Background
Acute lung injury (ALI) is characterized by pulmonary inflammation, non-cardiogenic edema, and severe systemic hypoxemia. Acute respiratory distress syndrome (ARDS) is the severe form of ALI [
1,
2]. One of the earliest manifestations of ALI is a diffuse intense inflammatory process and damage to both endothelial and epithelial cell barriers, resulting in marked extravasation of vascular fluid into the alveolar airspace [
3]. A number of inflammatory cytokines including tumor necrosis factor-alpha (TNFα) and interleukin 8 (IL-8) can induce or aggravate the inflammation of endothelial and epithelial cells, leading to this barrier dysfunctions [
4]. The mortality and morbidity of ALI/ARDS remain high since the etiology and molecular pathogenesis are still incompletely understood.
Our previous study, based on extensive microarray gene expression profiling in canine, murine, and human ALI, revealed pre-B-cell-colony-enhancing factor (PBEF) as a significantly upregulated gene [
5]. Analysis of single nucleotide polymorphisms (SNPs) in the PBEF gene proximal promoter region indicated that a GC haplotype had a higher risk of ALI while a TT haplotype may have a lower risk of ALI [
5]. Our findings were confirmed and extended by Bajwa et al [
6], who showed that the PBEF T-1001G variant allele and related haplotype are associated with increased odds of developing ARDS and increased hazard of intensive care unit mortality among at-risk patients. In contrast, the C-1543T variant allele and related haplotype are associated with decreased odds of ARDS among patients with septic shock and better outcomes among patients with ARDS. In a mechanistic study, we found that PBEF is critically involved in thrombin-induced lung endothelial cell barrier dysregulation [
7].
The objective of this study was to further elucidate the role of PBEF in pulmonary epithelial cell inflammation and barrier regulation since impaired alveolar epithelial fluid transport is also a characteristic feature in patients with ALI and has been associated with increased morbidity and mortality [
4]. Using A549 human pulmonary alveolar epithelial cells and primary bronchial airway epithelial cells, we assessed the effect of PBEF knockdown with PBEF-specific silencing RNA (siRNA) and the effect of PBEF overexpression on TNFα-mediated IL-8 production and on cellular barrier function. Effect of the altered PBEF expression on basal or TNFα stimulated primary human pulmonary artery endothelial cells permeability was also examined to indirectly validate the similar results in the A549 cell line. Study of the role of PBEF in TNFα-mediated pulmonary cell IL-8 production and resultant barrier dysfunctions may help elucidate the molecular mechanisms underlying the role of PBEF in the susceptibility and pathogenesis of ALI.
Methods
Materials
Rabbit anti-human IL-8 polyclonal antibody (Cat. No. sc-7922, Santa Cruz, California, USA) and mouse anti-human β-actin monoclonal antibody (Cat. No. A1978) were obtained from Sigma-Aldrich (St. Louis, MO, USA). Rabbit anti-human PBEF polyclonal antibody was from Bethyl Laboratories, Inc. (Cat. No. A300-372A, Montgomery, TX, USA). Total mouse lung RNA was from Stratagene (Cat. No. 736511, La Jolla, CA, USA). Recombinant human TNFα (Cat. No. 210-TA) was from R&D Systems Inc. (Minneapolis, MN, USA). Superscript III Reverse Transcriptase (Cat. No. 18080044), Platinum Taq DNA polymerase (Cat. No. 10966018) was from Invitrogen (Carlsbad, CA, USA). Tricine was purchased from the Sigma-Aldrich (Cat. No. T0377, St. Louis, MO, USA). Sources of other key reagents are specified in the relevant text.
Cell culture
Human A549 cells, a lung carcinomatous type II alveolar epithelial cell line, were obtained from ATCC (Cat. No. CCL-185™, Manassas, VA) and maintained in a Dulbecco's Modified Eagle's Medium supplemented with 10% fetal bovine serum, 2 mM glutamine, and penicillin/streptomycin. Primary human lung small airway epithelial cells (Cat. No. CC-2547) were obtained from Lonza (Walkersville, MD, USA) and maintained in a small airway epithelial cell basal medium (Cat. No. CC-3119) with Supplement & Growth factors (Cat. No. CC-4124). Primary human pulmonary artery endothelial cells (HPAEC, Cat. No. CC-2530) were obtained from Cambrex Bio Science Inc. (Walkersville, MD, USA) and maintained in EGM™-2 Endothelial Cell Medium-2 (Cat. No. CC-4176). All cells were cultured at 37°C in a humidified atmosphere of 5% CO2, 95% air. Cells from each primary flask were detached with 0.05% trypsin, resuspended in fresh culture medium, and seeded into 6-well plates for Western blot and RT-PCR analysis or seeded into the culture inserts for in vitro cell permeability assays.
Transfection of PBEF siRNA into human A549 cells, primary human lung small airway epithelial cells and primary HPAEC
PBEF stealth siRNA was designed based on the human PBEF cDNA reference sequence (NM_005746.1) using the BLOCK-iT™ RNAi Designer (Invitrogen, Carlsbad, CA, USA). Using GFP-labeled non-specific siRNA, we first optimized the conditions for human A549 cells transfection and achieved >90% transfection efficiency using the Lipofectamine 2000 reagent (Invitrogen, Carlsbad, CA, USA). To transfect PBEF stealth siRNA into human A549 cells, cells were seeded for 24 h in the regular growth medium (without antibiotics) so that they would be 80–90% confluent at the time of transfection. For each transfection in 24-well plates, 50 pmol PBEF stealth siRNA was diluted in 50 μl Opti-MEM I without serum and gently mixed with 1 μl Lipofectamine 2000 diluted in the 50 μl Opti-MEM I (Invitrogen, Cat. 31985-062). After incubation for 15 min at room temperature, PBEF stealth siRNA and Lipofectamine 2000 complexes were added to each well. Cell culture plates were gently mixed by rocking back and forth. The amount of PBEF stealth siRNA and Lipofectamine 2000 were adjusted according to the different sizes of cell culture plates. Transfected cells were further incubated at 37°C for 24–48 h until treatment with TNFα before intended assays were carried out. Primary human lung small airway epithelial cells were similarly transfected. Transfection of PBEF siRNA into HPAEC was performed as previously described by Ye et al [
7].
Preparation and expression of the PBEF-overexpressing construct pCAGGS-hPBEF
A human PBEF (hPBEF) coding cDNA was amplified from A549 cell total RNA by RT-PCR using the following primer pair designed according to the reference human PBEF mRNA sequence (NM_005746.2): forward primer, 5'-TTAGAATTC GCCACC ATGCCTGCGGCAGAAGCC-3'and reverse primer, 5'-TTAGAATTC TTAATGGTGATGGTGATGATG CAAATGATGTGCTGCTTCCAGTTC-3'. The regular bold letters indicate the optimized Kozac sequence. The bold italic letter part is His tag sequence. The underlined sequences are EcoRI adaptors. The amplified human PBEF cDNA was digested with EcoRI and subcloned into the unique EcoRI site of pCAGGS vector, which was provided by Dr. Deyu Fang (Department of Molecular Microbiology and Immunology, University of Missouri-Columbia). After the cloning, pCAGGS-hPBEF was sequence-verified. In this construct, human PBEF expression was driven by a chicken beta-actin/rabbit beta-globin hybrid promoter (AG) with an enhancer from the human cytomegalovirus immediate early promoter (CMV-IE). Overexpression of PBEF in A549 cells and HPAEC was carried out by a transient transfection of pCAGGS-hPBEF. Briefly, one day before transfection, A549 cells or HPAEC were plated in 6-well plate at 5 × 105 cells/well in 2 ml of growth medium without antibiotics. On the day of transfection, cells were at 95% confluence. For each well, 4 μg plasmid DNA was transfected using Lipofectamine 2000 according to the suppliers' instruction. Cell medium and cell lysate proteins were harvested at 48, 72 and 96 hours after the transfection for western blotting analyses of IL-8, PBEF and β-actin protein levels in A549 cells. pCAGGS-hPBEF or pCAGGS transfected HPAEC were used only for the assessment of cell permeability.
Isolation of RNA and RT-PCR analysis
Total RNA was isolated from A549 cells with TRIZOL solution (Cat. No. 15596-018, Invitrogen, Carlsbad, CA, USA) according to the supplier's instructions. RT-PCR was performed using Invitrogen RNA PCR kit (Superscript III, 18080-044) with the following procedures: 1 μg total RNA was reverse transcribed with random primer at 50°C for 1 h followed by 70°C for 15 min and 4°C for 5 min in a 20 μl reaction volume. Each PCR reaction from the cDNA template (2 μl RT product) was performed using gene specific primers (Table
1) at 94°C for 3 min, then 32 cycles at 94°C for 1 min, 55°C for 1 min and 72°C for 1 min, followed by 72°C for 7 min for the final extension. β-actin was used as a house-keeping gene control. PCR products were separated on a 1.5% agarose gel and stained by Ethidium Bromide (0.5 μg/ml). The band image was acquired using an Alpha Imager and analyzed by the AlphaEase™ Stand Alone Software (Alpha Innotech Corp., San leandro, CA, USA).
Table 1
Primers and products sizes
IL-8 | ATGACTTCCAAGCTGGCCGT | CCTCTTCAAAAACTTCTCCACACC | 297 | NM_000584 |
PBEF | AAGCTTTTTAGGGCCCTTTG | AGGCCATGTTTTATTTGCTGACAAA | 319 | NM_005746 |
β-actin | CAAACATGATCTGGGTCATCTTCTC | GCTCGTCGTCGACAACGGCTC | 487 | NM_001101 |
Western blotting
Western blot analysis was performed following the protocol of Bio-Rad Company. Briefly, after washing with PBS, cells were lysed with 500 μl of cell lysis buffer containing 10 mM Tris (pH 7.4), 1% Triton X-100, 0.5% Nonidet P-40, 150 mM NaCl, 1 mM EDTA, 0.2 mM EGTA, 0.2 mM vanadate, 0.2 mM PMSF, and 0.5% protease inhibitor cocktail. Total cell lysates were cleared by centrifugation and boiled with the same amount of 4× SDS sample buffer for 5 min. Total protein of cell lysates was quantified using the BCA Protein Assay Kit (Pierce Biotechnology, Inc., Rockford, IL, USA). An equal amount of total protein from each sample was then subjected to 16.5% Tris/tricine polyacrylamide gel electrophoresis. The separated proteins were transferred to PVDF membranes by electrotransfer. The blots were subsequently blocked with 5% bovine serum albumin in PBS containing 0.1% Tween 20 (TBS-T) at room temperature for 1 h and then incubated at 4°C overnight with primary antibodies of interest. After washing three times for 10 min with TBS-T, the membrane was incubated with horseradish-peroxidase-linked secondary antibodies of interest at room temperature for 1 h. The blots were then visualized with the ECL Western blot detection system (Cat. No. RPN2106, Amersham Bosciences, Buckinghamshire, UK). The same membrane was re-probed with an anti-human β-actin antibody. β-actin was used as an internal control. Band density on Western blot images was used as a measure of assayed protein level. The band image was acquired using an Alpha Imager and analyzed by the AlphaEase™ Stand Alone Software.
In Vitro Cell Permeability Assay
In Vitro Cell Permeability Assay was carried out according to the protocol of the CHEMICON in vitro Vascular Permeability Assay kit (Cat. No. ECM640, Millipore, Billerica, MA, USA). Briefly, cells were seeded to the culture inserts of permeability chambers (1.0 × 106 cells/ml) that were coated with collagen. Then, cells were incubated in 37°C and 5% until a monolayer was formed. After TNFα (Cat. No. 636-R1, R&D systems, Minneapolis, MN, USA) was added, cells were incubated for another 18 hours at 37°C and 5% CO2 in the tissue culture incubator. Finally, 150 μl of FITC-Dextran was added to each insert for 5 min at room temperature, and then 100 μl of the solution in the bottom chamber was transferred to a 96-well plate. The plate was read in a TriStar Multimode Reader (LB 941, Berthold Technologies GnbH & Co. KG, Bad Wildbad, Germany) at wavelengths of 485 and 530 nm. Reagent control wells were treated with basal medium and growth medium only. Blank inserts without cells plated were also included as controls.
Statistical analysis
Statistical analyses were performed using SigmaStat (ver 3.5, Systat Software, Inc., San Jose, CA, USA). Results are expressed as mean ± standard deviation (SD) of four samples from at least two independent experiments. Stimulated samples were compared with controls by unpaired Student's t test. P < 0.05 was considered statistically significant.
Discussion
Our findings demonstrate that the modulation of PBEF expression resulted in parallel changes in TNFα-mediated IL-8 production and secretion as well as alveolar epithelial cell permeability. These results provide new insight into the role of PBEF in the inflammatory pathways and functional abnormalities associated with ALI.
There is considerable experimental and clinical evidence that pro-inflammatory cytokines play a major role in the pathogenesis of ALI/ARDS from inflammatory causes, such as sepsis, pneumonia, aspiration, and shock [
8], as well as from mechanical stress [
9‐
11]. The landmark ARDSnet clinical trial found that a lung-protective ventilatory strategy reduces mortality by 22% in patients with ALI, a result that in part may be ascribed to the marked reduction in the concentration of pro-inflammatory cytokines released into the airspaces of the injured lung [
12,
8]. TNFα and IL-8 are among important early mediators of ALI [
4]. It has been shown that TNFα is present in increased amounts in the bronchoalveolar lavage fluid (BALF) of patients with ARDS [
13], in the serum during the onset of sepsis-induced lung injury [
14], and acutely increases in both serum and BALF when changing from a lung protective to non-protective ventilation strategy [
9]. Increasing TNFα biological activity has been demonstrated over the first week of ARDS and there are direct relationships between the molar ratio of TNFα/soluble TNF-receptor in the BALF and severity of ALI (lung compliance and severity of hypoxemia) [
13]. The role of TNFα in pulmonary pathophysiology has been well studied, and includes induction of cellular inflammatory reactions, enhancement of oxidative stress, and increased expression of various proinflammatory molecules [
15].
Among the TNFα induced pro-inflammatory cytokines, IL-8 is regarded as one of the most important mediators in the pathogenesis of ARDS. In BALF, IL-8 levels were significantly increased in patients with ARDS and correlated with the development of ARDS in at-risk patients [
16,
17]. IL-8 has been identified as one of biomarkers of ALI/ARDS mortality [
18]. In fact, IL-8 was first purified and molecularly cloned as a neutrophil chemotactic factor from lipopolysaccharide-stimulated human mononuclear cell supernatants [
19]. Since then, studies of models of acute inflammation have established IL-8 as a key mediator in neutrophil mediated acute inflammation [
20]. In acid aspiration- and endotoxemia-induced ARDS in rabbits, IL-8 is produced in the lungs [
21,
22]. In both models, the abrogation of IL-8 activity reduces neutrophil infiltration as well as tissue damage. It was demonstrated that TNFα mediated IL-8 production can suppress neutrophil apoptosis [
23] and thus potentially prolong neutrophil migration into the lungs and damage to lung tissues, including alveolar epithelial barrier function [
24].
Our data in this study indicate that TNFα significantly induces PBEF expression at both the mRNA and protein levels in A549 cells (Figures
2,
3,
4,
5), suggesting that PBEF may be an intermediate target of TNFα involved in the inflammatory process during the pathogenesis of ALI. The knockdown of PBEF expression by PBEF siRNA significantly blunted TNFα-stimulated IL-8 secretion and its production in A549 cells (Figures
6,
7), and PBEF-overexpression augmented IL-8 secretion from A549 cell (Figure
7). These results support the concept that PBEF may be an inflammatory signal transducer of TNFα or other inflammatory stimuli to regulate the synthesis of IL-8 or other inflammatory cytokines. These conclusions can be corroborated by evidence in non-lung tissue studies. PBEF silencing has been shown to prevent the suppression of neutrophil apoptosis caused by TNFα, IL-8 and other mediators [
25]. In addition, PBEF gene expression is up-regulated in severely infected fetal membranes [
26]. Inflammatory stimuli in fetal membranes inducing NF-κB and AP-1 have been shown to up-regulate PBEF [
27]. The recombinant human PBEF treatment of amnion-like epithelial cells and fetal membrane explants significantly increased IL-6 and IL-8 expression [
28]. Considered together, PBEF could play a critical role as an inflammatory cytokine during the pathogenesis of ALI.
Both endothelial and epithelial injuries were observed in earlier ultrastructural studies of the lung in patients dying with ALI secondary to sepsis [
29,
30]. Increased vascular permeability and endothelial injury contribute to the profound pathophysiological derangements in ALI [
31,
32]. If the alveolar epithelium is also damaged, the change in both endothelial and epithelial permeability could lead to major alveolar flooding with high-molecular-weight proteins, with prolonged changes in gas exchange, altered compliance and a much higher likelihood of disordered repair [
33]. Normally, the lung alveolar epithelium forms an extremely tight barrier that restricts the movement of proteins and liquid from the interstitium into the alveolar spaces. In ALI, impaired alveolar epithelial function in the lungs is a marker of poor outcome in ALI [
34]. A number of inflammatory cytokines, including TNFα and IL-8, can induce or aggravate the inflammation of endothelial and epithelial cells, leading to their barrier dysfunctions [
35]. In this study we have demonstrated (Figure
7) that the TNFα stimulated increased in A549 cell permeability is significantly attenuated by the knockdown of PBEF expression by PBEF siRNA. Overexpression of PBEF increased A549 cell permeability in both basal and TNFα induced conditions. These results suggest that PBEF may have an important role in epithelial cell barrier regulation. A549 cells are an alveolar Type II tumor epithelial cell line. While the type II epithelial cell only covers 7% of the alveolar surface area, it constitutes 67% of the epithelial cell number within the alveoli [
36], pointing to its biochemical importance. The permeability increase of A549 cells in the TNFα-stimulated condition involves both paracellular permeability, with gap formation visualized by actin cytoskeleton staining, and basement membrane permeability [
37]. Since A549 cells usually do not form a regular monolayer, we went to examine whether a similar effect can be observed in a primary HPAEC, which forms a typical monolayer. Indeed, we found that PBEF expression similarly affected the HPAEC permeability (Figure
7).
While an overexpression of PBEF results in an increased basal permeability, knocking down PBEF expression failed to alter the basal permeability both in A549 cells and HPAEC. It is possible that in our study, transfection of pCAGGS-PBEF engendered at least 3 fold higher PBEF protein expression, but transfection of PBEF siRNA only resulted in about 60% decrease of PBEF level, which might explain the subdued effect of the latter in the basal level. TNFα mediated effect may be partly due to its induction of IL-8 production. IL-8 has been demonstrated to induce actin fiber rearrangement and intercellular gap formation in endothelial cells [
38]. IL-8 could have a similar effect on epithelial barrier function. Our previous study found that reductions in PBEF protein expression significantly attenuated endothelial barrier dysfunction induced by the potent edemagenic agent, thrombin, reflected by reductions in transendothelial electric resistance [
7]. Furthermore, reductions in PBEF protein expression blunted thrombin-mediated increases in Ca
2+ entry, polymerized actin formation, and myosin light chain phosphorylation [
7], events critical to the thrombin-mediated permeability response [
32]. Whether similar mechanisms account for the attenuating effects of PBEF knockdown on TNFα-induced epithelial and endothelial cell barrier dysfunction remains to be elucidated in future studies.
Competing interests
The authors declare that they have no competing interests.
Authors' contributions
HL, PL, JC, DF, RE carried out all studies and statistical analyses, and drafted the manuscript. BS, LZ and SY conceived of the study, and participated in its design and coordination. All authors read and approved the final manuscript.