Skip to main content
Erschienen in: Journal of Translational Medicine 1/2008

Open Access 01.12.2008 | Research

Hypermethylated MAL gene – a silent marker of early colon tumorigenesis

verfasst von: Guro E Lind, Terje Ahlquist, Matthias Kolberg, Marianne Berg, Mette Eknæs, Miguel A Alonso, Anne Kallioniemi, Gunn I Meling, Rolf I Skotheim, Torleiv O Rognum, Espen Thiis-Evensen, Ragnhild A Lothe

Erschienen in: Journal of Translational Medicine | Ausgabe 1/2008

Abstract

Background

Tumor-derived aberrantly methylated DNA might serve as diagnostic biomarkers for cancer, but so far, few such markers have been identified. The aim of the present study was to investigate the potential of the MAL (T-cell differentiation protein) gene as an early epigenetic diagnostic marker for colorectal tumors.

Methods

Using methylation-specific polymerase chain reaction (MSP) the promoter methylation status of MAL was analyzed in 218 samples, including normal mucosa (n = 44), colorectal adenomas (n = 63), carcinomas (n = 65), and various cancer cell lines (n = 46). Direct bisulphite sequencing was performed to confirm the MSP results. MAL gene expression was investigated with real time quantitative analyses before and after epigenetic drug treatment. Immunohistochemical analysis of MAL was done using normal colon mucosa samples (n = 5) and a tissue microarray with 292 colorectal tumors.

Results

Bisulphite sequencing revealed that the methylation was unequally distributed within the MAL promoter and by MSP analysis a region close to the transcription start point was shown to be hypermethylated in the majority of colorectal carcinomas (49/61, 80%) as well as in adenomas (45/63, 71%). In contrast, only a minority of the normal mucosa samples displayed hypermethylation (1/23, 4%). The hypermethylation of MAL was significantly associated with reduced or lost gene expression in in vitro models. Furthermore, removal of the methylation re-induced gene expression in colon cancer cell lines. Finally, MAL protein was expressed in epithelial cells of normal colon mucosa, but not in the malignant cells of the same type.

Conclusion

Promoter hypermethylation of MAL was present in the vast majority of benign and malignant colorectal tumors, and only rarely in normal mucosa, which makes it suitable as a diagnostic marker for early colorectal tumorigenesis.
Hinweise

Electronic supplementary material

The online version of this article (doi:10.​1186/​1479-5876-6-13) contains supplementary material, which is available to authorized users.

Competing interests

The author(s) declare that they have no competing interests.

Authors' contributions

GEL and TA carried out the MSP analyses and interpreted the results independent of each other. GEL additionally designed the study, carried out the bisulphite sequencing and the quantitative real-time PCR analyses, performed the statistics, and drafted the manuscript. MK carried out the immunohistochemistry analyses, interpreted the results together with an expert pathologist and contributed in manuscript preparations. MB isolated DNA from cancer cell lines. ME cultured all cell lines and treated colon cancer cell lines with epigenetic drugs. MAA provided the antibody for immunohistochemical analyses and contributed with scientific discussion. AK provided several of the cancer cell lines. GIM and TOR have collected the series of human primary carcinomas and normal mucosa tissue and provided all clinical and pathological information regarding these samples. RIS generated the tissue microarray and contributed in manuscript preparations. ETE has provided the series of adenoma samples and provided all clinical and pathological information regarding these samples and contributed in manuscript preparations. RAL conceived the study, participated in its design, contributed in evaluation of results, scientific discussion and in manuscript preparation. All authors have read and approved the final manuscript.
Abkürzungen
MAL
T-cell differentiation protein gene
MSI
micro satellite instability
MSP
methylation-specific polymerase chain reaction
MSS
micro satellite stable micro satellite instability
TMA
tissue microarray.

Background

Epigenetic changes – non-sequence-based alterations that are inherited through cell division [1] – are frequently seen in human cancers, and likewise as genetic alterations they may lead to disruption of gene function. In colorectal cancer, several tumour suppressor genes have been identified to be epigenetically inactivated by CpG island promoter hypermethylation, including the DNA mismatch repair gene MLH1 [24], the gatekeeper APC [5], and the cell cycle inhibitor CDKN2A [6], to mention some. In addition to contributing to, or accompanying, the stepwise development of malignant colorectal carcinomas from benign adenomas, aberrant DNA methylation holds great promises for cancer diagnostics [7]. Based on the ubiquity of aberrant promoter methylation and the ability to detect this methylated DNA in body fluids, such as blood, the presence of this altered DNA may represent potential diagnostic biomarkers for cancer. For non-invasive detection of colorectal tumours, stool is the obvious source of DNA for such investigations and several studies have identified cancer-derived aberrant DNA hypermethylation using this approach [810]. However, the sensitivity and specificity of these tests are still suboptimal and would benefit from incorporating additional biomarkers.
We recently published a list of promising novel target genes for hypermethylation in colorectal tumours [11]. Among these was the MAL (T-cell differentiation protein) gene, and we then communicated that the CpG rich promoter of MAL seemed to be hypermethylated in the majority of colorectal tumours [12].
The MAL gene, which was initially isolated and cloned in 1987, maps to chromosome band 2cen-q13, encodes a 17 kDa integral membrane protein, and contains a CpG island [13, 14]. Originally, expression of MAL was found in intermediate and late stages of T-cell differentiation, and MAL was suggested to play a role in membrane signalling [15]. In recent years, MAL has also been shown to play a role in apical transport, which is a polarized transport of lipids and proteins to the apical (external facing) membrane in certain cell types [16]. Such polarized transport is essential for the proper functioning of epithelial cells, and the neoplastic transformation process is frequently associated with loss of this polarized phenotype [16]. Finally, MAL has been shown to possess tumour suppressor capabilities by suppressing motility, invasion, and tumorigenicity and enhance apoptosis in oesophageal cancer [17].
In the present study, we have compared the promoter methylation status of MAL in a large series of normal colorectal mucosa samples, with those of benign and malignant colorectal tumours. Furthermore, RNA and/or protein expression levels of MAL were determined in in vivo tumours as well as in in vitro models, the latter also including various cancer types. The findings were used to decide whether or not methylated MAL is suitable as a diagnostic marker for early colorectal tumorigenesis.

Methods

Patients and cell lines

DNA from 218 fresh-frozen samples was subjected to methylation analysis, including 65 colorectal carcinomas (36 micro satellite stable; MSS, and 29 with micro satellite instability; MSI) from 64 patients, 63 adenomas, median size 8 mm, range 5–50 mm (61 MSS and 2 MSI) from 52 patients, 21 normal mucosa samples from 21 colorectal cancer patients (taken from distant sites from the primary carcinoma), and another 23 normal colorectal mucosa samples from 22 cancer-free individuals, along with 20 colon cancer cell lines (11 MSS and 9 MSI), and 26 cancer cell lines from various tissues (breast, kidney, ovary, pancreas, prostate, and uterus; Table 1). The mean age at diagnosis was 70 years (range 33 to 92) for patients with carcinoma, 67 years (range 62 to 72) for persons with adenomas, 64 years (ranging from 24 to 89) for the first group of normal mucosa donors, and 54 years (ranging from 33 to 86) for the second group of normal mucosa donors. The colorectal carcinomas and normal samples from cancer patients were obtained from an unselected prospective series collected from seven hospitals located in the South-East region of Norway [18]. The adenomas were obtained from individuals attending a population based sigmoidoscopic screening program for colorectal cancer [19]. The normal mucosa samples from cancer-free individuals were obtained from deceased persons, and the majority of the total set of normal samples (27/44) consisted of mucosa only, whereas the remaining samples were taken from the bowel wall. Additional clinico-pathological data for the current tumour series include gender and tumour location, as well as polyp size and total number of polyps per individual for the adenoma series.
Table 1
Promoter methylation status of MAL in cell lines of various tissues.
Cell line
Tissue
Promoter methylation status
Methylation frequency
BT-20
Breast
M
57%
BT-474
Breast
U/M
 
Hs 578T
Breast
U
 
SK-BR-3
Breast
U
 
T-47D
Breast
U/M
 
ZR-75-1
Breast
U
 
ZR-75-38
Breast
M
 
Co115
Colon
M
95%
HCT15
Colon
M
 
HCT116
Colon
M
 
LoVo
Colon
M
 
LS174T
Colon
M
 
RKO
Colon
M
 
SW48
Colon
M
 
TC7
Colon
M
 
TC71
Colon
M
 
ALA
Colon
M
 
Colo320
Colon
M
 
EB
Colon
M
 
FRI
Colon
U/M
 
HT29
Colon
M
 
IS1
Colon
M
 
IS2
Colon
M
 
IS3
Colon
M
 
LS1034
Colon
M
 
SW480
Colon
M
 
V9P
Colon
U
 
ACHN
Kidney
U
50%
Caki-1
Kidney
U
 
Caki-2
Kidney
M
 
786-O
Kidney
U/M
 
ES-2
Ovary
U/M
50%
OV-90
Ovary
U/M
 
Ovcar-3
Ovary
U
 
SK-OV-3
Ovary
U
 
AsPC-1
Pancreas
M
67%
BxPC-3
Pancreas
U
 
CFPAC-1
Pancreas
U
 
HPAF-II
Pancreas
M
 
PaCa-2
Pancreas
M
 
Panc-1
Pancreas
U/M
 
LNCaP
Prostate
U
0%
AN3 CA
Uterus
U/M
75%
HEC-1-A
Uterus
M
 
KLE
Uterus
U
 
RL95-2
Uterus
M
 
The promoter methylation status of the individual cell lines was assessed by methylation-specific polymerase chain reaction (MSP). The methylation frequency reflects the number of methylated (M and U/M) samples from each tissue. Abbreviations: U, unmethylated; M, methylated.
All samples were retrieved from approved research biobanks and are part of research projects approved according to national guidelines (Biobank; registered at the Norwegian Institute of Public Health. Projects: Regional Ethics Committee and National Data Inspectorate).
Two colon cancer cell lines, HCT15 and HT29, were subjected to treatment with the demethylating drug 5-aza-2'deoxycytidine (1 μM for 72 h), the histone deactetylase inhibitor trichostatin A (0.5 μM for 12 h) and a combination of both (1 μM 5-aza-2'deoxycytidine for 72 h, 0.5 μM trichostatin A added the last 12 h).

Bisulphite treatment and methylation-specific polymerase chain reaction (MSP)

DNA from primary tumours and normal mucosa samples was bisulphite treated as previously described [11, 20], whereas DNA from colon cancer cell lines was bisulphite treated using the EpiTect bisulphite kit (Qiagen Inc., Valencia, CA, USA). The promoter methylation status of MAL was analyzed by methylation-specific polymerase chain reaction (MSP) [21], using the HotStarTaq DNA polymerase (Qiagen). All results were confirmed with a second independent round of MSP. Human placental DNA (Sigma Chemical Co, St. Louis, MO, USA) treated in vitro with Sss1 methyltransferase (New England Biolabs Inc., Beverly, MA, USA) was used as a positive control for the methylated MSP reaction, whereas DNA from normal lymphocytes was used as a positive control for unmethylated alleles. Water was used as a negative control in both reactions. The primers were designed with MethPrimer [22] and their sequences are listed in Table 2, along with the product fragment lengths and primer locations.
Table 2
PCR primers used for MSP and bisulphite sequencing.
Primer set
Sense primer
Antisense primer
Frg. Size, bp
An. Temp
Fragment location*
MAL MSP-M
TTCGGGTTTTTTTGTTTTTAATTC
GAAAACCATAACGACGTACTAACGT
139
56
-71 to 68
MAL MSP-U
TTTTGGGTTTTTTTGTTTTTAATTT
ACAAAAACCATAACAACATACTAACATC
142
56
-72 to 70
MAL BS_A
GGGTTTTTTTGTTTTTAATT
ACCAAAAACCACTCACAAACTC
236
53
-68 to 168
MAL BS_B
GGAAAAATGAAGGAGATTTAAATTT
AATAACCTAAACRCCCCC
404
50
-427 to -23
Abbreviations: MSP, methylation-specific polymerase chain reaction; BS, bisulphite sequencing; M, methylated-specific primers; U, unmethylated-specific primers; Frg. Size, fragment size; An. Temp, annealing temperature (in degrees celsius). *Fragment location lists the start and end point (in base pairs) of each fragment relative to the transcription start point provided by NCBI (RefSeq ID NM_002371).

Bisulphite sequencing

All colon cancer cell lines (n = 20) were subjected to direct bisulphite sequencing of the MAL promoter [23]. Two fragments were amplified: fragment A, covering bases -68 to 168 relative to the transcription start point (overlapping with our MSP product), and fragment B covering bases -427 to -23. Fragment A covered altogether 24 CpG sites and was amplified using the HotStarTaq DNA polymerase and 35 PCR cycles. Fragment B covered altogether 32 CpG sites and was amplified using the same polymerase and 36 PCR cycles. The primer sequences are listed in Table 2. Excess primer and nucleotides were removed by ExoSAP-IT treatment following the protocol of the manufacturer (GE Healthcare, USB Corporation, Ohio, USA). The purified products were subsequently sequenced using the dGTP BigDye Terminator Cycle Sequencing Ready Reaction kit (Applied Biosystems, Foster City, CA, USA) in an AB Prism 3730 sequencer (Applied Biosystems). The approximate amount of methyl cytosine of each CpG site was calculated by comparing the peak height of the cytosine signal with the sum of the cytosine and thymine peak height signals, as previously described [24]. CpG sites with ratios ranging from 0 – 0.20 were classified as unmethylated, CpG sites within the range 0.21 – 0.80 were classified as partially methylated, and CpG sites ranging from 0.81 – 1.0 were classified as hypermethylated.

cDNA preparation and real-time quantitative gene expression

Total RNA was extracted from cell lines (n = 46), tumours (n = 16), and normal tissue (n = 3) using Trizol (Invitrogen, Carlsbad, CA, USA) and the RNA concentration was determined using ND-1000 Nanodrop (NanoDrop Technologies, Wilmington, DE, USA). For each sample, total RNA was converted to cDNA using a High-Capacity cDNA Archive kit (Applied Biosystems), including random primers. MAL (Hs00242749_m1 and Hs00360838_m1) and the endogenous controls ACTB (Hs99999903_m1) and GUSB (Hs99999908_m1) were amplified separately in 96 well fast plates following the recommended protocol (Applied Biosystems), and the real time quantitative gene expression was measured by the 7900 HT Sequence Detection System (Applied Biosystems). All samples were analyzed in triplicate, and the median value was used for data analysis. The human universal reference RNA (containing a mixture of RNA from ten different cell lines; Stratagene) was used to generate a standard curve, and the resulting quantitative expression levels of MAL were normalized against the mean value of the two endogenous controls.

Tissue microarray

For in situ detection of protein expression in colorectal cancers, a tissue microarray (TMA) was constructed, based on the technology previously described [25]. Embedded in the TMA are 292 cylindrical tissue cores (0.6 mm in diameter) from ethanol-fixed and paraffin embedded tumour samples derived from 281 individuals. Samples from the same patient series has been examined for various biological variables and clinical end-points [18, 2628]. In addition, the array contains normal tissues from kidney, liver, spleen, and heart as controls. Ethanol-fixed normal colon tissues from four persons with no known history of colorectal cancer were obtained separately.

Immunohistochemical in situ protein expression analysis

Five μm thick sections of the TMA blocks were transferred onto glass slides for immunohistochemical analyses. The sections were deparaffinized in a xylene bath for 10 minutes and rehydrated via a series of graded ethanol baths. Heat-induced epitope retrieval was performed by heating in a microwave oven at full effect (850 W) for 5 minutes followed by 15 minutes at 100 W immersed in 10 mM citrate buffer at pH 6.0 containing 0.05% Tween-20. After cooling to room temperature, the immunohistochemical staining was performed according to the protocol of the DAKO Envision+™ K5007 kit (Dako, Glostrup, Denmark). The primary antibody, mouse clone 6D9 anti-MAL [29], was used at a dilution of 1:5000, which allowed for staining of kidney tubuli as positive control, while the heart muscle tissue remained unstained as negative control [30]. The slides were counterstained with haematoxylin for 2 minutes and then dehydrated in increasing grades of ethanol and finally in xylene. Results from the immunohistochemistry were obtained by independent scoring by one of the authors and a reference pathologist.

Statistics

All P values were derived from two tailed statistical tests using the SPSS 13.0 software (SPSS, Chicago, IL, USA). Fisher's exact test was used to analyze 2 × 2 contingency tables. A 2 × 3 table and Chi-square test was used to analyze the potential association between quantitative gene expression of MAL and promoter methylation status. Samples were divided into two categories according to their gene expression levels: low expression included samples with gene expression equal to, or lower than, the median value across all cell lines or all tumours, high expression included samples with gene expression higher that the median. The methylation status was divided into three categories: unmethylated, partial methylation, and hypermethylated.

Results

Promoter methylation status of MAL in tissues and cell lines

The promoter methylation status of MAL was analyzed with MSP (Figure 1). One of 23 (4%) normal mucosa samples from non-cancerous donors and two of 21 (10%) normal mucosa samples taken in distance from the primary tumour were methylated but displayed only low-intensity band compared with the positive control after gel electrophoresis. Forty-five of 63 (71%) adenomas and 49/61 (80%) carcinomas showed promoter hypermethylation. Nineteen of twenty colon cancer cell lines (95%), and 15/26 (58%) cancer cell lines from various tissues (breast, kidney, ovary, pancreas, prostate, and uterus) were hypermethylated (Table 1 lists tissue-specific frequencies).
The hypermethylation frequency found in normal samples was significantly lower than in adenomas (P < 0.0001) and carcinomas (P < 0.0001). Hypermethylation of the MAL promoter was not associated with MSI status, gender, or age in neither malignant nor benign tumours. Among carcinomas, tumours with distal location in the bowel (left side and rectum) were more frequently hypermethylated than were tumours with proximal location, although not statistically significant (P = 0.088). Among adenomas, no significant association could be found between promoter methylation status of MAL and polyp size or number.

Bisulphite sequencing verification of the promoter methylation status of MAL

Two overlapping fragments of the MAL promoter were bisulphite sequenced in 20 colon cancer cell lines. The results are summarized in Figure 2, and representative raw data can be seen in Figure 3. A good association was seen between the methylation status, as assessed by MSP, and the bisulphite sequences of the overlapping fragment A. However, in fragment B there was poor association with the MSP data. For this fragment, which is located farther upstream relative to the transcription start point, several consecutive CpG sites were frequently unmethylated and/or partially methylated. This held true also in cell lines shown to be heavily methylated around the transcription start point (fragment A; Figure 2).

Real-time quantitative gene expression

The level of MAL mRNA expression in cell lines (n = 46), primary colorectal carcinomas (n = 16), and normal mucosa (n = 3) was assessed by quantitative real time PCR. There was a strong association between MAL promoter hypermethylation and reduced or lost gene expression among cell lines (P = 0.041; Figure 4). Furthermore, the gene expression of MAL was up-regulated in colon cancer cell lines after promoter demethylation induced by the combined treatment 5-aza-2'-deoxycytidine and trichostatin A (Figure 5). Treatment with the deacetylase inhibitor trichostatin A alone did not increase MAL expression, whereas treatment with the DNA demethylating 5-aza-2'-deoxycytidine led to high expression in HT29 cells, but more moderate levels in HCT15 cells (Figure 5). Among primary colorectal carcinomas, those harbouring promoter hypermethylation of MAL (n = 13) expressed somewhat lower levels of MAL mRNA compared with the unmethylated tumours (n = 3), although not statistically significant (Figure 4).

MAL protein expression is lost in colorectal carcinomas

To evaluate the immunohistochemistry analyses of MAL, kidney and heart muscle tissues were included as positive and negative controls, respectively (Figure 6A–B) [30]. From the 231 scorable colorectal tissue cores, i.e. those containing malignant colorectal epithelial tissue, 198 were negative for MAL staining (Figure 6C–D). Twenty-nine of these had positive staining in non-epithelial tissue components within the same tissue cores, mainly in neurons and blood vessels (not shown). In comparison, all the sections of normal colon tissue contained positive staining for MAL in the epithelial cells (Figure 6E–F).

Discussion

In the present study, we have demonstrated that a sequence within the MAL promoter close to the transcription start is hypermethylated in the vast majority of malignant, as well as in benign colorectal tumours, in contrast to normal colon mucosa samples which are unmethylated, and we contend that MAL remains a promising diagnostic biomarker for early colorectal tumorigenesis [12]. The adenomas and carcinomas analyzed in the present study are from unselected clinical series and are therefore representative for the average risk population. However, the equal distribution between MSI and MSS carcinomas in the present study is not representative for a consecutive series.
Hypermethylation of MAL has, by quantitative methylation-specific polymerase chain reaction (MSP), previously been shown by others to be present only in a small fraction (6%, 2/34) of colon carcinomas [31], even though the expression of MAL was reported to be reduced/lost in the majority of colorectal tumours [11, 17, 31]. In contrast, we report here a significantly higher methylation frequency of MAL in both benign and malignant colorectal tumours (71% in adenomas and 80% in carcinomas). The discrepancy in methylation frequencies between the present report and the previous study by Mori and co-workers [31] is probably a consequence of study design. From direct bisulphite sequencing of colon cancer cell lines, we have now shown that the DNA methylation of MAL is unequally distributed within the CpG island of its promoter (Figure 2). CpG islands often span more than one kilobase of the gene promoter, and the methylation status within this region is sometimes mistakenly assumed to be equally distributed. This is exemplified by the MLH1 gene in which hypermethylation of a limited number of CpG sites approximately 200 base pairs upstream of the transcription start point invariably correlates with the lack of gene expression, while other sites do not [32, 33]. Since the results of an MSP analysis rely on the match or mismatch of the unmethylated and methylated primer sequences to bisulphite treated DNA, one should ensure that the primers anneal to relevant CpG sites in the gene promoter. In the present study, we designed the MSP primers close to the transcription start point of the gene (-72 to +70) and found, by bisulphite sequencing, concordance between the overall methylation status of MAL as assessed by MSP and the methylation status of the individual CpG sites covered by our MSP primer set (Figure 2). This part of the CpG island was hypermethylated in the majority of colon cancer cell lines (95%). We also found that these cell lines, as well as those of other tissues, showed loss of MAL RNA expression from quantitative real time analyses, and that removal of DNA hypermethylation by the combined treatment of 5-aza-2'-deoxycytidine and Trichostatin A re-induced the expression of MAL in colon cancer cell lines (Figure 5). Furthermore, by analyzing a large series of clinically representative samples by protein immunohistochemistry we confirmed that the expression of MAL was lost in malignant colorectal epithelial cells as compared to normal mucosa.
We have further analyzed the same region of the MAL promoter as Mori et al., which is located -206 to -126 base pairs upstream of the transcription start point [31]. By direct bisulphite sequencing, we showed that only a minority of the CpG sites covered by the Mori antisense primer were methylated in the 19 colon cancer cell lines that were heavily methylated around the transcription start point (Figure 2). We therefore conclude that the very low (six percent) methylation frequency initially reported for MAL in colon carcinomas [31] is most likely a consequence of the primer design and choice of CpG sites to be examined.
Inactivating hypermethylation of the MAL promoter might be prevalent also in other cancer types where low expression of MAL has been shown not to correlate with allelic loss or somatic mutations in the MAL gene [34]. In the present study, hypermethylated MAL was found in cancer cell lines from breast, kidney, ovary, and uterus.
The present analyses of cancer cell lines from seven tissues indicate that the hypermethylation of a limited area in the proximity of the transcription start point of MAL is associated with reduced or lost gene expression. However, among colorectal carcinomas and cell lines, MAL protein and gene expression seemed to be lost or reduced in all samples, including the minority with unmethylated MAL promoters. This underlines that loss of the MAL protein might have an important function in colorectal tumorigenesis and we hypothesize that early during colorectal neoplasia the gene is turned off by epigenetic mechanisms other than DNA methylation. The DNA methylation is subsequently recruited to the MAL promoter to "seal" the unexpressed state. Hence, it needs to be established whether MAL promoter hypermethylation is a cause or a consequence of the observed loss of gene expression in colorectal tumors. This is interesting from a biological – but not necessarily a diagnostic – perspective. The distinction between the two is supported by the fact that one of the most promising diagnostic biomarkers for colorectal cancer reported so far, DNA hypermethylation of the vimentin (VIM) gene, is not expected to alter the gene expression, nor to confer a selective advantage upon cancer cells in the colon, considering the lack of VIM expression by normal colonic epithelial cells [9].
A sensitive non-invasive screening approach for colorectal cancer could markedly improve the clinical outcome for the patient. Such a diagnostic test could in principle measure the status of a single biomarker, although multiple markers are probably needed to achieve sufficient sensitivity and specificity. Several studies have successfully detected such tumour-specific products in the faeces, and most experience has been with mutant genetic markers, including APC, KRAS, TP53, and BAT-26 [35]. However, one of the most promising faecal DNA tests so far consisted of a combination of a genetic DNA integrity assay and an epigenetic VIM methylation assay, resulting in 88% sensitivity and 82% specificity [36]. This panel might be further improved by implementing MAL and/or, as suggested by others, the SFRP2 marker, which has an independent sensitivity and specificity of 77% in faecal DNA [8].
Hypermethylation of the MAL promoter represents, to the best of our knowledge, the most frequently hypermethylated gene among pre-malignant colorectal lesions, accompanied by low methylation frequencies in normal colon mucosa. The presence of such epigenetic changes in pre-malignant tissues might also have implications for cancer chemoprevention. By inhibiting or reversing these epigenetic alterations, the progression to a malignant phenotype might be prevented [37]. However, for the purpose of cancer risk assessment, MAL methylation status should be used in combination with other markers to recognize high risk adenomas.

Conclusion

Promoter hypermethylation of MAL remains one of the most promising diagnostic biomarkers for early detection of colorectal tumours, and, together with other biomarkers, it merits further investigation with the purpose of developing a diagnostic marker panel with the necessary sensitivity and specificity to discover colorectal neoplasia and perform a risk assessment.

Acknowledgements

We are grateful to Vera M. Abeler for evaluating the immunohistochemical staining of the TMA tissue cores and to Stine Aske Danielsen for technical assistance. GEL is a post doc and MB is a PhD student supported by the Norwegian Cancer Society (grant A95068, RAL). The study is also supported by grants from the Norwegian Research Council (163962/V50, RAL and 161448/V40, RAL). MAA is supported by grants from the Ministerio de Educación y Ciencia (BFU2006-01925; GEN2003-20662-C07-02).
Open Access This article is published under license to BioMed Central Ltd. This is an Open Access article is distributed under the terms of the Creative Commons Attribution License ( https://​creativecommons.​org/​licenses/​by/​2.​0 ), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Competing interests

The author(s) declare that they have no competing interests.

Authors' contributions

GEL and TA carried out the MSP analyses and interpreted the results independent of each other. GEL additionally designed the study, carried out the bisulphite sequencing and the quantitative real-time PCR analyses, performed the statistics, and drafted the manuscript. MK carried out the immunohistochemistry analyses, interpreted the results together with an expert pathologist and contributed in manuscript preparations. MB isolated DNA from cancer cell lines. ME cultured all cell lines and treated colon cancer cell lines with epigenetic drugs. MAA provided the antibody for immunohistochemical analyses and contributed with scientific discussion. AK provided several of the cancer cell lines. GIM and TOR have collected the series of human primary carcinomas and normal mucosa tissue and provided all clinical and pathological information regarding these samples. RIS generated the tissue microarray and contributed in manuscript preparations. ETE has provided the series of adenoma samples and provided all clinical and pathological information regarding these samples and contributed in manuscript preparations. RAL conceived the study, participated in its design, contributed in evaluation of results, scientific discussion and in manuscript preparation. All authors have read and approved the final manuscript.
Literatur
1.
Zurück zum Zitat Feinberg AP, Ohlsson R, Henikoff S: The epigenetic progenitor origin of human cancer. Nat Rev Genet. 2006, 7: 21-33. 10.1038/nrg1748.CrossRefPubMed Feinberg AP, Ohlsson R, Henikoff S: The epigenetic progenitor origin of human cancer. Nat Rev Genet. 2006, 7: 21-33. 10.1038/nrg1748.CrossRefPubMed
2.
Zurück zum Zitat Kane MF, Loda M, Gaida GM, Lipman J, Mishra R, Goldman H, Jessup JM, Kolodner R: Methylation of the hMLH1 promoter correlates with lack of expression of hMLH1 in sporadic colon tumors and mismatch repair-defective human tumor cell lines. Cancer Res. 1997, 57: 808-811.PubMed Kane MF, Loda M, Gaida GM, Lipman J, Mishra R, Goldman H, Jessup JM, Kolodner R: Methylation of the hMLH1 promoter correlates with lack of expression of hMLH1 in sporadic colon tumors and mismatch repair-defective human tumor cell lines. Cancer Res. 1997, 57: 808-811.PubMed
3.
Zurück zum Zitat Herman JG, Umar A, Polyak K, Graff JR, Ahuja N, Issa JP, Markowitz S, Willson JK, Hamilton SR, Kinzler KW, Kane MF, Kolodner RD, Vogelstein B, Kunkel TA, Baylin SB: Incidence and functional consequences of hMLH1 promoter hypermethylation in colorectal carcinoma. Proc Natl Acad Sci U S A. 1998, 95: 6870-6875. 10.1073/pnas.95.12.6870.PubMedCentralCrossRefPubMed Herman JG, Umar A, Polyak K, Graff JR, Ahuja N, Issa JP, Markowitz S, Willson JK, Hamilton SR, Kinzler KW, Kane MF, Kolodner RD, Vogelstein B, Kunkel TA, Baylin SB: Incidence and functional consequences of hMLH1 promoter hypermethylation in colorectal carcinoma. Proc Natl Acad Sci U S A. 1998, 95: 6870-6875. 10.1073/pnas.95.12.6870.PubMedCentralCrossRefPubMed
4.
Zurück zum Zitat Cunningham JM, Christensen ER, Tester DJ, Kim CY, Roche PC, Burgart LJ, Thibodeau SN: Hypermethylation of the hMLH1 promoter in colon cancer with microsatellite instability. Cancer Res. 1998, 58: 3455-3460.PubMed Cunningham JM, Christensen ER, Tester DJ, Kim CY, Roche PC, Burgart LJ, Thibodeau SN: Hypermethylation of the hMLH1 promoter in colon cancer with microsatellite instability. Cancer Res. 1998, 58: 3455-3460.PubMed
5.
Zurück zum Zitat Esteller M, Sparks A, Toyota M, Sanchez-Cespedes M, Capella G, Peinado MA, Gonzalez S, Tarafa G, Sidransky D, Meltzer SJ, Baylin SB, Herman JG: Analysis of adenomatous polyposis coli promoter hypermethylation in human cancer. Cancer Res. 2000, 60: 4366-4371.PubMed Esteller M, Sparks A, Toyota M, Sanchez-Cespedes M, Capella G, Peinado MA, Gonzalez S, Tarafa G, Sidransky D, Meltzer SJ, Baylin SB, Herman JG: Analysis of adenomatous polyposis coli promoter hypermethylation in human cancer. Cancer Res. 2000, 60: 4366-4371.PubMed
6.
Zurück zum Zitat Burri N, Shaw P, Bouzourene H, Sordat I, Sordat B, Gillet M, Schorderet D, Bosman FT, Chaubert P: Methylation silencing and mutations of the p14ARF and p16INK4a genes in colon cancer. Lab Invest. 2001, 81: 217-229.CrossRefPubMed Burri N, Shaw P, Bouzourene H, Sordat I, Sordat B, Gillet M, Schorderet D, Bosman FT, Chaubert P: Methylation silencing and mutations of the p14ARF and p16INK4a genes in colon cancer. Lab Invest. 2001, 81: 217-229.CrossRefPubMed
7.
Zurück zum Zitat Laird PW: The power and the promise of DNA methylation markers. Nat Rev Cancer. 2003, 3: 253-266. 10.1038/nrc1045.CrossRefPubMed Laird PW: The power and the promise of DNA methylation markers. Nat Rev Cancer. 2003, 3: 253-266. 10.1038/nrc1045.CrossRefPubMed
8.
Zurück zum Zitat Müller HM, Oberwalder M, Fiegl H, Morandell M, Goebel G, Zitt M, Mühlthaler M, Ofner D, Margreiter R, Widschwendter M: Methylation changes in faecal DNA: a marker for colorectal cancer screening?. Lancet. 2004, 363: 1283-1285. 10.1016/S0140-6736(04)16002-9.CrossRefPubMed Müller HM, Oberwalder M, Fiegl H, Morandell M, Goebel G, Zitt M, Mühlthaler M, Ofner D, Margreiter R, Widschwendter M: Methylation changes in faecal DNA: a marker for colorectal cancer screening?. Lancet. 2004, 363: 1283-1285. 10.1016/S0140-6736(04)16002-9.CrossRefPubMed
9.
Zurück zum Zitat Chen WD, Han ZJ, Skoletsky J, Olson J, Sah J, Myeroff L, Platzer P, Lu S, Dawson D, Willis J, Pretlow TP, Lutterbaugh J, Kasturi L, Willson JK, Rao JS, Shuber A, Markowitz SD: Detection in fecal DNA of colon cancer-specific methylation of the nonexpressed vimentin gene. J Natl Cancer Inst. 2005, 97: 1124-1132.CrossRefPubMed Chen WD, Han ZJ, Skoletsky J, Olson J, Sah J, Myeroff L, Platzer P, Lu S, Dawson D, Willis J, Pretlow TP, Lutterbaugh J, Kasturi L, Willson JK, Rao JS, Shuber A, Markowitz SD: Detection in fecal DNA of colon cancer-specific methylation of the nonexpressed vimentin gene. J Natl Cancer Inst. 2005, 97: 1124-1132.CrossRefPubMed
10.
Zurück zum Zitat Zhang W, Bauer M, Croner RS, Pelz JO, Lodygin D, Hermeking H, Sturzl M, Hohenberger W, Matzel KE: DNA Stool Test for Colorectal Cancer: Hypermethylation of the Secreted Frizzled-Related Protein-1 Gene. Dis Colon Rectum. 2007 Zhang W, Bauer M, Croner RS, Pelz JO, Lodygin D, Hermeking H, Sturzl M, Hohenberger W, Matzel KE: DNA Stool Test for Colorectal Cancer: Hypermethylation of the Secreted Frizzled-Related Protein-1 Gene. Dis Colon Rectum. 2007
11.
Zurück zum Zitat Lind GE, Kleivi K, Meling GI, Teixeira MR, Thiis-Evensen E, Rognum TO, Lothe RA: ADAMTS1, CRABP1, and NR3C1 identified as epigenetically deregulated genes in colorectal tumorigenesis. Cell Oncol. 2006, 28: 259-272.PubMed Lind GE, Kleivi K, Meling GI, Teixeira MR, Thiis-Evensen E, Rognum TO, Lothe RA: ADAMTS1, CRABP1, and NR3C1 identified as epigenetically deregulated genes in colorectal tumorigenesis. Cell Oncol. 2006, 28: 259-272.PubMed
12.
Zurück zum Zitat Lind GE, Ahlquist T, Lothe RA: DNA hypermethylation of MAL: a promising diagnostic biomarker for colorectal tumors. Gastroenterology. 2007, 132: 1631-1632. 10.1053/j.gastro.2007.03.003.CrossRefPubMed Lind GE, Ahlquist T, Lothe RA: DNA hypermethylation of MAL: a promising diagnostic biomarker for colorectal tumors. Gastroenterology. 2007, 132: 1631-1632. 10.1053/j.gastro.2007.03.003.CrossRefPubMed
13.
Zurück zum Zitat Puertollano R, Martin-Belmonte F, Millan J, de Marco MC, Albar JP, Kremer L, Alonso MA: The MAL proteolipid is necessary for normal apical transport and accurate sorting of the influenza virus hemagglutinin in Madin-Darby canine kidney cells. J Cell Biol. 1999, 145: 141-151. 10.1083/jcb.145.1.141.PubMedCentralCrossRefPubMed Puertollano R, Martin-Belmonte F, Millan J, de Marco MC, Albar JP, Kremer L, Alonso MA: The MAL proteolipid is necessary for normal apical transport and accurate sorting of the influenza virus hemagglutinin in Madin-Darby canine kidney cells. J Cell Biol. 1999, 145: 141-151. 10.1083/jcb.145.1.141.PubMedCentralCrossRefPubMed
14.
Zurück zum Zitat Tugores A, Rubio T, Rancano C, Alonso MA: A tandem array of Sp-1 sites and a reverse initiator element are both required for synergistic transcriptional activation of the T-cell-specific MAL gene. DNA Cell Biol. 1997, 16: 245-255.CrossRefPubMed Tugores A, Rubio T, Rancano C, Alonso MA: A tandem array of Sp-1 sites and a reverse initiator element are both required for synergistic transcriptional activation of the T-cell-specific MAL gene. DNA Cell Biol. 1997, 16: 245-255.CrossRefPubMed
15.
Zurück zum Zitat Alonso MA, Weissman SM: cDNA cloning and sequence of MAL, a hydrophobic protein associated with human T-cell differentiation. Proc Natl Acad Sci U S A. 1987, 84: 1997-2001. 10.1073/pnas.84.7.1997.PubMedCentralCrossRefPubMed Alonso MA, Weissman SM: cDNA cloning and sequence of MAL, a hydrophobic protein associated with human T-cell differentiation. Proc Natl Acad Sci U S A. 1987, 84: 1997-2001. 10.1073/pnas.84.7.1997.PubMedCentralCrossRefPubMed
16.
Zurück zum Zitat Marazuela M, Alonso MA: Expression of MAL and MAL2, two elements of the protein machinery for raft-mediated transport, in normal and neoplastic human tissue. Histol Histopathol. 2004, 19: 925-933.PubMed Marazuela M, Alonso MA: Expression of MAL and MAL2, two elements of the protein machinery for raft-mediated transport, in normal and neoplastic human tissue. Histol Histopathol. 2004, 19: 925-933.PubMed
17.
Zurück zum Zitat Mimori K, Shiraishi T, Mashino K, Sonoda H, Yamashita K, Yoshinaga K, Masuda T, Utsunomiya T, Alonso MA, Inoue H, Mori M: MAL gene expression in esophageal cancer suppresses motility, invasion and tumorigenicity and enhances apoptosis through the Fas pathway. Oncogene. 2003, 22: 3463-3471. 10.1038/sj.onc.1206378.CrossRefPubMed Mimori K, Shiraishi T, Mashino K, Sonoda H, Yamashita K, Yoshinaga K, Masuda T, Utsunomiya T, Alonso MA, Inoue H, Mori M: MAL gene expression in esophageal cancer suppresses motility, invasion and tumorigenicity and enhances apoptosis through the Fas pathway. Oncogene. 2003, 22: 3463-3471. 10.1038/sj.onc.1206378.CrossRefPubMed
18.
Zurück zum Zitat Meling GI, Lothe RA, Børresen AL, Hauge S, Graue C, Clausen OP, Rognum TO: Genetic alterations within the retinoblastoma locus in colorectal carcinomas. Relation to DNA ploidy pattern studied by flow cytometric analysis. Br J Cancer. 1991, 64: 475-480.PubMedCentralCrossRefPubMed Meling GI, Lothe RA, Børresen AL, Hauge S, Graue C, Clausen OP, Rognum TO: Genetic alterations within the retinoblastoma locus in colorectal carcinomas. Relation to DNA ploidy pattern studied by flow cytometric analysis. Br J Cancer. 1991, 64: 475-480.PubMedCentralCrossRefPubMed
19.
Zurück zum Zitat Thiis-Evensen E, Hoff GS, Sauar J, Langmark F, Majak BM, Vatn MH: Population-based surveillance by colonoscopy: effect on the incidence of colorectal cancer. Telemark Polyp Study I. Scand J Gastroenterol. 1999, 34: 414-420. 10.1080/003655299750026443.CrossRefPubMed Thiis-Evensen E, Hoff GS, Sauar J, Langmark F, Majak BM, Vatn MH: Population-based surveillance by colonoscopy: effect on the incidence of colorectal cancer. Telemark Polyp Study I. Scand J Gastroenterol. 1999, 34: 414-420. 10.1080/003655299750026443.CrossRefPubMed
20.
Zurück zum Zitat Grunau C, Clark SJ, Rosenthal A: Bisulfite genomic sequencing: systematic investigation of critical experimental parameters. Nucleic Acids Res. 2001, 29: E65-E65. 10.1093/nar/29.13.e65.PubMedCentralCrossRefPubMed Grunau C, Clark SJ, Rosenthal A: Bisulfite genomic sequencing: systematic investigation of critical experimental parameters. Nucleic Acids Res. 2001, 29: E65-E65. 10.1093/nar/29.13.e65.PubMedCentralCrossRefPubMed
21.
Zurück zum Zitat Herman JG, Graff JR, Myöhänen S, Nelkin BD, Baylin SB: Methylation-specific PCR: a novel PCR assay for methylation status of CpG islands. Proc Natl Acad Sci U S A. 1996, 93: 9821-9826. 10.1073/pnas.93.18.9821.PubMedCentralCrossRefPubMed Herman JG, Graff JR, Myöhänen S, Nelkin BD, Baylin SB: Methylation-specific PCR: a novel PCR assay for methylation status of CpG islands. Proc Natl Acad Sci U S A. 1996, 93: 9821-9826. 10.1073/pnas.93.18.9821.PubMedCentralCrossRefPubMed
22.
Zurück zum Zitat Li LC, Dahiya R: MethPrimer: designing primers for methylation PCRs. Bioinformatics. 2002, 18: 1427-1431. 10.1093/bioinformatics/18.11.1427.CrossRefPubMed Li LC, Dahiya R: MethPrimer: designing primers for methylation PCRs. Bioinformatics. 2002, 18: 1427-1431. 10.1093/bioinformatics/18.11.1427.CrossRefPubMed
23.
Zurück zum Zitat Clark SJ, Harrison J, Paul CL, Frommer M: High sensitivity mapping of methylated cytosines. Nucleic Acids Res. 1994, 22: 2990-2997. 10.1093/nar/22.15.2990.PubMedCentralCrossRefPubMed Clark SJ, Harrison J, Paul CL, Frommer M: High sensitivity mapping of methylated cytosines. Nucleic Acids Res. 1994, 22: 2990-2997. 10.1093/nar/22.15.2990.PubMedCentralCrossRefPubMed
24.
Zurück zum Zitat Melki JR, Vincent PC, Clark SJ: Concurrent DNA hypermethylation of multiple genes in acute myeloid leukemia. Cancer Res. 1999, 59: 3730-3740.PubMed Melki JR, Vincent PC, Clark SJ: Concurrent DNA hypermethylation of multiple genes in acute myeloid leukemia. Cancer Res. 1999, 59: 3730-3740.PubMed
25.
Zurück zum Zitat Kononen J, Bubendorf L, Kallioniemi A, Barlund M, Schraml P, Leighton S, Torhorst J, Mihatsch MJ, Sauter G, Kallioniemi OP: Tissue microarrays for high-throughput molecular profiling of tumor specimens. Nat Med. 1998, 4: 844-847. 10.1038/nm0798-844.CrossRefPubMed Kononen J, Bubendorf L, Kallioniemi A, Barlund M, Schraml P, Leighton S, Torhorst J, Mihatsch MJ, Sauter G, Kallioniemi OP: Tissue microarrays for high-throughput molecular profiling of tumor specimens. Nat Med. 1998, 4: 844-847. 10.1038/nm0798-844.CrossRefPubMed
26.
Zurück zum Zitat Diep CB, Thorstensen L, Meling GI, Skovlund E, Rognum TO, Lothe RA: Genetic tumor markers with prognostic impact in Dukes' stages B and C colorectal cancer patients. J Clin Oncol. 2003, 21: 820-829. 10.1200/JCO.2003.05.190.CrossRefPubMed Diep CB, Thorstensen L, Meling GI, Skovlund E, Rognum TO, Lothe RA: Genetic tumor markers with prognostic impact in Dukes' stages B and C colorectal cancer patients. J Clin Oncol. 2003, 21: 820-829. 10.1200/JCO.2003.05.190.CrossRefPubMed
27.
Zurück zum Zitat Lothe RA, Peltomäki P, Meling GI, Aaltonen LA, Nyström-Lahti M, Pylkkänen L, Heimdal K, Andersen TI, Møller P, Rognum TO, Fosså SD, Haldorsen T, Langmark F, Brøgger A, de la Chapelle A, Børresen AL: Genomic instability in colorectal cancer: relationship to clinicopathological variables and family history. Cancer Res. 1993, 53: 5849-5852.PubMed Lothe RA, Peltomäki P, Meling GI, Aaltonen LA, Nyström-Lahti M, Pylkkänen L, Heimdal K, Andersen TI, Møller P, Rognum TO, Fosså SD, Haldorsen T, Langmark F, Brøgger A, de la Chapelle A, Børresen AL: Genomic instability in colorectal cancer: relationship to clinicopathological variables and family history. Cancer Res. 1993, 53: 5849-5852.PubMed
28.
Zurück zum Zitat Thorstensen L, Lind GE, Løvig T, Diep CB, Meling GI, Rognum TO, Lothe RA: Genetic and Epigenetic Changes of Components Affecting the WNT Pathway in Colorectal Carcinomas Stratified by Microsatellite Instability. Neoplasia. 2005, 7: 99-108. 10.1593/neo.04448.PubMedCentralCrossRefPubMed Thorstensen L, Lind GE, Løvig T, Diep CB, Meling GI, Rognum TO, Lothe RA: Genetic and Epigenetic Changes of Components Affecting the WNT Pathway in Colorectal Carcinomas Stratified by Microsatellite Instability. Neoplasia. 2005, 7: 99-108. 10.1593/neo.04448.PubMedCentralCrossRefPubMed
29.
Zurück zum Zitat Martin-Belmonte F, Kremer L, Albar JP, Marazuela M, Alonso MA: Expression of the MAL gene in the thyroid: the MAL proteolipid, a component of glycolipid-enriched membranes, is apically distributed in thyroid follicles. Endocrinology. 1998, 139: 2077-2084. 10.1210/en.139.4.2077.PubMed Martin-Belmonte F, Kremer L, Albar JP, Marazuela M, Alonso MA: Expression of the MAL gene in the thyroid: the MAL proteolipid, a component of glycolipid-enriched membranes, is apically distributed in thyroid follicles. Endocrinology. 1998, 139: 2077-2084. 10.1210/en.139.4.2077.PubMed
30.
Zurück zum Zitat Marazuela M, Acevedo A, Adrados M, Garcia-Lopez MA, Alonso MA: Expression of MAL, an integral protein component of the machinery for raft-mediated pical transport, in human epithelia. J Histochem Cytochem. 2003, 51: 665-674.CrossRefPubMed Marazuela M, Acevedo A, Adrados M, Garcia-Lopez MA, Alonso MA: Expression of MAL, an integral protein component of the machinery for raft-mediated pical transport, in human epithelia. J Histochem Cytochem. 2003, 51: 665-674.CrossRefPubMed
31.
Zurück zum Zitat Mori Y, Cai K, Cheng Y, Wang S, Paun B, Hamilton JP, Jin Z, Sato F, Berki AT, Kan T, Ito T, Mantzur C, Abraham JM, Meltzer SJ: A genome-wide search identifies epigenetic silencing of somatostatin, tachykinin-1, and 5 other genes in colon cancer. Gastroenterology. 2006, 131: 797-808. 10.1053/j.gastro.2006.06.006.CrossRefPubMed Mori Y, Cai K, Cheng Y, Wang S, Paun B, Hamilton JP, Jin Z, Sato F, Berki AT, Kan T, Ito T, Mantzur C, Abraham JM, Meltzer SJ: A genome-wide search identifies epigenetic silencing of somatostatin, tachykinin-1, and 5 other genes in colon cancer. Gastroenterology. 2006, 131: 797-808. 10.1053/j.gastro.2006.06.006.CrossRefPubMed
32.
Zurück zum Zitat Deng G, Chen A, Hong J, Chae HS, Kim YS: Methylation of CpG in a small region of the hMLH1 promoter invariably correlates with the absence of gene expression. Cancer Res. 1999, 59: 2029-2033.PubMed Deng G, Chen A, Hong J, Chae HS, Kim YS: Methylation of CpG in a small region of the hMLH1 promoter invariably correlates with the absence of gene expression. Cancer Res. 1999, 59: 2029-2033.PubMed
33.
Zurück zum Zitat Deng G, Peng E, Gum J, Terdiman J, Sleisenger M, Kim YS: Methylation of hMLH1 promoter correlates with the gene silencing with a region-specific manner in colorectal cancer. Br J Cancer. 2002, 86: 574-579. 10.1038/sj.bjc.6600148.PubMedCentralCrossRefPubMed Deng G, Peng E, Gum J, Terdiman J, Sleisenger M, Kim YS: Methylation of hMLH1 promoter correlates with the gene silencing with a region-specific manner in colorectal cancer. Br J Cancer. 2002, 86: 574-579. 10.1038/sj.bjc.6600148.PubMedCentralCrossRefPubMed
34.
Zurück zum Zitat Hatta M, Nagai H, Okino K, Onda M, Yoneyama K, Ohta Y, Nakayama H, Araki T, Emi M: Down-regulation of members of glycolipid-enriched membrane raft gene family, MAL and BENE, in cervical squamous cell cancers. J Obstet Gynaecol Res. 2004, 30: 53-58. 10.1111/j.1341-8076.2004.00156.x.CrossRefPubMed Hatta M, Nagai H, Okino K, Onda M, Yoneyama K, Ohta Y, Nakayama H, Araki T, Emi M: Down-regulation of members of glycolipid-enriched membrane raft gene family, MAL and BENE, in cervical squamous cell cancers. J Obstet Gynaecol Res. 2004, 30: 53-58. 10.1111/j.1341-8076.2004.00156.x.CrossRefPubMed
35.
Zurück zum Zitat Osborn NK, Ahlquist DA: Stool screening for colorectal cancer: molecular approaches. Gastroenterology. 2005, 128: 192-206. 10.1053/j.gastro.2004.10.041.CrossRefPubMed Osborn NK, Ahlquist DA: Stool screening for colorectal cancer: molecular approaches. Gastroenterology. 2005, 128: 192-206. 10.1053/j.gastro.2004.10.041.CrossRefPubMed
36.
Zurück zum Zitat Itzkowitz SH, Jandorf L, Brand R, Rabeneck L, Schroy PC, Sontag S, Johnson D, Skoletsky J, Durkee K, Markowitz S, Shuber A: Improved Fecal DNA Test for Colorectal Cancer Screening. Clin Gastroenterol Hepatol. 2007, 5: 111-117. 10.1016/j.cgh.2006.10.006.CrossRefPubMed Itzkowitz SH, Jandorf L, Brand R, Rabeneck L, Schroy PC, Sontag S, Johnson D, Skoletsky J, Durkee K, Markowitz S, Shuber A: Improved Fecal DNA Test for Colorectal Cancer Screening. Clin Gastroenterol Hepatol. 2007, 5: 111-117. 10.1016/j.cgh.2006.10.006.CrossRefPubMed
37.
Zurück zum Zitat Kopelovich L, Crowell JA, Fay JR: The epigenome as a target for cancer chemoprevention. J Natl Cancer Inst. 2003, 95: 1747-1757.CrossRefPubMed Kopelovich L, Crowell JA, Fay JR: The epigenome as a target for cancer chemoprevention. J Natl Cancer Inst. 2003, 95: 1747-1757.CrossRefPubMed
Metadaten
Titel
Hypermethylated MAL gene – a silent marker of early colon tumorigenesis
verfasst von
Guro E Lind
Terje Ahlquist
Matthias Kolberg
Marianne Berg
Mette Eknæs
Miguel A Alonso
Anne Kallioniemi
Gunn I Meling
Rolf I Skotheim
Torleiv O Rognum
Espen Thiis-Evensen
Ragnhild A Lothe
Publikationsdatum
01.12.2008
Verlag
BioMed Central
Erschienen in
Journal of Translational Medicine / Ausgabe 1/2008
Elektronische ISSN: 1479-5876
DOI
https://doi.org/10.1186/1479-5876-6-13

Weitere Artikel der Ausgabe 1/2008

Journal of Translational Medicine 1/2008 Zur Ausgabe

Leitlinien kompakt für die Innere Medizin

Mit medbee Pocketcards sicher entscheiden.

Seit 2022 gehört die medbee GmbH zum Springer Medizin Verlag

Mehr Lebenszeit mit Abemaciclib bei fortgeschrittenem Brustkrebs?

24.05.2024 Mammakarzinom Nachrichten

In der MONARCHE-3-Studie lebten Frauen mit fortgeschrittenem Hormonrezeptor-positivem, HER2-negativem Brustkrebs länger, wenn sie zusätzlich zu einem nicht steroidalen Aromatasehemmer mit Abemaciclib behandelt wurden; allerdings verfehlte der numerische Zugewinn die statistische Signifikanz.

ADT zur Radiatio nach Prostatektomie: Wenn, dann wohl länger

24.05.2024 Prostatakarzinom Nachrichten

Welchen Nutzen es trägt, wenn die Strahlentherapie nach radikaler Prostatektomie um eine Androgendeprivation ergänzt wird, hat die RADICALS-HD-Studie untersucht. Nun liegen die Ergebnisse vor. Sie sprechen für länger dauernden Hormonentzug.

„Überwältigende“ Evidenz für Tripeltherapie beim metastasierten Prostata-Ca.

22.05.2024 Prostatakarzinom Nachrichten

Patienten mit metastasiertem hormonsensitivem Prostatakarzinom sollten nicht mehr mit einer alleinigen Androgendeprivationstherapie (ADT) behandelt werden, mahnt ein US-Team nach Sichtung der aktuellen Datenlage. Mit einer Tripeltherapie haben die Betroffenen offenbar die besten Überlebenschancen.

So sicher sind Tattoos: Neue Daten zur Risikobewertung

22.05.2024 Melanom Nachrichten

Das größte medizinische Problem bei Tattoos bleiben allergische Reaktionen. Melanome werden dadurch offensichtlich nicht gefördert, die Farbpigmente könnten aber andere Tumoren begünstigen.

Update Innere Medizin

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.