Vitamin B12 Deficiency Stimulates Osteoclastogenesis via Increased Homocysteine and Methylmalonic Acid
verfasst von:
Bart L. T. Vaes, Carolien Lute, Henk J. Blom, Nathalie Bravenboer, Teun J. de Vries, Vincent Everts, Rosalie A. Dhonukshe-Rutten, Michael Müller, Lisette C. P. G. M. de Groot, Wilma T. Steegenga
The risk of nutrient deficiencies increases with age in our modern Western society, and vitamin B12 deficiency is especially prevalent in the elderly and causes increased homocysteine (Hcy) and methylmalonic acid (MMA) levels. These three factors have been recognized as risk factors for reduced bone mineral density and increased fracture risk, though mechanistic evidence is still lacking. In the present study, we investigated the influence of B12, Hcy, and MMA on differentiation and activity of bone cells. B12 deficiency did not affect the onset of osteoblast differentiation, maturation, matrix mineralization, or adipocyte differentiation from human mesenchymal stem cells (hMSCs). B12 deficiency caused an increase in the secretion of Hcy and MMA into the culture medium by osteoblasts, but Hcy and MMA appeared to have no effect on hMSC osteoblast differentiation. We further studied the effect of B12, Hcy, and MMA on the formation of multinucleated tartrate-resistant acid phosphatase–positive osteoclasts from mouse bone marrow. We observed that B12 did not show an effect on osteoclastogenesis. However, Hcy as well as MMA were found to induce osteoclastogenesis in a dose-dependent manner. On the basis of these results, we conclude that B12 deficiency may lead to decreased bone mass by increased osteoclast formation due to increased MMA and Hcy levels.
Osteoporosis is a complex multifactorial disease with a strong genetic component, but lifestyle factors are also important for maintenance of bone mass. Nutrition is one of the factors that contributes to bone health. During the first decades of life, adequate intake of calcium and vitamin D is essential to establish peak bone mass (see [1, 2] and references therein). It has also been observed that nutritional deficiencies can cause impaired growth and skeletal abnormalities during childhood [3], while in adults inadequate intake of nutrients such as proteins, vitamins, and minerals has been associated with loss of bone quality [2, 4]. Nutritional deficiency is very common in the elderly, emphasizing that adequate nutrient intake may slow down the age-related loss of bone mass.
A challenge in nutrition research is to identify food components that contribute to the maintenance of bone health. During the last years, vitamin B12 has gained particular attention since a number of epidemiological studies have reported a correlation between B12 status and bone quality and fracture risk [5‐9]. The micronutrient B12 is involved as a cofactor in two enzymatic reactions [10]. The enzyme methionine synthase requires B12 for the remethylation of homocysteine (Hcy) into methionine. The other enzyme dependent on B12 is methylmalonyl-CoA mutase, which catalyzes the conversion of methylmalonyl-CoA into succinyl-CoA. As a consequence of B12 deficiency, these enzymatic reactions are impaired and Hcy and methylmalonic acid (MMA) accumulate [11].
Anzeige
In the elderly, B12 uptake is reduced and the prevalence of low B12 levels as well as moderate hyperhomocysteinemia and elevated serum MMA levels increases with age [12]. Several studies have reported that low plasma B12 levels are associated with reduced bone quality [5, 8, 9, 13, 14], but this relation has not been observed by others [15‐17]. More consistently, however, are the observations that increased Hcy may be a predictive factor for fracture risk [13‐15, 18‐21]. Also, elevated MMA levels have been associated with osteoporosis in the elderly [14] and low bone mineral density (BMD) in adolescents [6]. Together, these data suggest that B12, Hcy, and MMA are important factors in the development of osteoporosis.
The mechanisms by which B12 deficiency leads to impaired bone quality are still poorly understood. A number of studies have described the effects of B12 and Hcy on osteoblasts and osteoclasts [22‐27]. Here, we analyzed the effects of B12, Hcy, and MMA on human mesenchymal stem cells (hMSCs), the precursor cells of both osteoblasts and adipocytes. In theory, a number of mechanisms may underlie the reduced bone quality in cases of B12 deficiency. B12 may have a stimulatory effect on bone formation via enhanced osteoblast differentiation or improved bone matrix mineralization. B12 may also act in a negative way on osteoclast formation and function. It can be hypothesized that Hcy and MMA may act in an opposite manner, i.e., reduced osteoblast formation and increased osteoclast formation. In the present study we examined the effects of varying levels of B12, Hcy, and MMA on the differentiation of MSCs into osteoblasts as well as on osteoclastogenesis from bone marrow cultures.
Materials and Methods
Cell Culture
hMSCs were obtained from Lonza (Verviers, Belgium; male donors, lot numbers 6F3502 and 6F4392) and cultured in proliferation medium as supplied by the manufacturer. Murine MC3T3-E1 osteoblast precursor cell, obtained from the American Type Culture Collection (Manassas, VA), were maintained in α-MEM supplemented with 10% fetal bovine serum (FBS, Lonza), penicillin (100 U/ml), and streptomycin (100 μg/ml). Cells were maintained at 37°C in a humidified atmosphere containing 5% CO2. For differentiation experiments, cells were seeded at a density of 1.0 × 104/cm2 in proliferation medium. Two days after cell seeding, the medium was replaced with osteogenic or adipogenic differentiation medium. Osteogenic medium for hMSCs consisted of DMEM (Lonza) supplemented with 10% FBS, penicillin/streptomycin, l-glutamine, 100 nM dexamethasone, 50 μg/ml ascorbic acid, 10 nM vitamin D, and 12.5 mM β-glycerophosphate. Osteogenic medium for MC3T3-E1 cells consisted of DMEM/10% FBS supplemented with penicillin/streptomycin, l-glutamine, 50 μg/ml ascorbic acid, and 12.5 mM β-glycerophosphate.
The DMEM medium did not contain B12 according to the manufacturer’s specification sheet. Determination of B12 levels (Lab SHO, Velp, The Netherlands) in DMEM was below the detection limit of 40 pM, while FBS contained 125 pM B12.
Anzeige
Cells were cultured in osteogenic medium (B12-deficient) or osteogenic medium supplemented with B12 mimicking physiological levels (500 pM) or high-B12 supplementation (50 nM). Adipogenic differentiation was stimulated by culturing cells in DMEM/10% FBS supplemented with penicillin/streptomycin, l-glutamine, 1 μM dexamethasone, 1 μM rosiglitazone, 0.45 mM isobutylmethylxanthine, and 5 μg/ml insulin. During differentiation, the medium was refreshed twice a week.
dl-Homocysteine, B12 (cyanocobalamin), and MMA were purchased from Sigma-Aldrich (Zwijndrecht, The Netherlands).
Alkaline Phosphatase Assays
Alkaline phosphatase (ALP) cytochemical staining was performed using the Alkaline Phosphatase Sigma Diagnostics kit 85, according to the protocol supplied by the manufacturer. ALP activity was determined by measuring the formation of p-nitrophenol from p-nitrophenyl phosphate (PNPP, Sigma-Aldrich). Briefly, cells were cultured in 96-well plates, washed twice with PBS, and fixed in 4% paraformaldehyde/PBS for 10 minutes at 4°C. Subsequently, cells were incubated with PNPP for 15 minutes at 37°C, after which the reaction was terminated with NaOH and the absorbance of p-nitrophenol was measured at 414 nm. ALP activity was corrected for cell number as determined by a neutral red assay. Cells were incubated with neutral red dye diluted in PBS for 1 hour at 37°C. After washing with PBS, the dye was extracted from the cells with 0.05 M NaH2PO4 in 50% EtOH and absorbance was measured at 540 nm. The results of the neutral red assay revealed that cell numbers were not changed by the different culture conditions. Measurements were performed sixfold and averaged.
Mineralization Assays
Calcium concentrations were determined in a colorimetric assay with o-cresolphthalein complexone as a chromogenic agent. Cells were washed twice with PBS, after which calcium was extracted with 0.5 M HCl by incubating overnight with continuous shaking.
Calcium was quantified by mixing 50 μl of sample with 950 μl of assay solution containing calcium binding reagent (0.024wt% o-cresolphthalein and 0.25wt% 8-hydroxyquinone in H2O) and calcium buffer (500 mM 2-amino-2-methyl-1,3 propanediol in H2O) in a 1:1 volume mixture. The absorbance of each solution was measured at 575 nm. All reagents were obtained from Sigma-Aldrich.
Triglyceride Analysis
For quantification of lipid accumulation during adipogenesis, cells were grown in 24-well plates. Cells were washed twice with PBS, after which lipids were extracted by shaking for 10 minutes in 50 μl of 25 mM Tris–HCl (pH7.5)/1 mM EDTA, 40 μl of tert-butanol, and 10 μl of methanol. After drying the plates, triglycerides were determined spectrophotometrically using the triglyceride Liquicolor Monoreagent (Instruchemie, Delfzijl, The Netherlands). Triglyceride formation was expressed as fold changes averaged over biological duplicate measurements.
The accumulation of lipid droplets during adipogenic differentiation was visualized by staining with oil red O (ORO) in combination with ALP staining as described above. After staining for ALP, cells were washed twice with water and incubated with ORO staining solution containing two volumes of 50 mg ORO in 10 ml isopropanol and three volumes of water. After staining for 10 minutes at 37°C, cells were washed twice with water and pictures were taken.
RNA Isolation and Real-Time PCR
Total RNA was extracted from cells using TRIzol® Reagent (Invitrogen, Breda, The Netherlands), and RNA concentrations were determined by measuring the absorbance at 260 nm.
Anzeige
Total RNA (1 μg) was reverse-transcribed with the use of the cDNA synthesis kit (Promega, Leiden, the Netherlands). Subsequently, cDNA was amplified in a quantitative real-time PCR performed with the use of Platinum® Taq DNA polymerase (Invitrogen) and SYBR® green on an iCycler PCR machine (Bio-Rad, Veenendaal, The Netherlands). The data were normalized by measuring threshold cycle ratios between the candidate genes and a housekeeping gene, RPS27A (ribosomal protein S27a). The following primer pairs were used: RPS27A (forward), GTTAAGCTGGCTGTCCTGAAA, RPS27A (reverse), CATCAGAAGGGCACTCTCG; ALP (forward), GATGGACAAGTTCCCCTTCGT, ALP (reverse), GGACCTGGGCATTGGTGTT; COL1A1 (forward), GTCGAGGGCCAAGACGAAG, COL1A1 (reverse), CAGATCACGTCATCGCACAAC; IBSP (forward), GCAAAATTAAAGCAGTCTTCATTTTG, IBSP (reverse), TGCCTTGAGCCTGCTTCC; OPG (forward), AAGGGCGCTACCTTGAGATAG, OPG (reverse), GCAAACTGTATTTCGCTCTGGG.
Osteocalcin Assay
Osteocalcin in cultured medium form murine MC3T3-E1 cells was determined by an immunoradiometric assay (Immutopics, San Clemente, CA). The detection limit is 29 ng/ml, intra-assay variation is 4.55%, and interassay variation is 6.1%.
Determination of Hcy and MMA Levels
Total Hcy levels secreted by hMSCs and MC3T3 cells were determined in the cell culture medium by an automated HPLC method with reverse-phase separation and fluorescent detection as described earlier [28]. MMA concentrations in the culture medium were measured with the use of a liquid chromatography mass spectrometry method (LC-MS-MS).
Osteoclastogenesis
Osteoclast differentiation from bone marrow cultures was performed as described previously [29]. Whole bone marrow isolated from femurs of male C56/BL6 mice was cultured in 96-well plates at a density of 1.0 × 105 cells/well on plastic and on 650-μm-thick bovine cortical long bone slices. Cells on plastic were cultured in 150 μl of DMEM/5% FBS medium containing 30 ng/ml recombinant murine M-CSF (R&D Systems, Minneapolis, MN) and 20 ng/ml RANKL (Biovision, Mountain View, CA) to induce osteoclast formation. Cells on bone slices were cultured in 150 μl α-MEM/5% FCS supplemented with 30 ng/ml M-CSF and 20 ng/ml recombinant mouse RANKL (R&D Systems). Cells were cultured for 7 or 9 days in the presence of B12, Hcy, or MMA on plastic or for 6 days on bone slices. The medium was refreshed after 3 and 6 days. RANKL (Biovision) was kindly provided by Dr. R. Arends (Organon, Oss, The Netherlands).
Anzeige
Tartrate-Resistant Acid Phosphatase Assay
Osteoclast cultures were washed with PBS, fixed, and stained for tartrate-resistant acid phosphatase (TRAP) using the Sigma-Aldrich Acid Phosphatase Kit 387, according to the protocol supplied by the manufacturer. After staining, TRAP-positive cells with three or more nuclei were counted and pictures were taken. Student’s t-tests (two-tailed) were carried out to compare values between two groups. Differences between groups were considered significant at P < 0.05 (two-tailed).
Results
Vitamin B12 Deficiency Does Not Affect Osteoblast Differentiation
To examine the effect of B12 deficiency on MSC differentiation, bone marrow–derived hMSCs were used since these cells have been described as multipotent cells which efficiently differentiate toward the osteoblast and adipocyte lineage [30, 31]. We first investigated the effect of B12 on the onset of osteoblast differentiation as characterized by expression of ALP [32]. To exclude the possibility that substantial baseline levels of B12 were present in the culture medium, a quantitative measurement of B12 levels was carried out. Baseline levels were lower than 15 pM, which is far below the B12 deficiency level of 200 pM [13]. Culturing hMSCs in osteogenic differentiation medium resulted in a homogeneous population of ALP-positive cells after 9 days of culture, as visualized by cytochemical staining for ALP (Fig. 1a). Supplementation with 50 nM B12 had no effect on osteoblast formation from hMSCs when characterized by cytochemical staining. An identical result was observed with physiological concentration of 500 pM (not shown). Similarly, a quantitative assay revealed a strong induction of ALP activity in osteogenic medium compared to control medium, but no effect of B12 on ALP activity was detected (Fig. 1b), even when cells were treated with concentrations up to 5 μM (not shown). ALP activity was not changed by B12 by repeating the experiment with cells obtained from another donor (not shown).
Fig. 1
The effect of B12 on MSC differentiation. a Cytochemical analysis of ALP expression in hMSCs cultured in control medium, in osteogenic differentiation medium (OB), or in OB supplemented with 50 nM B12 for 4, 7, and 9 days. b Quantification of ALP expression in hMSCs cultured in OB medium supplemented with B12. Measurements were performed sixfold, averaged, and normalized for cell numbers by a neutral red assay. Error bars indicate standard deviation. c Triglyceride formation by hMSCs was quantified after 7 (white bars) and 9 (dashed bars) days of differentiation in control medium, adipogenic differentiation (AD) medium, or AD medium supplemented with B12. Triglyceride formation is represented as fold change relative to control at t7 and t9. Adipocyte formation at t7 was indicated by the accumulation of lipid droplets that stain with oil red O (inset). d Calcium release by hMSCs after 7, 9, or 11 days of culture in OB medium supplemented with 0, 0.5, or 50 nM B12. Calcium was determined in a colorimetric reaction and quantified by measuring the absorbance at 575 nm. e Gene expression levels of osteoblast markers ALP, COL1A1, IBSP, and OPG in hMSCs cultured over a period of 9 days in control medium (♦), OB medium (■), or OB medium supplemented with 50 nM B12 (▲). Measurements were performed in duplicate, after which relative expression was calculated by correction for expression of the housekeeping gene RPS27A. f ALP activity of murine MC3T3 osteoblast precursor cells in control medium, OB medium, or OB supplemented with B12 over a period of 4 days. g Osteocalcin secretion in culture medium by MC3T3 cells cultured for a period of 20 days in control medium (♦), OB medium (■), or OB medium supplemented with 0.5 nM B12 (•) or 50 nM B12 (▲)
×
To study the effect of B12 on an alternative differentiation pathway of hMSCs, these cells were cultured in adipogenic medium and triglyceride content was determined after 7 and 9 days of differentiation (Fig. 1c). A strong increase in triglyceride formation was observed in adipogenic medium compared to control medium, but the triglyceride content was not significantly changed when B12 was supplied to the medium. These data show that the onset of hMSC differentiation toward osteoblasts or adipocytes is not influenced by B12 deficiency.
We further examined the effect of B12 on osteoblast maturation by measuring calcium deposition in the extracellular matrix after 7, 9, and 11 days of differentiation. The data presented in Fig. 1d show that hMSCs strongly accumulated calcium in the matrix under osteogenic conditions. B12 supplementation of 0.5 or 50 nM had no effect on calcium levels, a result that was verified by means of a von Kossa staining (not shown), indicating that B12 has no effect on matrix mineralization.
Anzeige
To analyze B12 effects in more detail, osteoblast gene expression was determined by means of quantitative real-time PCR (Q-PCR). Expression of the osteoblast marker genes ALP, COL1A1 (collagen type 1 alpha 1), IBSP (integrin-binding sialoprotein or bone sialoprotein), and OPG (osteoprotegerin) was determined in cells cultured for 2, 4, 7, and 9 days in control medium, osteogenic medium, or osteogenic medium supplemented with 50 nM B12. Figure 1e shows that the mRNA levels of these genes increased in osteogenic medium but that gene expression was not modulated by B12 supply.
Taken together, these results show that B12 has no effect on osteoblast differentiation of hMSCs. To exclude a cell type–specific effect, the murine preosteoblast cell line MC3T3-E1 was tested for its response to B12. Figure 1f shows that ALP activity was induced in osteogenic medium after 4 days but, as in hMSCs, no effect of B12 could be detected, indicating that B12 had no effect on the early phase of MC3T3-E1 differentiation. As a marker for osteoblast maturation, secreted osteocalcin levels were determined in the medium of differentiating MC3T3 cells. As can be seen in Fig. 1g, osteocalcin secretion was strongly increased in osteogenic medium compared with control medium during a 3-week culturing period. However, no changes in osteocalcin secretion were detected under the influence of different B12 levels.
Vitamin B12 Deficiency Increases Hcy and MMA Secretion by Osteoblasts
To investigate whether B12 deficiency correlates with Hcy and MMA secretion by osteoblasts, total Hcy (tHcy) and MMA secreted in the culture medium were measured during osteoblast differentiation of hMSCs and MC3T3-E1 cells (Fig. 2). As can be seen in Fig. 2a, tHcy secreted by hMSCs in osteogenic medium increased during a differentiation period of 10 days. After 10 days of differentiation, secreted tHcy levels were reduced by 20% when the cells were cultured in the presence of 50 nM B12. This result shows that lower B12 levels result in higher tHcy secretion by osteoblasts. As in hMSCs, lowering B12 levels caused increased tHcy secretion by MC3T3-E1 (Fig. 2b). During a 20-day period of differentiation, a dose-dependent increase in tHcy secretion was observed when cultures were treated with 50, 0.5, or 0 nM B12.
Fig. 2
The effect of B12 on Hcy and MMA secretion by osteoblasts. tHcy and MMA levels were determined during differentiation of hMSCs (a, c) and MC3T3 cells (b, d) for a period of 10 and 20 days, respectively. tHcy and MMA were determined at the indicated time points and are shown as cumulative values. Cells were cultured in OB medium (♦), or OB medium supplemented with 0.5 nM B12 (■) or 50 nM B12 (▲)
×
Secretion of MMA in the culture medium of hMSCs appeared to be unchanged by varying B12 levels during a differentiation period of 10 days (Fig. 2c). In MC3T3-E1 cells, however, secreted MMA levels showed a dose-dependent response to B12 (Fig. 2d). MMA secretion was attenuated in the presence of 0.5 and 50 nM B12, and the effect increased during the progress of differentiation. The observed differences between supplementation of 0 and 0.5 nM B12 indicate that prolonged B12 deficiency results in increased Hcy and MMA secretion by osteoblasts.
Hcy and MMA Do Not Reduce Osteoblast Differentiation
To analyze the effect of Hcy on the onset of osteoblast differentiation, ALP activity was determined in hMSCs cultured in osteogenic medium in the presence of different concentrations of Hcy. Figure 3a shows that Hcy concentration up to 500 μM had no effect on ALP activity after 4 days of differentiation. Also, no effect was found at other time points (data not shown). We further investigated the effect of Hcy on mineral deposition by differentiating hMSCs. Quantification of the amount of calcium released from the extracellular matrix revealed no difference due to the presence of an increasing amount of Hcy (Fig. 3b), and an identical result was obtained by von Kossa staining (not shown).
Fig. 3
The effect of Hcy and MMA on osteoblast differentiation. Quantification of ALP activity in hMSCs in OB medium supplemented with Hcy (a) or MMA (c) after 4 days of differentiation. Measurements were performed sixfold, averaged, and normalized for cell numbers by a neutral red assay. b Calcium release assay by hMSCs after 10 days (white bars) and 12 days (hatched bars). Cells were cultured in OB medium in the presence of Hcy 0–500 μM. Calcium was determined in a colorimetric reaction and quantified by measuring the absorbance at 575 nm. Error bars indicate standard deviation (n = 4)
×
To study the effect of MMA levels on osteoblast differentiation, ALP activity was analyzed in hMSCs after 4 days of differentiation (Fig. 3c). Similar to the results obtained with Hcy, no effect of MMA on ALP activity was observed, indicating that Hcy and MMA do not modulate osteoblast differentiation of MSCs.
Hcy and MMA Stimulate Osteoclastogenesis
We next examined the effects of B12, Hcy, and MMA on the formation of osteoclasts from whole bone marrow cultures. To characterize the effect of these molecules on osteoclast formation, multinucleated TRAP-positive cells were counted and shown as average number of osteoclasts per well. B12 was found to have no effect on the formation of multinucleated TRAP-positive cells (Fig. 4a). However, supplementation with Hcy resulted in a dose-dependent increase in osteoclast formation (Fig. 4a). A low dose of 5 μM Hcy already led to a 2.2-fold increase in the average number of multinucleated osteoclasts per well. The number of osteoclasts further increased with higher concentrations of Hcy, showing a significant increase (P < 0.05) at 50 μM Hcy (Fig. 4a). A very strong increase was observed in the presence of 500 μM Hcy (Fig. 4a, b). Similar to Hcy, an increase in osteoclast numbers was observed when cells were cultured in the presence of MMA (Fig. 4c). These data therefore show that both Hcy and MMA are able to increase osteoclast formation. To analyze whether these effects of Hcy and MMA could be observed on osteoclast formation in a more physiological situation, bone marrow cells were cultured on bone slices. As can be seen in Fig. 4d, a dose of 200 μM Hcy stimulated osteoclast formation. While MMA was able to increase osteoclast formation on plastic, the effect on bone slices was not significant at a concentration of 200 μM MMA.
Fig. 4
The effects of B12, Hcy, and MMA on osteoclast formation. Mouse bone marrow cells cultured with M-CSF and RANKL were treated with different concentrations of B12, Hcy, and MMA. After TRAP staining, TRAP-positive multinucleated (n > 2) cells (MNCs) were counted. a Number of MNCs per well in 96-well plates after 7 days of culture (n = 6 mice, average number of MNCs). Hcy showed a significant induction of MNCs at 50 μM (*P < 0.05, **P < 0.005) and higher concentrations. b Formation of MNCs in the presence of high B12 and Hcy concentration. Arrows indicate TRAP-positive MNCs. Note that at 500 μM Hcy the number of nuclei per cell is strongly increased. c Number of MNCs per well in the presence of MMA (n = 6 mice, each measurement performed in duplicate, 9 days of culture). d Osteoclasts per millimeter squared on bone slices (n = 5 mice, each measurement performed in duplicate, 6 days of culture). e Reduction of Hcy-induced osteoclast formation by B12 (n = 6 mice, 9 days of culture). Error bars indicate standard error of the mean
×
We finally examined whether B12 supplementation affects osteoclastogenesis in case of increased Hcy (Fig. 4e). A dose of 100 μM Hcy caused a significant induction of osteoclast formation, which was not seen when 50 nM B12 was added. Thus, while under standard culture conditions B12 had no effect on osteoclast formation, B12 was able to reduce the Hcy-induced osteoclastogenesis.
Discussion
We and others have previously shown that B12 deficiency and increased Hcy and MMA levels are associated with impaired bone health in the elderly [6, 8, 9, 14, 21]. In order to elucidate the molecular mechanism behind these clinical observations, we now examined the effects of B12, Hcy, and MMA on the differentiation of bone marrow cell cultures.
Our study is the first that has analyzed the effects of B12, Hcy, and MMA on MSC differentiation. A number of previous studies have appeared with contradictory results with respect to the effect of B12 on other osteoblast model systems. A stimulating effect on ALP expression was reported in human rib–derived osteoprogenitors [25], rat osteosarcoma cells [25], and chicken calvaria–derived osteoblasts [22]. More recently, it was shown that simultaneous reduction of B12, B6, and folic acid levels had no influence on ALP expression in human osteoblasts [24].
Since MSCs are a more relevant model system to cover all stages of osteoblast differentiation, we extensively studied the effect of B12 on these cells. Furthermore, we used mouse MC3T3 osteoblasts to study the effect of B12 on cells which are at a later stage of osteoblast differentiation. We found that B12 (1) did not affect the onset of osteoblast differentiation, (2) did not alter the stem cell switch, (3) did not affect matrix protein formation, and (4) did not affect matrix calcification. However, B12 significantly reduced Hcy and MMA secretion by differentiating osteoblasts. Importantly, increased Hcy and MMA had no effect on osteoblast differentiation or function, indicating that B12 deficiency neither directly nor indirectly alters bone formation by osteoblasts.
Based on these results, it is reasonable to expect that the B12-associated bone loss as observed in clinical studies is mediated by osteoclasts. Indeed, we have found that elevated levels of Hcy as well as MMA had a stimulatory effect on the formation of multinucleated TRAP-positive osteoclasts. In contrast, various levels of B12 did not affect the formation of osteoclasts. Gene expression analysis in osteoblasts revealed that OPG expression was not affected by B12, while expression of RANKL could not be detected in hMSCs (data not shown). Our data are therefore in agreement with a study in which no relation was found between Hcy levels and OPG and RANKL in peri- and postmenopausal women [33]. As OPG and RANKL are known to regulate osteoclastogenesis, these results imply that B12 deficiency does not indirectly affect osteoclast formation via RANKL and OPG secretion. Together, our data suggest a mechanism by which B12 deficiency leads to increased Hcy and MMA levels in the bone microenvironment, thereby stimulating the formation of osteoclasts.
The effect of MMA on osteoclastogenesis has not been described to date. The stimulatory effect of low concentrations of Hcy on osteoclast formation is in agreement with a study by Koh and colleagues [26]. These data provide in vitro support for our previous observations that low B12 levels (<200 pM) and increased Hcy (>15 μM) in women result in elevation of urinary secreted deoxypyridinoline levels, which is a marker for collagen degradation, a measure for bone resorption [13]. Our data indicate that not only Hcy but also MMA may contribute to bone loss in case of B12 deficiency.
Our study implies that, with respect to clinical applications, B12 may reduce osteoclast formation in case of high Hcy concentrations and that reduction of Hcy and MMA levels may be a promising strategy to prevent the increased fracture risk in the elderly. Animal studies in mice and rats have already revealed that modulating Hcy levels by means of methionine-enriched diets caused an increase in bone resorption [34, 35], indicating that nutrient intervention can modulate bone resorption via alteration of Hcy levels. In the elderly, Hcy levels can effectively be reduced by means of B12 and folate supplementation [36‐38]. The novel observation that MMA is also able to induce osteoclast formation indicates that not only Hcy but also MMA levels need to be attenuated in order to prevent osteoporosis via nutrient supplementation. It has previously been shown that B12 supplementation leads to a reduction in plasma MMA levels in elderly with B12 deficiency [36, 39]. To date, studies on the effect of B12 and/or folate supplementation on bone health are limited. BMD and bone formation markers were found to increase in a group of osteoporotic patients after 6 months of B12 and calcium supplementation [40]. A larger study in patients after stroke showed that Hcy levels, fracture risk, and BMD were reduced after treatment with B12 and folate for 2 years [41]. However, another study reported that reduction of Hcy levels via B12 supplementation in healthy elderly appeared to have no effect on markers of bone turnover in a 2-year study [42]. Two-month supplementation with folate in healthy individuals led to a decrease in Hcy, but no effect on bone turnover markers was found [43]. Thus, the results of these clinical studies and observations are still inconclusive with respect to the effectiveness of B12 supplementation in maintaining bone health.
It will be of most relevance to examine whether reducing Hcy and MMA in a normal aging population may prevent the occurrence of osteoporosis. Further research and intervention studies will be required to determine to what extent B12 and folate supplementation may prevent bone loss by reducing Hcy- and MMA-induced osteoclast activity during aging and in case of B12 deficiency.
Acknowledgment
We kindly thank Ms. Dinny van Oppenraaij (RU Nijmegen) for technical assistance. This research was financially supported by the Graduate School VLAG and the Jan Dekkerstichting/Ludgardine Bouwmanstichting Amsterdam.
Open Access
This article is distributed under the terms of the Creative Commons Attribution Noncommercial License which permits any noncommercial use, distribution, and reproduction in any medium, provided the original author(s) and source are credited.
Open AccessThis is an open access article distributed under the terms of the Creative Commons Attribution Noncommercial License (https://creativecommons.org/licenses/by-nc/2.0), which permits any noncommercial use, distribution, and reproduction in any medium, provided the original author(s) and source are credited.
Vitamin B12 Deficiency Stimulates Osteoclastogenesis via Increased Homocysteine and Methylmalonic Acid
verfasst von
Bart L. T. Vaes Carolien Lute Henk J. Blom Nathalie Bravenboer Teun J. de Vries Vincent Everts Rosalie A. Dhonukshe-Rutten Michael Müller Lisette C. P. G. M. de Groot Wilma T. Steegenga
Ob bei einer Notfalloperation nach Schenkelhalsfraktur eine Hemiarthroplastik oder eine totale Endoprothese (TEP) eingebaut wird, sollte nicht allein vom Alter der Patientinnen und Patienten abhängen. Auch über 90-Jährige können von der TEP profitieren.
Wenn unter einer medikamentösen Hochdrucktherapie der diastolische Blutdruck in den Keller geht, steigt das Risiko für schwere kardiovaskuläre Ereignisse: Darauf deutet eine Sekundäranalyse der SPRINT-Studie hin.
Insektenstiche sind bei Erwachsenen die häufigsten Auslöser einer Anaphylaxie. Einen wirksamen Schutz vor schweren anaphylaktischen Reaktionen bietet die allergenspezifische Immuntherapie. Jedoch kommt sie noch viel zu selten zum Einsatz.
Beginnen ältere Männer im Pflegeheim eine Antihypertensiva-Therapie, dann ist die Frakturrate in den folgenden 30 Tagen mehr als verdoppelt. Besonders häufig stürzen Demenzkranke und Männer, die erstmals Blutdrucksenker nehmen. Dafür spricht eine Analyse unter US-Veteranen.
Update Innere Medizin
Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.
