Patients
Patients were recruited randomly from those undergoing diagnostic catheterization at the University Hospital (Heraklion, Crete, Greece) over a 4 month period. A total of 53 patients were included in the study. A group of 36 patients, that were submitted to angiography due to angina pectoris, showed ≥ 1 vessel coronary stenosis of ≥ 70% by visual analysis and thus were considered as CAD group. A total of 17 individuals, that were submitted to angiography due to valvular disease or nontypical chest pain syndrome with a negative or non diagnostic exercise ECG or asymptomatic episodes of unsustained ventricular tachycardia, were found to have no stenosis and were considered to be the control group (noCAD). Due to poor RNA yields we excluded from the analysis 4 macrophage (1 CAD UA, 2 noCAD and 1 CAD SA) and 12 lymphocyte samples (5 CAD UA, 3 noCAD and 4 CAD SA).
The patients, and controls had no evidence of peripheral artery or cerebrovascular disease; all had normal echo-duplex of cervical arteries, the aorta and lower limb arteries and/or resting and post-exercise ankle/ brachial pressure index > 0.85. Criteria for exclusion were 1) age < 18.2) clinical or laboratory signs of acute or chronic inflammatory disease and 3) presence of overt neoplastic disease.
The definitions of the clinical parameters used in the study are presented below. A. Hypertension: systolic blood pressure ≥ 160 mm Mg and or diastolic > 90 mm Mg, B. Hypercholesterolaemia: LDL ≥ 160 mg/dl for patient without any artery risk factors for coronary artery desease or LDL ≥ 130 mg/dl for patient with one known risk factor for coronary artery desease or LDL ≥ 100 mg/dl for patent with known coronary artery desease, C. Diabetes: Two separate values of fasting blood glucose ≥ 126 mg/dl or two random values of blood glucose ≥ 200 mg/dl. D. Levels of acid uric ≥ 7 mg/dl. E. Unstable angina: crescendo angina of superimposed on a preexisting pattern of relatively stable exertion-related angina pectoris or angina pectoris at rest as well as with minimal exertion or angina pectoris of new onset which is brought on by minimal exertion. F. Stable angina: stable angina on effort without any clinical changes within two months. The present study was approved by the institutional ethics committee and the patients gave written informed consent to participate in the study. The investigation conforms to the principles outlined in the Declaration of Helsinki.
Blood collection, lymphocyte separation and cell culture
Twenty millilitres of blood was collected from the femoral venous catheter placed for the catheterization before angiography was begun. The blood was immediately placed in four 5-ml polypropylene heparinized tubes and kept on ice until it was used for monocyte isolation. In all instances, the blood was used within 1 hour of removal from the patients.
The 20 ml of heparinized blood was gently layered over 30 ml of Histopaque-1077 (Sigma) in a 50-ml polypropylene centrifuge tube. Tubes were centrifuged at 1800 rpm for 30 minutes at room temperature. The middle phase (buffy coat) containing the monocytes was isolated and placed in a fresh 50-ml polypropylene centrifuge tube. The cell yield was on average 106 cells /ml of blood. The isolated mononuclear cells were washed twice with sterile phosphate buffered saline (PBS). The cell pellets were resuspended in RPMI1640 medium (Sigma). The cells were plated on 25 cm2 tissue culture flasks (Costar) and incubated in a 5% CO2 incubator (Forma) at 37°C for 1 hour to allow for monocyte attachment. The non adherent cells were removed by washing twice with PBS. Purity assessment of the monocyte preparation was performed with anti CD14 FACS analysis (FACSCalibur, Beckton Dickinson) and showed consistently more than 95% purity. The lymphocyte fraction mentioned in the study represented the non adherent fraction of the ficoll purified peripheral leucocyte preparation. The lymphocyte fraction contained a very low level of granulocytes (<1%) and macrophages (<1%). The viability of our populations after the purification procedure was more than 99% as determined by trypan blue exclusion.
Analysis of the effect of glucose and Fluvastatin on the kinetics of mRNA expression was performed as previously described [
17]. Due to the need of a large cell number for the kinetic analysis we utilized buffy coats from healthy donors. Briefly Ficoll purified cells were incubated in 6-well plates (Costar) at a concentration of 2 × 10
6 cells/ml, in 2 ml RPMI1640 medium, for 1 hour, in a CO
2 incubator. Non adherent cells were removed by washing twice with PBS and new RPMI1640 medium was added containing 5% human serum. Fluvastatin (1 μM) or glucose (6 mg/ml) was added according to the study design. At an appropriate time period (30 min, 1 h, 2 h, 4 h, 24 h, 48 h) cells were harvested and mRNA was extracted and purified.
Extraction and quantification of mRNA
Total RNA was isolated directly from the tissue culture dishes containing the adherent monocytes using the Trizol reagent (Life Technologies Ltd., U.K.). Briefly, 1 ml of reagent was added to each dish with vigorous pipetting and transferred to a 1.5 ml Eppendorf tube. Chloroform (200 μl) was added, and the tube was vortexed and centrifuged at 14 000 rpm for 15 minutes. The RNA was precipitated with an equal volume of isopropanol and washed with 75% ethanol. The RNA was air-dried and resuspended in water treated with diethyl pyrocarbonate. The RNA preparation was treated with DNase I to remove residual traces of DNA, purified with the phenol-Chloroform method and precipitated with ethanol. The non-adherent/lymph fraction was harvested, centrifuged and RNA extraction was performed with the Trizol reagent according to the manufacturer's instructions. RNA concentration and purity was determined on a UV spectrophotometer (Hitachi Instruments Inc., U.S.A.) by the 260 nm absorbance and 260 nm to 280 nm absorbance ratio respectively. 1% agarose gel electrophoresis and ethidium bromide staining were used to examine RNA integrity.
Semi-quantitative RT-PCR
Each quantification set included two PCR reactions (the target and the β2-microglobulin (β2M) reference). Each PCR reaction (target and β2M) was optimized individually for primer, Mg and Taq polymerase concentration using as a template a representative pool of all samples to be measured. Then the reactions were combined into a single tube in order to eliminate tube to tube variations. A new optimization was performed to ensure that there was no cross inhibition between the two PCR reactions. Subsequently another optimization was performed modulating the relative concentration of the two sets of primers to ensure that the two reactions reached the logarithmic phase of expansion in the same PCR cycles (reaction synchronization). Finally we determined the cycle in which the reaction reached the middle of the logarithmic expansion phase. The set of conditions that were established regarding primer, Mg, Taq polymerase concentration and cycle number, was applied specifically to the set of samples that were used for the standardization (sample pool) and the corresponding target. The total standardization procedure was repeated for each quantification reaction (bFGF, VEGF, TGF-β1).
Reverse transcription reactions for the preparation of first strand cDNA from 1 μg of total RNA, were performed for 1 h at 52°C, using 15 U Thermoscript reverse transcriptase, 40 U RNaseOut, 50 ng of random hexamers and 1.0 mM of each dNTP in a total volume of 20 μl of 1x First Strand cDNA Synthesis Buffer containing 5 mM dithiothreitol (DTT), ensued by incubation for 20 min at 37°C with 2 U of E. coli RNaseH to avoid RNA contamination of cDNA, according to the manufacturer's protocol (Life Technologies Ltd., U.K.).
PCR assays were carried out in a PTC-200 programmable thermal controller (MJ Research Inc., U.S.A.); 1 μl of cDNA was amplified in a total volume of 10 μl containing. The general PCR protocol included 1x PCR reaction buffer, 2.5 mM MgCl2, 0.4 mM dNTPs, and 0.6 U Platinum Taq DNA polymerase (Life Technologies Ltd., U.K.), with 30 pmol of each primer set. Cycling parameters were as follows: 3 min for initial denaturation at 94°C; 30 sec at 94°C, 30 sec at 58°C for primer annealing, 40 sec at 72°C for primer extension, these steps were repeated for 35 cycles; final extension step at 72°C for 10 min. β2-microglobulin was used as an internal control in all PCR reactions.
PCR products were analysed by 8% polyacrylamide gel electrophoresis (29:1 ratio acrylamide/bis-acrylamide) and silver stained. Gels were scanned on an Agfa SnapScan 1212 u (Agfa-Gevaert N.V., Belgium). The integrated density of the bands was used as quantitative parameter and was calculated by digital image analysis (Scion image). The ratio of the integrated density of each gene divided by that of β2-microglobulin was used to quantify the results.
The oligonucleotide primers used in the study were: β2-microglobulin;Forward (F): TCCAACATCAACATCTTGGT,
β2-microglobulin;Reverse (R): TCCCCCAAATTCTAAGCAGA,
TGF-β1;F: ATGAACTCATTCAGTCACCATAGC,
TGF-β1;R: CTATCCCCCACTAAAGCAGG,
VEGF;F: ACGATCGATACAGAAACCACG,
VEGF;R: CTCTGCGCAGAGTCTCCTCT,
bFGF;F: GCCACATCTAATCTCATTTCACA,
bFGF;R: CTGGGTAACAGCAGATGCAA.
Statistical analysis
Data are reported as mean ± SEM. Initial statistical comparison of the mRNA expression results between the CAD and the noCAD (control) groups was performed utilizing the Mann Whitney test [
18]. Subsequent analysis between noCAD, CAD SA (stable angina) and CAD UA (unstable ungina) groups for statistically significant differences in enumerative data was performed with the use of the X
2 test. Analysis between groups for continuous variables such as age, number of diseased vessels and % of lymphocytes was performed with one-way ANOVA. The expression of VEGF, bFGF and TGF-β1 mRNA was compared between the groups noCAD, CAD SA (stable angina) and CAD UA (unstable ungina) by ANCOVA with age, number of diseased vessels, family history of heart disease, diabetes, smoking, hypertension, and hypercholesterolaemia as covariates. Bonferroni post hoc comparisons were performed to compare the adjusted levels of VEGF, bFGF and TGF-β1 between the 3 groups.