Background
Methods
Patient material
Extraction of genomic DNA
In silicopromoter analysis
Bisulfite-modification and methylation-specific PCR
Sequence (5' → 3') | TA
[°C] | Primer [nM] | Product size (bp) | |
---|---|---|---|---|
Methylation-specific PCR
| ||||
WIF1 unmethylated | Forward: GGGTGTTTTATTGGGTGTATTGT | 55 | 400 | 154 |
Reverse: AAAAAAACTAACACAAACAAAATACAAAC | ||||
WIF1 methylated | Forward: CGTTTTATTGGGCGTATCGT | 55 | 400 | 145 |
Reverse: ACTAACGCGAACGAAATACGA | ||||
DKK3 unmethylated | Forward: TTAGGGGTGGGTGGTGGGGT | 58 | 320 | 126 |
Reverse: CTACATCTCCACTCTACACCCA | ||||
DKK3 methylated | Forward: GGGCGGGCGGCGGGGC | 58 | 320 | 120 |
Reverse: ACATCTCCGCTCTACGCCCG |
Statistical evaluations
Results
WIF1promoter methylation in primary breast carcinomas
DKK3promoter methylation in primary breast carcinomas
Association of WIF1 and DKK3promoter methylation with clinicopathological parameters
WIF1 methylation |
DKK3 methylation | ||||||||
---|---|---|---|---|---|---|---|---|---|
Variable | Categorization | n1
| No (%) | Yes (%) |
P
2
| n1
| No (%) | Yes (%) |
P
2
|
Clinicopathological factors
| |||||||||
Age at diagnosis | |||||||||
<57 years | 74 | 32 (43) | 42 (57) | 0.127 | 74 | 37 (50) | 37 (50) | 0.007 | |
≥ 57 years | 76 | 23 (30) | 53 (70) | 76 | 21 (28) | 55 (72) | |||
Tumor size3
| |||||||||
pT1-pT2 | 129 | 48 (37) | 81 (63) | 1.000 | 129 | 52 (40) | 77 (60) | 0.440 | |
pT3-pT4 | 18 | 7 (39) | 11 (61) | 18 | 5 (28) | 13 (72) | |||
Lymph node status3
| |||||||||
pN0 | 72 | 29 (40) | 43 (60) | 0.606 | 72 | 32 (44) | 40 (56) | 0.170 | |
pN1-pN3 | 71 | 25 (35) | 46 (65) | 71 | 23 (32) | 48 (67) | |||
Histological grade | |||||||||
G1-G2 | 88 | 28 (32) | 60 (68) | 0.170 | 88 | 31 (35) | 57 (65) | 0.313 | |
G3 | 62 | 27 (44) | 35 (57) | 62 | 27 (44) | 35 (57) | |||
Histological type | |||||||||
IDC | 122 | 43 (35) | 79 (65) | 122 | 45 (37) | 77 (63) | |||
lobular | 19 | 7 (37) | 12 (63) | 0.296 | 19 | 7 (37) | 12 (63) | 0.236 | |
other | 9 | 5 (56) | 4 (44) | 9 | 6 (67) | 3 (33) | |||
Immunohistochemistry
| |||||||||
Estrogen receptor | |||||||||
negative (IRS4 0–2) | 47 | 21 (45) | 26 (55) | 0.142 | 47 | 20 (43) | 27 (57) | 0.467 | |
positive (IRS 3–12) | 98 | 31 (32) | 67 (68) | 98 | 35 (36) | 63 (64) | |||
Progesterone receptor | |||||||||
negative (IRS4 0–2) | 51 | 22 (43) | 29 (57) | 0.206 | 51 | 21 (41) | 30 (59) | 0.593 | |
positive (IRS 3–12) | 94 | 30 (32) | 64 (68) | 94 | 34 (36) | 60 (64) | |||
WIF1 promoter
| |||||||||
unmethylated | - | - | - | - | 55 | 29 (53) | 26 (47) | 0.009 | |
methylated | - | - | - | 95 | 29 (31) | 66 (69) |
Correlation of WIF1 and DKK3 promoter methylation in primary breast carcinoma
Association of WIF1 promoter methylation with patient survival
Variable | Categorization | Overall survival | Disease-free survival | ||||
---|---|---|---|---|---|---|---|
n1
| events |
P
2
| n1
| events |
P
2
| ||
Clinicopathological factors
| |||||||
Age at diagnosis | |||||||
<57 years | 64 | 7 | 0.094 | 64 | 16 | 0.711 | |
≥ 57 years | 61 | 14 | 61 | 14 | |||
Tumor size3
| |||||||
pT1-pT2 | 107 | 17 | 0.372 | 107 | 25 | 0.427 | |
pT3-pT4 | 16 | 4 | 16 | 5 | |||
Lymph node status3
| |||||||
pN0 | 54 | 3 | 0.002 | 54 | 5 | <0.001 | |
pN1-pN3 | 65 | 18 | 65 | 24 | |||
Histological grade | |||||||
G1-G2 | 72 | 5 | 0.001 | 72 | 11 | 0.012 | |
G3 | 53 | 16 | 53 | 19 | |||
Histological type | |||||||
IDC | 101 | 19 | 0.267 | 101 | 22 | 0.277 | |
other | 24 | 2 | 24 | 8 | |||
Immunohistochemistry
| |||||||
Estrogen receptor | |||||||
negative (IRS4 0–2) | 40 | 9 | 0.155 | 40 | 9 | 0.962 | |
positive (IRS 3–12) | 80 | 12 | 80 | 21 | |||
Progesterone receptor | |||||||
negative (IRS4 0–2) | 39 | 9 | 0.154 | 39 | 13 | 0.087 | |
positive (IRS 3–12) | 81 | 12 | 81 | 17 | |||
WIF1 promoter
| |||||||
unmethylated | 47 | 9 | 0.656 | 47 | 8 | 0.154 | |
methylated | 78 | 12 | 78 | 22 | |||
DKK3 promoter
| |||||||
unmethylated | 46 | 1 | <0.001 | 46 | 7 | 0.037 | |
methylated | 79 | 20 | 79 | 23 |
Association of DKK3promoter methylation with patient survival
Multivariate analysis Overall survival (global model) | Multivariate analysis Overall survival (reverse selection procedure2) | |||||||
---|---|---|---|---|---|---|---|---|
Variable | HR | 95% CI1
|
P
| HR | 95% CI1
|
P
| ||
Age at diagnosis | <57 years | 0 | 1.0 | 1.0 | ||||
≥ 57 years | 1 | 1.78 | 0.63 – 4.99 | 0.276 | 2.27 | 0.85 – 6.07 | 0.104 | |
Tumor size | pT1-2 | 0 | 1.0 | |||||
pT3-4 | 1 | 0.83 | 0.25 – 2.78 | 0.766 | ||||
Lymph nodes | pN0 | 0 | 1.0 | 1.0 | ||||
pN1-3 | 1 | 5.47 | 1.46 – 20.53 | 0.012 | 4.50 | 1.26 – 15.87 | 0.021 | |
Histological grade | G1 | 0 | 1.0 | 1.0 | ||||
G2-G3 | 1 | 4.36 | 1.54 – 12.40 | 0.006 | 4.50 | 1.57 – 12.87 | 0.005 | |
Histological type | ductal | 0 | 1.0 | |||||
other | 1 | 0.46 | 0.09 – 2.22 | 0.330 | ||||
Estrogen receptor | negative | 0 | 1.0 | 1.0 | ||||
positive | 1 | 0.51 | 0.18 – 1.47 | 0.214 | 0.43 | 0.17 – 1.09 | 0.426 | |
Progesterone receptor | negative | 0 | 1.0 | |||||
positive | 1 | 0.57 | 0.21 – 1.54 | 0.270 | ||||
DKK3 promoter | unmethylated | 0 | 1.0 | 1.0 | ||||
methylated | 1 | 14.41 | 1.86 – 111.56 | 0.011 | 13.68 | 1.77–105.52 | 0.012 |
Multivariate analysis Disease-free survival (global model) | Multivariate analysis Disease-free survival (reverse selection procedure2) | |||||||
---|---|---|---|---|---|---|---|---|
Variable | HR | 95% CI1
|
P
| HR | 95% CI1
|
P
| ||
Age at diagnosis | <57 years | 0 | 1.0 | |||||
≥ 57 years | 1 | 0.57 | 0.24 – 1.33 | 0.191 | ||||
Tumor size | pT1-2 | 0 | 1.0 | |||||
pT3-4 | 1 | 0.61 | 0.22 – 1.72 | 0.353 | ||||
Lymph nodes | pN0 | 0 | 1.0 | 1.0 | ||||
pN1-3 | 1 | 4.24 | 1.50 – 11.96 | 0.006 | 4.01 | 1.49 – 10.81 | 0.006 | |
Histological grade | G1 | 0 | 1.0 | 1.0 | ||||
G2-G3 | 1 | 2.01 | 0.91 – 4.43 | 0.086 | 1.93 | 0.88 – 4.24 | 0.102 | |
Histological type | IDC | 0 | 1.0 | |||||
other | 1 | 1.04 | 0.42–2.62 | 0.929 | ||||
Estrogen receptor | negative | 0 | 1.0 | |||||
positive | 1 | 2.17 | 0.78 – 6.03 | 0.137 | ||||
Progesterone receptor | negative | 0 | 1.0 | 1.0 | ||||
positive | 1 | 0.36 | 0.15 – 0.88 | 0.025 | 0.53 | 0.25 – 1.11 | 0.091 | |
DKK3 promoter | unmethylated | 0 | 1.0 | 1.0 | ||||
methylated | 1 | 2.46 | 1.01 – 5.97 | 0.047 | 2.08 | 0.88 – 4.88 | 0.094 |