease.
Long non-coding RNA (lncRNA) is a class of longer than 200 nucleotides RNA transcripts [
5]. Emerging studies have shown that lncRNAs participate in NPC development and progression. For example, maternally expressed gene 3 (MEG3) was identified as a tumor suppressor lncRNA that is downregulated in NPC due to losses of DNA copy numbers and aberrant promoter methylation [
6]. On the contrary, LncRNA HOX transcript antisense intergenic RNA (HOTAIR) acts as an oncogene, whose high abundance in NPC cells and the patient tumor samples correlates with a poor prognosis [
7,
8]. With the advance of microarray and high-throughput RNA sequencing, a large number of lncRNAs have been identified in NPC tissues and cell lines [
9]. However, the roles of these dysregulated lncRNAs in the pathogenesis of NPC remain poorly understood.
The Janus kinase (JAK)-signal transducer of activators of transcription (STAT) signaling pathway is involved in diverse biological processes such as cell proliferation, differentiation, apoptosis, and immune regulation [
10]. It mainly consists of three components, namely tyrosine-kinase-related receptor, tyrosine kinase JAK and transcription factor STAT. The binding of cytokines to their receptors activates JAKs and promote STAT nuclear translocation to initiate the corresponding gene transcription, including the expression of SOCS which feeds back negatively to shut down the signaling pathway [
11]. It was reported that the abnormal JAK/STAT signaling with persistent activation of STAT1, 3 and 5 has a cancer-promoting role in the progression of Epstein-Barr virus (EBV)-related NPC [
12]. Therefore, suppression of the aberrantly activated JAK/STAT signaling pathway could be promising strategy for NPC therapy.
In current study, we demonstrated an abnormal accumulation of lncRNA LINC00669 in the cytoplasm of NPC cells, where it binds to the key JAK/STAT signaling pathway suppressor SOCS1 and blocks its ubiquitin ligase activity toward the transcription factor STAT1. The stabilized STAT1 is further activated and translocated into the nucleus to initiate expression of genes associated with proliferation and invasion. These results shed light on a clinical implication of LINC00669 as a diagnostic and prognostic marker as well as a therapeutic target of NPC.
Materials and methods
Ethical statement
All animal experiments were conducted in accordance with the guidelines of Animal Experimentation Ethics Committee of the Third Xiangya Hospital of Central South University. Clinical NPC tumor and para-tumor samples were collected from 16 patients with informed consents being signed by all of the patients.
Cell lines and treatment
All the NPC cell lines and normal human nasopharyngeal epithelial cell line NP69 were purchased from the Chinese Academy of Sciences Cell Bank (Shanghai, China). NPC cells were cultured in Dulbecco’s modified Eagle’s medium (Gibco, Thermo Fisher Scientific, Inc., Waltham, MA, USA) containing 10% fetal bovine serum (FBS) (Sigma-Aldrich, St. Louis, MO, USA) and 1% antibiotics (100 U/ml penicillin and 100 mg/ml streptomycin sulfates), while NP69 cells were maintained in the RPMI1640 medium containing 10% FBS and 1% penicillin/streptomycin. Cycloheximide (20 mg/ml, Millipore Sigma, #C7698) and MG132 (5 μM, Sigma-Aldrich, #1211877-36-9) were used for studying ubiquitin-proteasome-mediated protein degradation.
Nucleic acid extraction and mRNA expression quantification
Total RNA of NPC tissues and cells was extracted using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.), followed by reverse transcription using RevertAidTM H Minus First Strand cDNA Synthesis Kit (Fermentas). The relative mRNA contents were quantified by quantitative PCR (qPCR) using SYBR Green PCR Master Mix (ABI 4309155) in the ABI7900 Realtime-PCR machine. Primers used for qPCR analysis were included in Table
1.
Primers U1 -F | GGGAGATACCATGATCACGAAGGT |
Primers U1 -R | CCACAAATTATGCAGTCGAGTTTCCC |
JAK2-F | ATCCACCCAACCATGTCTTCC |
JAK2-R | ATTCCATGCCGATAGGCTCTG |
JAK3-F | CCTGATCGTGGTCCAGAGAG |
JAK3-R | GCAGGGATCTTGTGAAATGTCAT |
STAT1-F | CAGCTTGACTCAAAATTCCTGGA |
STAT1-R | TGAAGATTACGCTTGCTTTTCCT |
STAT3-F | ATCACGCCTTCTACAGACTGC |
STAT3-R | CATCCTGGAGATTCTCTACCACT |
SOCS1-F | TTTTCGCCCTTAGCGTGAAGA |
SOCS1-R | GAGGCAGTCGAAGCTCTCG |
LINC00669-F | CAGTGAGATGCAGAGCTTGG |
LINC00669-R | TGTCCTTGAGGCTGTCTGTG |
β-actin -F | CATGTACGTTGCTATCCAGGC |
β-actin -R | CTCCTTAATGTCACGCACGAT |
Oligonucleotide sequence for RNA pulldown |
LINC00669-sense-F | TAATACGACTCACTATAGGGAGACTGTGTGGAACTTGGGATTCGAACGG |
LINC00669-sense-R | CAATTTTGATTGGCTTTATTTTGATGTG |
LINC00669-antisense-F | CTGTGTGGAACTTGGGATTCGAACGG |
LINC00669-antisense-R | TAATACGACTCACTATAGGGAGACAATTTTGATTGGCTTTATTTTGATGTG |
Gene cloning, knockdown and overexpression
The truncated LINC00669 plasmids were constructed using Phusion Site-Directed Mutagenesis Kit (Thermo Fisher Scientific, Inc., Waltham, MA, USA) by following the manual instruction. In vitro loss-of-function studies were performed by pre-designed siRNA from Millipore Sigma using Lipofectamine™ 2000 (Invitrogen; Thermo Fisher Scientific, Inc.). For in vivo xenograft experiment, lentiviral vectors expressing shLINC00669, SOCS1, shSOCS1 and the empty lentiviral vector were purchased from GeneChem (Shanghai, China for the stable infection of CNE-2 cells upon puromycin (2 μg/ml) selection.
Western blotting
Total proteins from NPC tissues and cells were extracted using RIPA buffer (1% NP-40, 0.1% SDS, 50 mM DTT) supplemented with protease inhibitor cocktail containing 2 μg/ml Aprotinin, 2 μg/ml Leupeptin and 1 mM PMSF. An equal amount of total protein from each sample was separated by 8 ~ 15% SDS-PAGE gel and electroblotted onto a polyvinylidene difluoride membrane. Immunoblotting was conducted using antibodies listed in Table
2.
SOCS1 | ≈38 | 1:500 | Santa Cruz, sc-518,028 | Goat Anti Rabbit IgG/HRP | 1:4000 |
JAK2 | ≈120 | 1:500 | omnimabs,OM206683 | Goat Anti Rabbit IgG/HRP | 1:4000 |
JAK3 | ≈125 | 1:1000 | omnimabs,OM260121 | Goat Anti Mouse IgG/HRP | 1:4000 |
STAT1 | ≈87 | 1:1000 | Abcam,ab234400 | Goat Anti Rabbit IgG/HRP | 1:4000 |
STAT3 | ≈88 | 1:2000 | Abcam,ab119352 | Goat Anti Mouse IgG/HRP | 1:4000 |
p-STAT1(Y701) | ≈87 | 1:1000 | Abcam,ab29045 | Goat Anti Mouse IgG/HRP | 1:4000 |
UB | ≈8.4 | 1:200 | Ptgcn,10,201–2-AP | Goat Anti Rabbit IgG/HRP | 1:4000 |
HIS | | 1:500 | Abcam,ab18184 | Goat Anti Mouse IgG/HRP | 1:4000 |
GFP | | 1:1000 | Abcam,ab290 | Goat Anti Rabbit IgG/HRP | 1:4000 |
FLAG | | 1:1000 | Abcam,ab205606 | Goat Anti Rabbit IgG/HRP | 1:4000 |
β-actin | 42 | 1:2000 | Ptgcn, 66,009–1-Ig | Goat Anti Mouse IgG/HRP | 1:4000 |
Co-immunoprecipitation (Co-IP)
Total proteins from NPC cells cultured in 10-cm culture dishes were used for Co-IP assay. Briefly, primary antibodies against SOCS1 or STAT1 were added in each cell lysate and incubated overnight at 4 °C with rotation. The normal human IgG protein was used as a negative control. Protein A/G agarose beads (Beyotime Biotechnology, #P1012) were then added for affinity binding of primary antibody by a 2 h-incubation at 4 °C with gentle rotation. The unbound antibodies were washed off through the sequential wash with PBS and cell lysis buffer. The agarose beads were resuspended in 20 μl 1x SDS-PAGE loading buffer, and boiled for western blot analysis of the precipitated target proteins.
Cell proliferation assay
Time-dependent NPC cell proliferation was characterized by MTT cell proliferation and cytotoxicity detection kit (KeyGEN Biotech, #KGA312) by following the manual instruction.
Wound-healing assay
NPC cell migration was characterized by wound-healing assay. Briefly, a confluent monolayer of NPC cells in 24-well plate was scratched using a sterile 100 μl pipette tip. Cells were then allowed to expand in FBS-reduced growth medium (1%) for another 48 h. The migration was assessed using the scratch ratio by dividing the interval at the starting point (0 h) with the one at the ending point (48 h).
Transwell assay
NPC cells were seeded into the Matrigel (BD Biosciences, San Jose, CA)-coated upper chamber of 8.0 μm pore size Transwell apparatus (Corning, NY, USA) with serum-free medium. Growth medium supplemented with 10% FBS was added to the lower chamber as a chemoattractant. The cells were allowed to invade for 48 h at 37 °C under 5% CO2. Cells invaded to the lower surface of filter were then fixed in 70% ethanol for 30 min followed with staining by 0.1% crystal violet for 10 min at room temperature.
Fluorescence in situ hybridization (FISH)
Cellular LINC00669 localization was characterized using the fluorescence in situ hybridization kit from Ribo Bio (Guangzhou, China) according to the manufacturer’s instruction.
Cell apoptosis
NPC cell apoptosis were determined by flow cytometry using Annexin V-PE/7-AAD Apoptosis Kit (Abnova, #KA3809) according to the manual instruction.
Immunohistochemistry (IHC)
Tissues for IHC were fixed in 10% buffered formalin for 24 h and embedded in paraffin. The deparaffinized and rehydrated sections were blocked for endogenous peroxidase by incubation in 3% hydrogen peroxide followed with antigen retrieval in the boiling citrate buffer (10 mM, pH 6.0) for 10 min. The sections were then blocked with normal goat serum (1:10) and subject to incubation with anti-Ki67 monoclonal antibody (1:100, Dako, Glostrup, Denmark) or anti-Caspase 3 antibody (1:100, Abcam, #ab32351) overnight at 4 °C. Thereafter, the PBS cleaned sides were incubated with the biotinylated secondary antibody at 37 °C for 30 min, and subsequently incubated with a 1:200 streptavidin-biotin-peroxidase complex (Sigma, St. Louis). Reactive products were visualized with 3,3′-diaminobenzidene (DAB) as the chromogen, and nuclei were counter-stained with hematoxylin.
Immunofluorescence
NPC cells were fixed with 4% paraformaldehyde and permeabilized by 0.2% Triton X-100. After 1 h blocking with 1% bovine serum albumin at room temperature, the cells were incubated with anti-STAT1 (1:100) antibody overnight at 4 °C. Next day, the cells were washed off the unbound primary antibody and stained with donkey anti-rabbit IgG Alexa Fluor 488 secondary antibody (ThermoFisher, #A32790) for 1 h at room temperature.
In vivo xenograft experiments
Male BALB/c nude mice (8-week-old, n = 6 mice/group) from Beijing HFK Bioscience Co. Ltd. (Beijing, China) were maintained under pathogen-free conditions. After subcutaneously injected with 106 control or viral shRNA infected CNE-2 cells, the mice were monitored for tumor growth from 1 week after injection. Tumor size was calculated based on the formula of Volume = a x b2 × 0.52 (a, long diameter; b, short diameter).
RNA pulldown assay
Biotin-labeled full-length LINC00669 and antisense LINC00669 were synthesized in vitro using Biotin RNA Labeling Mix (Roche) and the Riboprobe Systems with T7 RNA polymerase (Promega). After DNase I treatment, the RNA probes were purified with RNeasy Mini Kit (QIAGEN). For each pulldown assay, 30 μg of biotin-labeled RNA probes were incubated with CNE-2 cell lysates at room temperature for 4 h followed by adding pulling down the binding protein partner with streptavidin magnetic beads (TermoFisher, USA) at 4 °C overnight. The proteins were then separated by electrophoresis and visualized with sliver staining. The unique bands pulled down by sense LINC00669 were subject to mass spectrometry and retrieved in human proteomic library.
RNA immunoprecipitation (RIP)
RIP assay was conducted in wildtype and LINC00669-depleted NPC cells using Magna RIP RNA-binding protein immunoprecipitation Kit (Millipore, MA) according to manufacturer’s instruction. Antibodies against the normal human IgG and SNRNP70 were used as negative and positive controls for RIP, respectively. The relative enrichment of LINC00669 was normalized to the amount of the enriched U1snRNA.
The common signatures in NPC were searched by overlapping the upregulated genes (
p ≤ 0.05, log2 fold change ≥2) in databases of GSE12452 and GSE53819 followed by the overall survival correlation analysis using the Signature-based statistics tool in GEPIA 2 (
http://gepia2.cancer-pku.cn/#index). In silico prediction of LINC00669-SOCS1 interaction was performed using online tools from catRAPID (
http://s.tartaglialab.com/page/catrapid_group).
Statistical analysis
Data are expressed as the mean ± standard deviation of three independent experiments. Two-tailed Student’s t-test was performed for detecting difference between two groups, while One-Way ANOV test was conducted for comparing two-group difference among the multiple groups using GraphPad Prism 6 software. P < 0.05 was considered as significant.
Discussion
Normal cell functions are directed by the finely tuned activation and inactivation of diverse cellular signaling pathways. The JAK-STAT signaling pathway is a chain of interactions between proteins in a cell, and is involved in fundamental processes such as immunity, cell division and cell death [
21]. One of the features of this pathway is characterized by the rapid activation and inactivation [
22]. Activated STATs accumulate rapidly in the nucleus, and within a few hours, the inactivated STATs return to the cytoplasm and prepare for the next round of signaling. Disruption of the cellular machineries that control the JAK-STAT signaling may lead to a variety of diseases, such as skin conditions, cancers, and disorders in the immune system [
23]. In this study, we revealed that LINC00669 participates in regulating the JAK-STAT signaling pathway negative feedback loop of SOCS1/STAT1, through which it plays an oncogenic role in NPC tumorigenicity.
The localization of lncRNAs within a cell is the primary determinant of their molecular functions. Cabili and colleagues used FISH to directly visualize the regional RNA expression and observed the complex localization patterns of 34 lncRNAs, which can be divided into five categories: large nuclear foci, large nuclear foci with single molecules scattered through the nucleus, predominantly nuclear without foci, cytoplasmic and nuclear, and predominantly cytoplasmic [
24]. Generally, nuclear lncRNAs act as chromatin-restricted regulators of gene transcription and chromatin structure [
25‐
28]. Instead, sufficient evidence shows that cytoplasmic localized lncRNAs perform parts suitable for the cytoplasm including translational regulation, signaling, and respiration. For example, lncRNAs interacting with microRNA are enriched in the cytoplasm [
29,
30]. In addition, lncRNAs that control protein stability or mRNA translation efficiency are also more common in the cytoplasm and ribosomes [
31‐
33]. In agreement to these assumptions, LINC0069, which is cytoplasmically enriched in NPC cells, does not directly set up cancerous transcriptome, but to regulate the JAK/STAT signaling pathway through the physical binding to inactivate its key negative feedback regulator SOCS1 in the cytoplasm.
SOCS proteins are potent JAK/STAT signaling pathway suppressors. All SOCS family members are featured with a SH2 domain and a brief C-terminal domain, namely SOCS box1 that is physically associated with the adaptor complex, elonginBC2 [
34,
35]. This connection facilitates the ubiquitination of signal intermediates by recruiting the E3 ubiquitin ligase scaffold (Cullin5) [
18]. Except for the common ubiquitin ligase activity, SOCS1 and SOCS3 are capable of a direct inhibition on JAK kinase activity through a short motif called Kinase Inhibitory Region [
18], which is however, unlikely true in NPC cells in that lacking of the direct interaction between SOCS1 and JAK. Instead, SOCS1 directs proteasomal degradation of STAT1 by catalyzing ubiquitination on the protein.
Constitutive activation of STAT1 and STAT3 has been reported in NPC tissues [
36]. However, the abnormal STAT3 activity in NPC should not be ascribed to the aberrant expression of LINC00669 since it remained stable regardless of the changes in LINC00669 expression. Instead, STAT1 is highly responsive to the cytosolic content of LINC00669, whose ectopic expression leads to increases in both total and phosphorylated STAT1. Inhibition of STAT1 can enhance the radiosensitivity of CNE-2R cells, and knockout STAT1 causes cell growth retardation and apoptosis both in vitro and in vivo [
37]. Therefore, we consider STAT1 as a key effector in LINC00669/SOCS1/JAK-STAT signaling cascade, which compiles cancerous transcriptome in NPC cells.
In conclusion, although it has been aware of the aberrant activation of the JAK/STAT signaling pathway in NPC tumors for long, its causes remain largely underexplored. We revealed in current study that lncRNA LINC00669 was upregulated in NPC cell cytoplasm, where it binds to SOCS1, and blocks its ubiquitination modification function toward STAT1. Interruption of such negative feedback machinery enhances STAT1 stability and facilitates its phosphorylation and thus nuclear translocation to initiate the proliferation and invasion-associated transcriptome. Our study not only provides a novel marker for diagnosis and prognosis of NPC, but also highlights it a potential target for therapy.
Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit
http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (
http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.