Background
Porcine epidemic diarrhea (PED), which is characterized by severe diarrhea, vomiting and dehydration, is a highly contagious enteric disease of swine and is caused by porcine epidemic diarrhea virus (PEDV) [
1]. PED was first reported in England in 1971 [
2] and the virus was identified in Belgium and United Kingdom for the first time [
3]. Since then it has become prevalent in many swine-raising countries and it is one of the most important viral causes of diarrhea, resulting in heavy economic losses to the swine industry, mainly in European and Asia [
4‐
11]. Although the commercial vaccines are available to prevent and control of disease, damage caused by PEDV infection is serious and continuous.
PEDV, the etiologic agent of PED, belongs to the genus
Alphacoronavirus, family
Coronaviridae. It has a genome of single-stranded, positive-sense RNA that is approximately 28 kb in length. The spike protein (S, 180–220kDa), membrane protein (M, 27–32kDa), envelope protein (E, ~7kDa) and nucleocapsid protein (N, 55–58kDa) are the four structural proteins of PEDV [
12]. The S protein and M protein are localized on the surface of the virion. The M protein of coronavirus is the most abundant component of the viral envelope. In silico analysis has suggested that the M protein consists of a triple-transmembrane segment flanked by a short amino-terminal domain on the exterior of the virion and a long carboxy-tail located inside the virion. The M protein of coronaviruses is indispensable in the assembly process and budding of virions [
13‐
15]. The immune reaction to the M protein of coronaviruses plays an important role in the induction of protection and in mediating the course of the disease [
16,
17]. Monoclonal antibodies against the M protein of coronaviruses have virus-neutralizing activity in the presence of complement [
18]. The M protein of coronavirus can also stimulate the production of alpha-interferon (α-IFN) [
19].
Until now, identification of epitopes on the M protein of PEDV has not been reported. McAb development and epitope mapping of the PEDV M protein will provide the basis for the establishment of diagnostic methods for PEDV infection and also increase understanding of the antigenic structure of the M protein.
Discussion
Mapping epitopes of viral proteins and defining the degree of conservation of identified epitopes may facilitate our understanding of the antigenic structure and virus–antibody interactions, and are useful for clinical application. The epitopes of the PEDV S protein have been reported, and these epitopes were shown to be able to induce the production of virus-neutralizing antibodies [
20,
21]. However, to date, the epitope on the M protein of PEDV has not been mapped.
Identification of B-cell epitopes on the M protein requires the preparation of McAb. To produce McAb against the M protein, we had tried to express the intact M protein, but this was unsuccessful (data not shown). As a result of unidentified but complex factors, it is very difficult to express the full-length M protein of coronaviruses [
22,
23]. Finally, we chose to express the truncated C-terminus of the M (tM) protein, and the tM protein was expressed in a fusion form either with a 6×His tag or a GST tag. The results of WB analysis showed that the fusion proteins tM-His
6 and GST-tM could be recognized by PEDV-positive serum, which indicates that both fusion proteins had good reactivity. In order to obtain more specific McAb, the fusion protein tM-His
6 was selected as an immunogen to elicit the formation of antibody. The fusion protein GST-tM was chosen to coat the ELISA plates to screen hybridomas, so that the coating antigen bore a different tag from the immunogen. After cell fusion and three cycles of selection, one McAb, designed 4D4, was chosen because of its specific reactivity with the fusion protein GST-tM as well as the native M protein of the PEDV CH/SHH/06 strain.
To map the epitope on the M protein, three overlapping peptides (M1, M2 and M3) covering the tM protein were expressed with a 6×His tag, respectively. Identified by ELISA and WB, the epitope was located at M3, which spans from residues 160 to 226 of the amino acid sequence of the M protein (Figure
3). Nine peptides spanning the identified epitope M3 were expressed in the form of GST-fusion peptides. Further experiments revealed that the epitope was in the M12 region (
193TGWAFYVR
200) of the M protein (Figure
3). To define more precisely the core epitope, amino acid residues were removed from the carboxy or amino terminals of the peptide M12 one by one to verify the minimal unit of the epitope that could be recognized by McAb 4D4. As demonstrated in Figure
3, the amino acid residues “
195W” and “R
200” were essential for reactivity because deletion of either of them destroyed antibody binding. It is therefore reasonable to deduce that the minimal epitope recognized by McAb 4D4 is
195WAFYVR
200.
Sequence alignment of the amino acids of the identified epitope with those of other PEDV strains and other coronaviruses showed that this epitope was totally conserved across different strains of PEDV, but among different coronaviruses the epitope had only low homology.
To investigate whether the identified epitope 195WAFYVR200 is specific to PEDV, the peptide was expressed as a GST-fusion protein, and subjected to sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and WB analysis. The results demonstrated that the epitope peptide did not react with TGE-positive serum, but it showed reactivity with PEDV-positive serum, indicating that epitope 195WAFYVR200 is specific for PEDV. Therefore, it was possible to distinguish anti-PEDV antibody from anti-TGEV antibody by employing the epitope as antigen. This will be very helpful in distinguishing PEDV from TGEV infection, because these two diseases have similar clinical and pathological signs, which obscures the differentiation of the two diseases, and diarrhea caused by PEDV and TGEV coinfection occurs frequently in the field.
To our knowledge, the epitopes of coronaviruses that have been identified are mainly focused on the S and N proteins. In the case of the M protein of coronaviruses, Qian
et al. identified a B-cell antigenic epitope at the N-terminus of the severe acute respiratory syndrome coronavirus (SARS–CoV) M protein [
24], and Xing
et al. reported a linear B-cell epitope in the M protein of avian infectious bronchitis coronavirus (IBV) [
25]. The epitope of the IBV M protein identified by Xing
et al. was
199FATFVYAK
206. Comparative analysis of the epitope
199FATFVYAK
206 with the corresponding regions of other coronaviruses revealed that the homologous region of the PEDV M protein was
195WAFYVRSK
202[
25]. The epitope of the M protein of PEDV defined in this study was
195WAFYVR
200, and by comparison the homologous region of the IBV M protein was
199FATFVY
204. So, interestingly, the results of our study are consistent with findings regarding the IBV M protein.
Conclusion
In the current study, we generated a McAb, 4D4, and mapped the epitope on the M protein of PEDV using the McAb. The linear B-cell epitope identified, 195WAFYVR200, was highly conserved among different PEDV isolates. Furthermore, this epitope could differentiate PEDV-positive serum from TGEV-positive serum. These data could deepen understanding of the antigenic structure of the M protein. The information regarding the epitope obtained in this study could be used to establish a differential diagnostic test and may be helpful in the design of multi-epitope vaccines.
Methods
Cell lines, viruses and serum specimens
Myeloma cell line SP2/0 and Vero E6 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Hyclone) in humidified 5% CO2 atmosphere at 37°C. All culture media were supplemented with 10% heat-inactivated fetal bovine serum (PAA, Somerset, UK) and antibiotics (0.1mg/ml of streptomycin and 100IU/ml of penicillin). The PEDV CH/SHH/06 strain (EU033966) and TGEV attenuated strain H (EU074218) were maintained in our laboratory. Hyperimmune serum against PEDV and TGEV were obtained from pigs that had been inoculated with purified PEDV or TGEV.
Expression of the truncated form of the PEDV M gene
A truncated form, comprising 387 bp at the C-terminus of the M gene of PEDV CH/SHH/06 strain, was cloned. The sequences of the primers used for amplification of the gene in this study are shown in Table
1.
Table 1
Sequences of the primers used in this study
tM-His6 | F: ATACATATGAGCATTCGGTTGTGGCG | 295–678 | 384bp |
R: CGCCTCGAGGACTAAATGAAGCACT |
F: TAAGGATCCAGCATTCGGTTGTGGCGCAG |
GST-tM | R: CGGCTCGAGGACTAAATGAAGCACTTTCTCAC | 295–678 | 384bp |
F: TATCATATGAGCATTCGGTTGTGG |
M1 | R: TATCTCGAGTACGCCAGTAGCAAC | 295–480 | 186bp |
F: GCGCATATGCTCACTACTTCTGTGAT |
M2 | R: GCGCTCGAGATAGACAATTGTTGTAG | 358–540 | 183bp |
F: GCACATATGGTACAGGTAAGTCAAT |
M3 | R: CTACTCGAGGACTAAATGAAGCACT | 478–678 | 201bp |
F: gatccGTACAGGTAAGTCAATTACCTAATTTCGTCACAGTCGCCA |
M4 | AGGCCACTACAACAATTGTCTATGGACGTGTTtaa c | 478-549 | 72bp |
R: tcgag ttaAACACGTCCATAGACAATTGTTGTAGTGGCCTTGGCGA |
CTGTGACGAAATTAGGTAATTGACTTACCTGTACg |
F: gatccGGACGTGTTGGTCGTTCAGTCAATGCTTCATCTGGCACTG |
M5 | GTTGGGCTTTCTATGTCCGGtaa c | 541–600 | 60bp |
R: tcgag ttaCCGGACATAGAAAGCCCAACCAGTGCCAGATGAAGCA |
TTGACTGAACGACCAACACGTCCg |
M6 | F: gatccTCAGCTGTGAGTAATCCGAGTGCGGTTCTCACAGATtaa c | 592–627 | 36bp |
R: tcgag ttaCACAGCTGAGTAGTCGCCGTGTTTTGACCGGACATAg |
M7 | F: gatccTCAGCTGTGAGTAATCCGAGTGCGGTTCTCACAGATtaa c | 619–654 | 36bp |
R: tcgag ttaATCTGTGAGAACCGCACTCGGATTACTCACAGCTGAg F: gatccCTCACAGATAGTGAGAAAGTGCTTCATTTAGTCtaa c |
M8 | R: tcgag ttaGACTAAATGAAGCACTTTCTCACTATCTGTGAGg | 646–678 | 33bp |
M9 | F: gatccGGACGTGTTGGTCGTTCAGTCAATtaa c | 541–564 | 24bp |
R: tcgag ttaATTGACTGAACGACCAACACGTCCg |
M10 | F: gatccCGTTCAGTCAATGCTTCATCTGGCtaa c | 553–576 | 24bp |
R: tcgag ttaATTGACTGAACGACCAACACGTCCg |
M11 | F: gatccGCTTCATCTGGCACTGGTTGGGCTtaa c | 565–588 | 24bp |
R: tcgag ttaAGCCCAACCAGTGCCAGATGAAGCg |
M12 | F: gatccACTGGTTGGGCTTTCTATGTCCGGtaa c | 577–600 | 24bp |
R: tcgag ttaCCGGACATAGAAAGCCCAACCAGTg |
M13 | F: gatccGGTTGGGCTTTCTATGTCCGGtaa c | 580–600 | 21bp |
R: tcgag ttaCCGGACATAGAAAGCCCAACCg |
M14 | F: gatccTGGGCTTTCTATGTCCGGtaa c | 583–600 | 18bp |
R: tcgag ttaCCGGACATAGAAAGCCCAg |
F003A gatccGCTTTCTATGTCCGGtaa c |
M15 | R: tcgag ttaCCGGACATAGAAAGCg | 586–600 | 15bp |
R: tcgag ttaGACATAGAAAGCCCAg |
M16 | F: gatccTGGGCTTTCTATtaa c | 583–597 | 15bp |
R: tcgag ttaGACATAGAAAGCCCAg |
M17 | F: gatccTGGGCTTTCTATtaa c | 583–594 | 12bp |
R: tcgag ttaATAGAAAGCCCAg |
The amplified truncated form of the M gene (tM, 387bp), encoding the C-terminus of M protein (aa, 99–226), was cloned into prokaryotic expression vectors pET-30a (Novagen, USA) and pGEX-6p-1 (Pharmacia, Belgium), respectively. The inserts in the recombinant plasmids were sequenced and the confirmed plasmids were transformed into E. coli BL21(DE3) and induced by Isopropyl β-D-1-thiogalactopyranoside (IPTG). The expressed fusion proteins were analyzed with SDS-PAGE and detected by staining with Coomassie blue. For preparation of purified proteins, inclusion body proteins were separated by SDS-PAGE, the proteins of interest were excised, and the gel slices were crushed and added to an appropriate volume of sterilized phosphate buffered saline (PBS). After several cycles of freeze–thawing, the fusion proteins were dissolved in PBS, and the PBS was separated from the solid gel by centrifugation. The purity of the fusion proteins generated was analyzed by SDS-PAGE, and the purified proteins were used for ELISA and WB analysis.
Preparation and characterization of McAb against the tM protein
Female six-week-old BALB/c mice were primed subcutaneously with purified tM-His6 protein emulsified with an equal volume of Freund’s complete adjuvant (Sigma, USA). Two booster immunizations were given at two-week intervals with the fusion protein tM-His6 in Freund’s incomplete adjuvant. A final immunization containing purified tM-His6 protein without adjuvant was injected intraperitoneally. Three days after the final injection, the mice were euthanized and their splenocytes were harvested and fused with SP2/0 myeloma cells using polyethylene glycol 1450 (PEG1450, Sigma, USA). The hybridoma cells were seeded into 96-well plates and selected in hypoxanthine–aminopterin–thymidine (HAT) medium and hypoxanthine–thymidine (HT) medium in sequence. Cell culture supernatants of surviving clones were screened for antibody reactivity and specificity by ELISA. The positive hybridoma cell clones were subcloned thrice by limiting dilution. Ascites fluid was produced in separate primed BAB/c mice. The class and subclass of the McAb was determined using a SBA ClonotypingTM System/HRP (Southern Biotechnology Associates, Inc., Birmingham, AL35260, USA).
Animal care and all procedures were performed in accordance with animal ethics guidelines and approved protocols. The animal experiment was approved by Harbin Veterinary Research Institute. The animal Ethics Committee approval number is Heilongjiang-SYXK-2006-032.
Immunofluorescence assay was performed to assess whether the McAb 4D4 could recognize the native M protein. Vero E6 cells were infected with the CH/SHH/06 strain of PEDV and incubated at 37°C for 24 h. The cells were fixed with cold methanol for 10 min and then probed with McAb 4D4 and negative normal mouse serum for 1 h at 37°C. A fluorescein isothiocyanate (FITC)-conjugated goat anti-mouse IgG was used as a secondary antibody, and bound antibodies were visualized under a fluorescence microscope.
The specificity and reactivity of the McAb was determined by WB analysis using purified virus particles of the CH/SHH/06 strain of PEDV and the attenuated H strain of TGEV.
Expression of the truncated forms of the tM gene
To map the epitope of the M protein, a panel of 17 partially overlapping peptides (M1–M17) spanning the tM protein, as shown in Figure
1, were expressed successively. For peptides M1–M3, three pairs of primers were designed to amplify the genes of the fragments, and peptides M1–M3 were expressed with a 6×His tag, respectively. For each peptide M4–M17, a pair of oligonucleotide strands was synthesized. Each pair of oligonucleotide strands was annealed, and the resultant double-stranded DNA contained a BamHI and a XhoI cohesive terminus at the 5' and 3' ends. The annealed fragments were cloned into the expression vector pGEX-6p-1 and expressed as GST fusion proteins.
The recombinant plasmids thus constructed were sequenced and the confirmed recombinant plasmids were transformed into E. coli BL21(DE3). A series of fusion peptides were induced by IPTG and stained with Coomassie blue after SDS-PAGE. Purification of the short fusion peptides was carried out as mentioned above.
Identification of the epitope by indirect ELISA
Ninety-six-well microtiter plates were coated with the purified proteins in 0.1 M carbonate buffer (pH 9.6) at 4°C overnight and blocked with 5% skim milk for 1 h. After washing three times with PBST, 100 μl of McAb was added to the wells and incubated at 37°C for 1 h. Subsequently, the plates were washed thrice and incubated with horseradish peroxidase (HRP)-conjugated goat anti-mouse IgG at 37°C for 1 h. The color was developed and the reaction was terminated with 2 M H2SO4. The absorbance was measured at 450 nm. All assays were performed in triplicate and the results depict the average of the three values.
Mapping of the epitope by WB
The reactivity of the McAb with different truncated M proteins was determined further by WB. Purified truncated proteins were subjected to electrophoresis using 12% SDS-PAGE and transferred onto a nitrocellulose (NC) membrane. Non-specific antibody binding sites were blocked with 5% skim milk in PBS overnight at 4°C. The membranes were incubated with primary antibody at 37°C for 1 h and then washed three times with PBST. Next, the stripes were probed with HRP-conjugated goat anti-mouse IgG (Sigma, USA) for 1 h at 37°C. After three final wash steps, the color was developed using 3,3'-diaminobenzidine (DAB) substrate and was stopped finally by rinsing in deionized water.
Detection of the reactivity and specificity of the epitope defined by McAb 4D4
To investigate the reactivity and specificity of the epitope peptide defined by McAb 4D4, the peptide M14 “GST-WAFYVR” was purified and subjected to WB to investigate its reactivity with PEDV-positive serum, TGEV-positive serum and pre-immune serum from pigs, respectively. The WB was performed as described above, and HRP-conjugated goat anti-swine IgG was used as the secondary antibody.
Homology analysis
To analyze the conservation of the identified epitope among PEDV reference strains, the epitope sequence and flanking sequences of the M protein were compared with those of nine other selected PEDV strains using the DNAMAN software (Lynnon BioSoft Inc., USA). Alignment analysis was also performed between the defined epitope and the corresponding regions of other associated coronavirus strains using the DNASTAR Larsergene program (Windows version; DNASTAR Inc., Madison, WI, USA).
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
LF designed the experiment. ZZ carried out most of the experiments and wrote the manuscript. XC, BY and DS prepared the McAb and analyzed the data from the ELISA. HS participated in some of the experiments. JC and LF revised the manuscript. All the authors read and approved the final manuscript.