Background
While studying the molecular response of the injured pancreas, we identified a new gene, called p8, whose expression is strongly induced during the acute phase of pancreatitis [
1]. Further experiments have shown that p8 mRNA is activated in almost all cells in response to several stresses [
2], including minimal stresses such as after routine change of the culture medium in the absence of any added substance [
3], indicating that p8 is a ubiquitous protein induced by cellular stress. The p8 gene was cloned in human, rat, mouse, and
Xenopus laevis [
1,
4‐
6], conceptually translated from the
Drosophila melanogaster genome or deduced from EST libraries (
Bos taurus,
Xenopus tropicalis,
Zebrafish,
Orzzias latipes,
Bombyx mori and
Paralichthys olivaceous). The overall degree of homology with human p8 ranged from 81 to 40%. Secondary structure prediction methods indicated that within the homologous region of the eleven proteins, there is a basic Helix-Loop-Helix secondary structure motif, characteristic of some classes of transcription factors [
1]. Even though a small protein such as p8 would not need a nuclear localization signal (NLS) to be transported to the nucleus, a clear NLS can be predicted for the eleven proteins comprising a bipartite domain of positively charged aminoacids. In addition, a nuclear/cytoplasmic location has been demonstrated for human p8 upon overexpression of the recombinant protein and immunohistochemistry [
4], and for recombinant
Xenopus laevis p8 fused to green fluorescent protein [
6]. Homology searching in databases did not reveal significant similarity of p8 with other proteins of known function. However, biochemical properties of the mammalian p8 proteins are shared by some high mobility group proteins (HMG) [
7], particularly by the HMG-I/Y family. The overall identity of human p8 with human HMG-I/Y is only about 35%, but the molecular mass, isoelectric point, hydrophilicity plot, the resistance to denaturation after heating at 100°C and the charge separation are very similar [
8]. The p8 protein seems to bind DNA weakly, as shown by electrophoretic mobility shift assay, without preference for DNA sequences. Finally, human p8 has also been shown to be a substrate for protein kinase A
in vitro and phosphorylated p8 has a higher content of secondary structure and binding to DNA is highly increased [
8]. An architectural role in transcription has been proposed for this protein, in analogy with the HMG-I/Y proteins, and a recent work seems to confirm this hypothesis [
9].
Functions of p8 appear to be multiple and complex. For example, p8 mRNA expression was strongly induced in 3T3 cells upon TGFβ-1 treatment which in turn enhances the Smad-transactivating function responsible for TGFβ-1 activity [
10]. We also found that p8 is involved in cell cycle regulation since p8-deficient embryonic fibroblasts grew more rapidly and incorporated more [
3H] thymidine and BrdU than p8-expressing cells [
11]. Moreover, expression of p8 in breast cancer-derived cells seems to mediate the inhibition of cell growth induced by 1,25-Dihydroxyvitamin D3 [
12]. On the contrary, we also reported that p8 may promote cell growth when overexpressed in Cos-7, AR42J and HeLa cells [
1,
4]. In addition, p8 seems to be involved in other intracellular functions such as apoptosis since p8-expressing fibroblasts are more sensitive than p8-deficient fibroblasts to the apoptosis induced by DNA damage. Also, p8 is required for endothelin-induced mesangial cell hypertrophy in diabetic kidney, in a mechanism involving ERK, JNK and PI3 kinase [
13]. p8 seems to play a functional role in the initiation of LHβ gene expression during embryonic cell differentiation [
14]. Moreover, the
Drosophila melanogaster p8 homologue is involved in response to starvation and might be activated to stop cell growth in case of nutrient deprivation [
15]. Finally, a particularly attractive role in tumour progression was recently proposed for p8 [
16]. Fibroblasts obtained from p8-expressing or p8-deficient animals were transformed with a retroviral vector expressing both the ras
V12 mutated protein and the E1A adenoviral oncogene. In soft-agar assays, transformed p8-expressing cells formed colonies at high frequency, as expected, but p8-deficient transformed fibroblasts were unable to form colonies. Similarly, transformed p8-expressing cells produced tumours in all athymic nude mice when injected subcutaneously or intraperitoneally, whereas transformed p8-deficient fibroblasts did not. On the other hand, studies by another laboratory revealed that expression of the Com1 protein [
17], which is identical to human p8, mediates the growth of tumour cells after metastatic establishment in a secondary organ, indicating that activated expression of Com1/p8 in metastatic cells is required for tumour progression. These results strongly suggest that p8 is involved in the cellular pathway(s) required for tumour progression and metastasis.
Our aim is to check the relevance of p8 to cancer progression in human. As a first step, we investigated in the present study the function of p8 in two cell lines derived from human pancreatic cancer. We observed that inhibition of p8 expression increased the cells growth rate. In addition, activations of the Ras→Raf→MEK→ERK and JNK intracellular pathways, which promote the growth of pancreatic cells, down-regulated p8 expression, whereas activation of p38 or TGFβ-1, which inhibit cell growth, induced its expression. It was concluded that i/ p8 inhibits the growth of human pancreatic cancer cell lines, ii/ p8 expression is induced through pathways involved in growth inhibition and, conversely, repressed by factors that promote cell growth.
Discussion
Pancreatic adenocarcinoma is the fourth leading cause of death from malignant diseases [
26]. The aggressive nature of the neoplasia, the lack of early detection, and the limited response to treatments such as chemotherapy and radiotherapy contribute to the high mortality rate of the disease. Therefore, a better understanding of the molecular mechanism leading to pancreatic cancer remains a major goal because it may help proposing strategies for earlier diagnosis and better treatment. The most commonly altered genes in pancreatic adenocarcinoma are K-ras (75 to 100%), p16INK4a (95%), p53 (50 to 75%) and DPC4 (50%) [
27‐
31]. Whereas K-ras is a proto-oncogene all the others are tumour suppressor genes. Additional genes have been found altered at lower frequency. Panc-1 and BxPc-3 pancreatic cells were chosen for this study because they both express high levels of p8 (Figure
1) and because they present with different mechanisms of transformation and genetic backgrounds, Panc-1 being wild-type for Smad4/DPC4 but mutated for K-ras and BxPc-3 mutated for Smad4/DPC4 and wild-type for K-ras [
18,
19]. This work presents evidences that p8 inhibits the growth rate of pancreatic cancer-derived cells and that the intracellular pathways promoting cell growth down-regulate p8 expression whereas those promoting growth arrest up-regulate its expression. Together, these results suggest that p8 is downstream of some cell growth regulators and therefore regulation of p8 expression or its activity could be used as a target for treating pancreatic cancer.
Silencing p8 expression was able to strongly promote cell growth in both cell types, Panc-1 and BxPc-3, suggesting that p8 may act downstream of the ras- or Smad4/DPC4-dependent ways. Also, we found that stimulating cell growth by the complex combination of growth factors contained in fetal calf serum down-regulated expression of p8 whereas, on the contrary, treating the cells with TGFβ-1, which promotes cell cycle arrest, stimulates p8 expression. Therefore, p8 gene expression seems to be regulated in opposite directions by mechanisms promoting cell growth or cell cycle arrest. It is interesting to note that while p8 expression is under the control of cell growth regulatory pathways such as Ras→Raf→MEK→ERK, JNK, p38 and TGFβ-1, p8 can affect cell cycle progression, suggesting that p8 is a target for factors regulating pancreatic cell growth.
A mechanism by which p8 could regulate cell cycle progression in embryonic fibroblasts was previously proposed [
11]. In fact, p8 seems to take action upstream from cyclin-dependent kinases because the intracellular levels and activities of Cdk2 and Cdk4 are decreased when p8 is expressed. Concomitantly, the cyclin-dependent kinase inhibitor p27 is expressed at a low level in p8-deficient cells which may explain the increased activity of Cdk2 and Cdk4. The mechanism by which p8 regulates the intracellular level of those proteins remains to be determined. However, because p8 is a transcriptional cofactor, it is possible that regulation of expression of these molecules takes place, at least in part, at the transcription level.
Interestingly, expression of p8 mRNA seems to be regulated in a cell type- and stimulus-specific manner since, for example, p38 can induce p8 expression in response to stress in fibroblasts [
3] but not in renal mesangial cells treated with endothelin [
13]. In pancreatic cancer-derived cells p38 seems to play a major role since it is involved in p8 activation as judged by transient transfection assays and using a specific p38 inhibitor (Figures
10 and
11). In addition, p38 is also involved in TGFβ-1-induced p8 expression because about 40% of the TGFβ-1 effect was abolished when p38 activity was specifically blocked (Figure
13). On the other hand, ERK and JNK are inducers of p8 expression in mesangial cells treated with endothelin, but not involved in the activation of p8 in response to stress in fibroblasts [
3], and even repressors in pancreatic cells (Figures
5,
6,
7,
8 and
9). Finally, PI3 kinase is an inducer of p8 expression in both endothelin-mediated p8 activation in mesangial cells [
13] and pancreatic cells (data not shown).
Based on these observations, overexpression of p8 could be considered a possible goal for treating pancreatic tumours, in order to limit their growth. However, we previously reported that p8 repression would prevent ras
V12/E1A transformed fibroblasts from evolving as tumours in nude mice [
16]. This apparent contradiction needs to be resolved before considering p8 as a target for treating cancer progression.
Material and Methods
Cell lines and cell culture conditions
The human pancreatic cancer cell lines Panc-1 and BxPc-3 were a kind gift of Dr C. Susini (INSERM U.531, Toulouse) and A. Hajri (IRCAD, Strasbourg) respectively. Panc-1 cells were grown in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal calf serum, 2 mM L-glutamine, 100 IU/ml penicilin G and 100 μg/ml streptomycin. BxPc-3 were cultivated in RPMI 1640 medium in the presence of 2 mM L-glutamine, 4.5 g/L glucose, 10 mM Hepes, 1.0 mM sodium pyruvate, 10% fetal calf serum and 100 IU/ml penicilin G and 100 μg/ml streptomycin. Human recombinant TGFβ-1 was obtained from Sigma, and specific SB203580, U0126 and SP600125 inhibitors were from Calbiochem and utilized at 10 μM.
Expression plasmids
Expression plamids encoding p38 (pCEFL HA p38), Erk2 (pcDNAIII HA ERK2), JNK (pcDNAIIIB HA JNK), the wild-type Raf (pcDNA RAF BXB) and the Raf dominant negative (pcDNA RAF 301 K375W) were obtained from O Coso (University of Buenos Aires). Plamids encoding the constitutively activated type I TGFβ receptor (RI ACT), the dominant negative type II TGFβ receptor (RII DN) and the Smad4 dominant negative (DPC4 1–514 a.a.) were obtained from R Urrutia (Mayo Clinic, Rochester) and the wild type Smad4 was from C Heldin (Ludwig Institute, Uppsala).
Pancreatic p8-deficient cells
To silence p8 expression in pancreatic cells, we infected these cells with a retrovirus expressing human p8 in the antisense orientation. The retroviral vector was constructed as follows: human p8 cDNA was subcloned in HindIII and XhoI restriction sites of the pLPC plasmid (obtained from S. Lowe) in the antisense orientation. Amphotrope human p8 expressing retrovirus was then generated by transient transfection using Phoenix amphotrope packaging cells. Viral supernatant was used to infect Panc-1 and BxPc-3 pancreatic cells and the population of p8-silenced cells was isolated by selection in presence of puromycin (1 μg/ml). As control, cells were infected with the pLPC empty vector.
p8 expression in arrested and growing cells
One million of Panc-1 or BxPc-3 cells were cultivated on 10-cm Petri plates in standard conditions (with 10% FCS). After 48 h, culture media were changed for fresh media with FCS restricted to 0.1%, in order to stop growth. After 24 hours of growth arrest, culture medium was replaced either by medium with 10% fetal calf serum to resume cell growth or, as control, by medium with 0.1% fetal calf serum. Twenty four hours later cells were recovered and RNA and protein extracted.
p8 expression in TGFβ-1-treated Panc-1 cells
One million of Panc-1 cells were cultivated in 10-cm culture dishes for 48 hours under standard conditions before TGFβ-1 treatment. Human recombinant TGFβ-1 (5 ng/ml) was added to cells, without changing the culture medium, and cells were collected 12 hours later for RNA and protein preparation.
BxPc-3 rasV12-expressing cells
pLPC-rasV12 and pLPC plasmids were obtained from S. Lowe. Phoenix amphotrope packaging cells (106) were plated in a 6-well plate, incubated for 24 hours, then transfected with PEI with 5 μg of retroviral plasmid. After 48 hours, the medium containing virus was filtered (0.45 μm filter, Millipore) to obtain the viral supernatant. Target BxPc-3 were plated at 2 × 105 cells per 35-mm dish and incubated overnight. For infections, the culture medium was replaced by an appropriate mix of the viral supernatant and culture medium (V/V), supplemented with 4 μg/ml polybrene (Sigma), and cells were incubated at 37°C. BxPc-3 rasV12-expressing cells were selected with puromycin (1 μg/ml). Cells infected with the pLPC empty vector were used as control.
Western-blot analyses
One hundred μg of total protein extracted from cells was separated with standard procedures on 15.0% SDS-PAGE using the Mini Protean System (Bio-Rad) and transferred to a nitrocellulose membrane (Sigma). The intracellular level of p8 was estimated by Western blot using a polyclonal antibody (1:1000) raised against human p8 [
4].
Growth curves
One hundred thousand cells per well were plated in a series of 35-mm culture dishes. The cell number was estimated daily in triplicate, during 1 to 5 days, in a haemocytometer. Within experiments, each point was determined at least two times.
Cell transfection and gene reporter assays
Panc-1 and BxPc-3 (10
5) were cultivated in 30 mm diameter culture dishes for 24 hours then transiently transfected with 0.5 μg of p8-CAT reporter plasmid and 0.5 μg of pCMV/βgal plasmid (to control transfection efficiency) using the Fugene reagent in accordance with the manufacturer's protocol (Roche Molecular Biochemicals). The p8-CAT plasmid is the previously reported p-1471/+37p8-CAT promoter construct [
5]. Reporter activities were measured as previously described [
5]. Briefly, cell extracts were prepared with the reporter lysis buffer (Promega) 24 hours after transfection and CAT activity was determined by the phase extraction procedure [
32] and β-galactosidase assay was performed essentially as described in Sambrook et al. [
33]. CAT activity was normalized to β-galactosidase activity. Experiments were carried out in triplicate and repeated at least two times. Expression plasmids (0.5 μg) were co-transfected with p8-CAT and pCMV/βgal plasmids as indicated.
RT-PCR analysis
RNA was extracted using the Trizol (Life Technologies) procedure. Total RNA (1 μg) was analyzed by RT-PCR with the SuperScript™ One-step RT-PCR System and the Platinum Taq kit (Life Technologies). RT-PCR was performed using different numbers of cycles to verify that the conditions chosen were within the linear range. The mRNA coding for p8 was specifically amplified with sense (5' GAAGAGAGGCAGGGAAGACA 3') and antisense (5' CTGCCGTGCGTGTCTATTTA 3') primers, in positions 72 and 643 of the cDNA (accession # NM_012385), respectively. As control, the transcript coding for the ribosomal protein RL3 was specifically amplified for 22 cycles with sense (5'GAAAGAAGTCGTGGAGGCTG3') and antisense (5'ATCTCATCCTGCCCAAACAC3') primers, in positions 216 and 637 of the cDNA, respectively.