Background
The cytokine interleukin 1 beta (IL-1β) is a potent mediator in response to infection and injury [
1]. It is produced mainly by blood monocytes, but also by macrophages, dendritic cells and a variety of other cells in the body [
2,
3]. A minute amount of IL-1β
in vivo can evoke fever, hypotension, release of adrenocorticotrophic hormone and production of cytokines which in turn induce various inflammatory and immune responses.
Increased IL-1β production has been reported in patients with various infections, inflammation, trauma (surgery), ischemic diseases, tumors, intravascular coagulation, autoimmune disorders, UV radiation, graft-versus-host disease, transplant rejection, and in healthy subjects after strenuous exercise [
4,
5]. An increasing IL-1β production was observed in patients with Alzheimer's disease and a possible role for IL-1β in the release of the amyloid precursor protein was proposed [
6]. Significant elevations of plasma IL-1β have been detected in healthy humans injected with lipopolysaccharide (LPS) and in patients with septic shock and burns [
7]. Correlations have been found between plasma IL-1β levels and severity of acute attacks of rheumatoid arthritis, thermal burns, and mortality in septic shock [
8]. Agents that reduce the production and activity of IL-1β are likely to have an impact on clinical applications. In fact, IL-1Ra, a blocker of IL-1β transduction, has been administered to patients with septic shock, rheumatoid arthritis, steroid resistant graft-versus-host disease, AML, CML and so on [
8‐
11].
Development of a method to monitor IL-1β gene promoter activity
in vivo will facilitate its use in the study of related diseases and preclinical evaluation of anti-inflammatory drugs. For this purpose, in this paper, we have established a transgenic mouse model using the human IL-1β gene promoter [
12] to direct the expression of luciferase reporter gene. When combining with the approach of "biophotonic" imaging using a highly light-sensitive camera system [
13‐
15], this model allows us to non-invasively study the transcriptional activity of IL-1β gene promoter in real time. Our data indicate that human IL-1β gene promoter functions in transgenic mice and this model can be used to study transcriptional regulation of the IL-1β gene expression in the inflammatory process and evaluate the effects of anti-inflammatory agents on IL-1β gene induction
in vivo.
Discussion
We have generated a cHS4I-hIL-1βP-Luc transgenic mouse model for monitoring hIL-1β gene transcriptional activity during inflammation. Using an
in vivo bioluminescence imaging system, we demonstrated that luciferase signals in the cHS4I-hIL-1βP-Luc transgenic mice were dramatically induced in the whole body (especially in liver, duodenum, lung, kidneys, stomach, brain, and thymus) following treatment with LPS. Direct quantification of luciferase signals using the LivingImage software yielded data comparable to those obtained by the conventional luminometer assay performed on excised and homogenized tissues. In an arthritis and a CHS reaction model, luciferase signals were induced locally in the treated area. Dexamethasone, a well known blocker of IL-1β production [
16‐
18], suppressed the induced expression of luciferase in transgenic mice in these inflammation models. These data indicate that cHS4I-hIL-1βP-Luc mice are useful as a sensitive and convenient model for monitoring IL-1β gene expression during the disease process in a broad range of inflammatory conditions and for evaluating the effects of anti-inflammatory drugs.
Conventional methods for monitoring IL-1β gene expression rely mostly on either measuring circulating levels of IL-1β in the serum or mRNA expression in tissues. Compared with these methods, the approach reported in this study is convenient and sensitive, and more importantly, with this approach the kinetics as well as the anatomical location of IL-1β gene expression can be conveniently studied and use a minimal number of animals. This is extraordinarily useful in monitoring both systematic and local inflammation, such as sepsis, arthritis, and chemical-induced skin toxicity.
The pattern of LPS-induced luciferase expression in transgenic mice was generally in agreement with the endogenous murine IL-1β mRNA expression. However, the fold of increase did not match exactly between luciferase activity and endogenous IL-1β mRNA. This might be explained by the facts that the promoter for the luciferase is from human and IL-1β mRNA level and protein level are often not in linear correlation. In addition, translational regulation of IL-1β mRNA and luciferase mRNA, as well as posttranslational regulation of IL-1β protein and luciferase protein, may also be different. So it should be note that the signal of luciferase in the reporter mice may be not consist with the IL-1β protein level since the regulation of IL-1β protein translational and posttranslational process is rather complex in vivo[
19]. However, these differences do not affect the application of our transgenic model in inflammation research to monitor the mRNA level of IL-1β. In the cHS4I-hIL-1βP-Luc transgenic mice described here, there were no clear gender differences in both baseline of luciferase signals and response to LPS where nearly identical kinetics and signal intensity were observed. This result is in agreement with the results reported previously [
20].
IL-1β have been found in the synovial fluid recovered from inflamed joints of rheumatoid arthritis patients [
21]. We clearly demonstrated that local administration of zymosan into knee joints triggered induction of luciferase expression in the joints, which correlated with the increases in both IL-1β mRNA and protein in zymosan-treated knee joint tissue reported earlier [
22]. It is believed that locally synthesized IL-1β by synovial cells in inflamed joints plays a key role in the pathogenesis of rheumatoid arthritis, and IL-1β can be used as a marker for evaluating the efficacy of therapeutics for rheumatoid arthritis.
Luciferase expression was also clearly induced in the ear of the transgenic mice in a CHS model. Contact hypersensitivity is a two-phase process. The induction phase begins on initial epicutaneous application of a hapten (low-molecular-weight chemical), resulting in activation and rapid lymphocyte proliferation. The challenge or elicitation phase occurs when sensitized individuals are re-exposed to the sensitizing antigen. This local CHS reaction is characterized by infiltrating T lymphocytes, macrophages, and neutrophils. It has been reported that mice with oxazolone treatment in the ear showed ear swelling and increased expression levels of IL-1β, IL-4, IL-18 and GM-CSF [
23,
24]. In line with these reports, we showed that luciferase expression was induced in the ear of the transgenic mice at day 1 after oxazolone challenge and the expression level correlated with the increase in ear thickness.
The regulatory region for human IL-1β gene expression was found to be distributed over several thousand basepairs upstream and a few basepairs downstream from the transcriptional start site [
25]. There are two independent enhancer regions, -2782 to -2729 and -2896 to -2846 that appear to act cooperatively [
26]. The latter contains a cAMP response element, whereas the former is a composite cAMP response element (NFIL-6) that is responsive to LPS. The 80-bp fragment (-2800 to -2720) is required for transcription and contains, in addition to a cAMP response element, an NF-κB-like binding site. Activating protein-l (AP-l) sites also participate in endotoxin-induced IL-1β gene expression. Proximal promoter elements have also been identified between -131 and +14 [
26]. Sequences in this region contain binding sites for the novel nuclear factor NFβA [
27], which appears to be similar to nuclear factors termed NFβl and NFβ2 [
26]. This proximal promoter is required for maximal IL-1β gene expression. The nucleotide binding sequences of NFβA are found to be identical to those of the transcription factor Spi-1/PU.1 [
28,
29], a well-established NF in cells of myeloid and monocyte lineage [
30]. The requirement for Spi-1/PU.1 for IL-1β gene expression imparts its tissue specificity. Human blood monocytes, which constitutively express Spi-l/PU.1, are exquisitely sensitive to LPS inducible IL-1β gene expression. In our case, the promoter region used for driving luciferase expression in the transgenic mice is 4.5-kb long which contains all the cis-elements discussed above. The chicken HS4 insulator (cHS4I) upstream of the hIL-1βP may eliminate the transgenic chromosomal insertion site effect on transgene expression[
31]. Therefore, the expression of the luciferase gene in the transgenic mice was expected to reflect the natural pattern of IL-1β gene expression.
Bioluminescence imaging techniques have been used to study the expression of several inflammatory factors in reporter mice, such as NF-κB-binding cis elements[
13,
15], the inducible NO synthase gene(iNOS)[
32], the vascular endothelial growth factor-2 (VEGFR2)[
33]. These reporter systems can be successfully used to monitor and quantify different inflammatory processes in vivo. Together with our model in this paper, we believe these reporter mice systems will facilitate us a better understanding of the molecular mechanism of different diseases.
Conclusion
The cHS4I-hIL-1βP-Luc transgenic mouse, with its IL-1β promoter driven luciferase expression, is able to provide information about anatomical sites of IL-1β expression in an inflammatory process. The induction was observed in the whole body (especial in liver, lungs, and duodenum) in a LPS-sepsis model, and was restricted to the treated joints and ears in a zymosan-arthritis model and in an oxazolone-CHS model, respectively. Treatment with dexamethasone, a proven IL-1β expression blocker, significantly suppressed LPS- or zymosan-induced IL-1β promoter-driven luciferase expression. As IL-1β induction is featured in the pathogenesis of a number of acute and chronic inflammatory diseases, the cHS4I-hIL-1βP-Luc mouse is a useful tool not only for tracking various inflammatory processes in vivo, but also for testing the efficacies of therapeutic compounds that are targeted to inflammatory diseases, especially those that involve induction of IL-1β expression.
Methods
Reagents
Bacterial LPS (from Escherichia Coli Serotype 0127:B8), zymosan A (a cell wall preparation from Saccharomyces cerevisiae), dexamethasone and oxazolone were purchased from Sigma-Aldrich (St. Louis, MO, USA). Luciferin (Biosyth, Basel, Switzerland) was dissolved in PBS at 15 mg/ml and stored at -20°C.
Generation of cHS4I-hIL-1βP-Luc transgenic mice
A 4.5-kb
Kpn I-
Bgl II fragment of human IL-1β gene promoter (hIL-1βP) was isolated from human genomic DNA by PCR amplification according to the literature [
12]. The promoter fragment was verified by DNA sequencing and cloned into the polylinker sites
Kpn I and
Bgl II of pGL3-Basic (Promega) to direct the expression of luciferase reporter gene (hIL-1βP-Luc). The resulting plasmid was named as pGL3-hIL-1βP-Luc. In order to eliminate the transgenic chromosomal insertion site effect on transgene expression[
31], the
Not I-
Kpn I fragment of the chicken HS4 insulator (cHS4I) was cloned into the
Not I and
Kpn I sites upstream to hIL-1βP. Then, the constructed cHS4I-hIL-1βP-Luc cassette was cut and subcloned into the
Apa I and
Sal I sites of plasmid pGFP-1. The cHS4I-hIL-1βP-Luc transgenic cassette (Fig.
1A) was cut out by
Apa I and
Mlu I, and used to generate transgenic mice in the C57XCBA background by standard microinjection techniques. The transgenic mice were bred to BALB/c for 5 generations before testing. All animals were housed in a specific pathogen-free environment in accordance with institutional guidelines for animal care. Animal handling was performed in accordance with institutional guidelines and approved by the local institutional animal care and use committee.
Genotyping of cHS4I-hIL-1βP-Luc transgene in mice
Transgenic founders and their offspring were identified by PCR using the forward-luc (5' TTCCGCCCTTCTTGGCCTTTATGA 3') and reverse-luc (5' CAGCTATTCTGATTACACCCGAGG 3') primers specific for luciferase gene.
In vivo imaging
In vivo bioluminescent imaging was performed using an IVIS imaging system (Xenogen, Alameda, CA) as previously described. 150 ul sodium salt luciferin (dissolved in PBS) was injected into the intraperitoneal cavity at a dose of 150 mg/ml. Mice were anesthetized with isoflurane/oxygen and placed on the imaging stage. 12 min after luciferin injection, mice were imaged for 1 to 5 min. Photons emitted from specific regions were quantified using a LivingImage software (Xenogen). In vivo luciferase activity was presented in photons emitted per second.
Functional screening of cHS4I-hIL-1βP-Luc transgenic lines
For primary functional screening of transgenic lines, the luciferase gene PCR positive mice were imaged for expression of the luciferase transgene without any treatment or at 5 h after LPS injection at the does of 3.0 mg/kg. The criteria used for screening available transgenic lines were: (1) lower basal luciferase expression in normal status and (2) higher induced luciferase expression in whole body after LPS injection.
Acute septic shock model by intraperitoneal LPS injection
The acute septic shock model was produced by i.p. injection of LPS (3.0 mg/kg) into cHS4I-hIL-1βP-Luc transgenic mice at the age of 2–3 mo. Control mice were injected with saline. At selected time points after the treatment, mice were i.p. injected with luciferin and imaged 12 min later with the IVIS imaging system described above. To test the effect of dexamethasone on LPS-triggered luciferase expression, male mice were cotreated with dexamethasone and LPS, and the control mice were injected with saline and LPS. The luciferase signal was monitored through imaging.
Acute arthritis model by intra-articular administration of zymosan
Zymosan A was suspended in sterile saline containing 5% glucose at a concentration of 30 mg/ml. Female cHS4I-hIL-1βP-Luc mice at the age of 2–3 mo were anesthetized with isoflurane. Then the hind legs of mice were shaved and the skin was sterilized with 70% ethanol. The right knee tendon was exposed and 10 μl of zymosan A suspension was intra-articularly injected through the tendon with a 25-gauge needle. The left rear knees of the same mice were intra-articularly injected with 5% glucose in saline (sham control). Mice were imaged at selected time points after the injection. Separately, mice were pretreated with dexamethasone (50 μg/mouse i.p.) half hour before the zymosan administration, and the luciferase signal was monitored through imaging.
Female cHS4I-hIL-1βP-Luc mice, 3–6 mo of age, were shaved in the thorax area and treated topically with 50 μl of 2% oxazolone solution (in acetone/olive oil (4/1, vol/vol)). Six days after sensitization, the right ears were challenged by topical application of 10 μl of 1% oxazolone solution, and the left ears were treated with vehicle (acetone/olive oil, 4:1 vol/vol) alone. The extent of inflammation was assessed by measuring ear thickness with a micrometer. Bioluminescent images were collected on the day of sensitization (day -6), the day of challenge (day 0), and at day 1 and 30 after treatment.
Luciferase activity assay in vitro
Luciferase activity was assayed using the Luciferase Assay System (Promega) on a Luminometer (Lumat LB9507, EG&G, Berthold, Germany).
Total RNA isolation
Female cHS4I-hIL-1βP-Luc mice, 3–6 mo of age, were treated with i.p. injection of LPS (3.0 mg/kg). Control mice were injected with saline. After 5 h, total RNA was isolated from selected mouse tissues using TRIZOL (Invitrogen, Paisley, Scotland, UK) according to the manufacturer's instruction and the extracted RNAs were kept at -80°C prior to use.
Real-time reverse transcription-polymerase chain reaction (real time RT-PCR)
Two μg of the RNA samples isolated from the LPS-treated female cHS4I-hIL-1βP-Luc mice was reverse-transcribed into cDNA using M-MLV reverse transcriptase (Promega) in a final reaction volume of 25 μl. For real time PCR amplification, 0.5 μl of cDNA per reaction and 0.2 μM primer sets were used. Reaction conditions were as follows: 94°C/4 min; 51 cycles of 94°C/30 s, 60°C/30 s, 72°C/30 s; and 72°C/10 min. Evagreen used for detecting PCR products was purchased from Molecular Probes (Gentaurer, Brussels, Belgium). Amplification and detection of Evagreen were performed with RG-3000 Real Time Thermal Cycler (Corbett. Research, Sydney, Australia). The expression of the mRNA for the murine β-actin gene was used as a reference to normalize expression levels. All data were expressed relative to β-actin to compensate for any difference in sample loading, and all experiments were performed in triplicates. Data were obtained as threshold cycle (Ct) values (PCR cycle numbers at which fluorescence was threshold) using Rotor-Gene Real-Time Analysis Software 6.0 and used to calculate ΔCT values (ΔCT is the Ct of the target gene subtracted from the Ct of the housekeeping gene). Fold changes relative to saline controls were determined by the 2-ΔΔCT method.
Primers for real time PCR were synthesized as the sequences listed below (Sangon, Shanghai, China). The forward murine IL-1β primer used was 5' AAGGAGAACCAAGCAACGACAAAA 3', the reverse murine IL-1β primer used was 5' TGGGGAACTCTGCAGACTCAAACT 3'. The forward murine β-actin primer used was 5' CCTGTATGCCTCTGGTCGTA 3', the reverse murine β-actin primer used was 5' CCATCTCCTGCTCGAAGTCT 3'.
Western blot analysis of mIL-1β and luciferase activity assay in tissues
Mouse tissues were removed and homogenized in 3 volumes of phosphate buffered saline (PBS) containing a protease inhibitor cocktail (Roche Applied Science, Indianapolis, IN, USA) and lysed with passive lysis buffer (Promega). After centrifugation at 14,000 rpm for 10 min at 4°C, the supernatant was collected. Luciferase activity was measured using a luminometer and the Luciferase Assay System (Promega). Protein concentration in lysate was estimated by Bradford reagent (Sangon, Shanghai, China). For Western blot analysis, equal amounts of proteins (120 μg) were loaded onto SDS-PAGE gels. After transfer, the membrane was probed with a specific anti-mIL-1β rabbit polyclonal Ab (Chemicon International, Temecula, CA, USA). The blots were developed using the ECL Plus Western Blotting Detection System (Amersham Biosciences, Piscataway, NJ, USA).
Statistics
All data are expressed as means ± SE. The data were analyzed by one-way ANOVA. A P value of less than 0.05 was considered significant.
Acknowledgements
We thank Mrs. Xixia ZHOU (Institute of Biochemistry and Cell biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences) for the care of the animals used in this study, Mrs. Jiajuan SHEN (School of Life Science and Technology, Tongji University, Shanghai) for her lab administration affairs, Mr. Zhen Yu (Shanghai Genomics, Inc) for his guidance of the IVIS imaging system, as well as for Mr. Boliang LI (Laboratory of Molecular Cell Biology, Institute of Biochemistry and Cell biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences) for valuable advice. This study was supported by grants from the Science and Technology Commission of Shanghai Municipality (06DZ19004; 06XD14014; 06DZ05907) and E-Institutes of Shanghai Municipal Education Commission (Project Number: E03003).
Authors' contributions
LL and JF designed and analyzed all the experiments, and wrote the manuscript. LL carried out the molecular genetic studies and the immunoassays, participated in the sequence alignment and the design of the study, and performed the statistical analysis. LW and XS participated in transgenic research. ZF, JR, RS, ZL, ZS, JY and ZW participated in its design and coordination. All authors read and approved the final manuscript.