Skip to main content
Erschienen in: BMC Infectious Diseases 1/2020

Open Access 01.12.2020 | Research article

Expansion of acquired 16S rRNA methytransferases along with CTX-M-15, NDM and OXA-48 within three sequence types of Escherichia coli from northeast India

verfasst von: Jayalaxmi Wangkheimayum, Mohana Bhattacharjee, Bhaskar Jyoti Das, K. Melson Singha, Debadatta Dhar Chanda, Amitabha Bhattacharjee

Erschienen in: BMC Infectious Diseases | Ausgabe 1/2020

Abstract

Background

This study aimed to identify ten different 16S rRNA methyltransferase genes (rmtA, rmtB, rmtC, rmtD, armA, rmtF, npmA, rmtH, rmtE and rmtG) and their coexisting ESBL and carbapenemase with the emergence of three E.coli clones within a single study centre.

Methods

A total of 329 non-duplicate E.coli isolates were studied to detect the presence of 16S rRNA methyltransferases along with β-lactamases (TEM, SHV, OXA, VEB, GES, PER,CTX-M types, NDM, OXA-48,VIM, IMP and KPC) using PCR assay. Horizontal transferability were validated by transformation and conjugation analysis. Plasmid incompatibility typing and MLST analysis was also performed.

Results

A total of 117 isolates were found to be resistant to at least one of the aminoglycoside antibiotics. It was observed that 77 (65.8%) were positive for 16S rRNA methyltransferases. Among them thirty nine isolates were found to harbour only blaCTX-M-15, whereas combination of genes were observed in three isolates (blaVEB+ blaCTX-M-15 in 2 isolates and blaPER + blaCTX-M-15 in 1 isolate). blaNDM and blaOXA-48 like genes were found in 23 and 9 isolates, respectively. All the resistance genes were conjugatively transferable, and incompatibility typing showed multiple 16S rRNA methyltransferase genes were originated from a single Inc. I1 group. MLST analysis detected 3 clones of E.coliST4410, ST1341 and ST3906.

Conclusion

The present study identified emergence of three clones of E.coli, resistant to aminoglycoside -cephalosporin- carbapenem. This warrants immediate measures to trace their transmission dynamics in order to slow down their spread in clinical setting.
Begleitmaterial
Hinweise
The original version of this article was revised: we were notified of a few errors in Tables 1 and 2
A correction to this article is available online at https://​doi.​org/​10.​1186/​s12879-020-05326-7.

Supplementary information

Supplementary information accompanies this paper at https://​doi.​org/​10.​1186/​s12879-020-05264-4.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Abkürzungen
MLST
Multilocus sequence typing
ESBL
Extended Spectrum Beta-lactamase
MIC
Minimum inhibitory concentration

Background

Aminoglycoside antibiotics have a wide spectrum of activity against both Gram positive and Gram negative bacteria and are used in combination with β-lactam antibiotics, especially third generation cephalosporins. However, emergence of multidrug resistance severely compromised this therapeutic option as organisms harbour multiple resistance determinants to make chemotherapeutic alternatives ineffective. 16S rRNA methylation is one of the major mechanisms of aminoglycoside resistance [1]. In India there are multiple reports of 16S rRNAmethyltrasferase genes (armA,rmtA, rmtB, rmtC, rmtD and rmtF) as published in various studies [24]. These enzymes are responsible for alteration of A site of 16S rRNA and reported across the globe [510]. These genes are often associated with horizontal transmission and expansion of aminoglycoside resistance in hospital settings along with other resistance determinants [11]. These 16S rRNA methyl transferases confer resistance to all clinically relevant aminoglycosides and in particular high level resistance to amikacin. In the present study we have investigated the presence of acquired 16 s rRNA rmehyltransferase genes along with other co-resistance determinants in the clinical isolate of E. coli in a tertiary referral hospital of northeastern part of India.

Methods

Bacterial strains

A total of 329 consecutive clinical isolates of Escherichia coli were obtained from Silchar Medical College and Hospital, India, during March 2018–February 2019 from the patients who were admitted or attended the clinic and associated with infection. The additional information of the isolates was presented in supplementary Table S1. Isolates were identified by VITEK® 2 compact system (Biomeriux, USA). The study was approved by Institutional ethical committee of both Silchar Medical College and Assam University,

Antimicrobial susceptibility testing

Minimum inhibitory concentration (MICs) of isolates against aminoglycoside antibiotics namely; kanamycin, tobramycin, gentamicin, netilmicin, amikacin and streptomycin (Hi,Media,India) were determined by agar dilution method. Disc diffusion method was used for detection of susceptibility pattern towards imipenem (10 μg), meropenem (10 μg), cefepime (30 μg), aztreonam (30 μg) cefotaxime (30 μg), ceftazidime (30 μg), ceftriaxone (30 μg) and ciprofloxacin (5 μg). E. coli ATCC 25922 was used as control. Results were interpreted in accordance with Clinical and Laboratory Standards Institute (CLSI) guidelines 2017 [12].

Molecular characterization of 16S rRNA methyltransferase genes

The isolates which were resistant to at least one of the aminoglycoside antibiotics tested were subjected to PCR assay targeting 16S rRNA methyl transferase genes namely; rmtA, rmtB, rmtC, rmtD, rmtE, rmtF, rmtG rmtH armA and npmA (Table 1). The PCR mixture composed of 12.5 μl Go Taq green Master mix (Promega, Madison, USA) 10 pmol of each primer and ~ 100 ng DNA template prepared by boiling centrifugation method (83 °C for 20mins). The PCR was conducted in Bio-RadT100™Thermal cycler with the conditions: Initial denaturation at 95 °C for 5 min, 32 cycles of denaturation at 95 °C for 30 s, annealing at 50 °C for 40 s, extension at 72 °C for 40 s and final extension at 72 °C for 7 min.
Table 1
Primers used in this study for amplification of 16S rRNAmethyltransferase genes
Target primers
Sequence (Forward& reverse-5'-3')
Amplicon size (bp)
Reference
armA
GGTGCGAAAACAGTCGTAGT
1153
[22]
TCCTCAAATATCCTCTATGT
rmtA
CTAGCGTCCATCCTTTCCTC
635
[22]
TTTGCTTCCATGCCCTTGCC
rmtB
GGAATTCCATATGAACATCAACGATGCC
756
[22]
CCGCTCGAGTCCATTCTTTTTTATCAAGT
rmtC
CGAAGAAGTAACAGCCAAAG
1000
[22]
GCTAGAGTCAAGCCAGAAAA
rmtD
TCATTTTCGTTTCAGCAC
744
[22]
AAACATGAGCGAACTGAAGG
npmA
CGGGATCCAAGCACTTTCATACTGACG
981
[22]
CGGAATTCCAATTTTGTTCTTATTAGC
rmtE
ATGAATATTGATGAAATGGTTGC
818
[23]
TGATTGATTTCCTCCGTTTTTG
rmtF
GCGATACAGAAAACCGAAGG
589
[24]
ACCAGTCGGCATAGTGCTTT
rmtG
AAATACCGCGATGTGTGTCC
250
[25]
ACACGGCATCTGTTTCTTCC
rmtH
AATGACCATTGAACAGGCAGC
760
[26]
TCAAGCTGGGTTTGGCTGGA

Determination of co-existing ESBLs and carbapenemases

Further, all the 16S rRNA methyltransferase producing isolates were subjected to detection of ESBLs and carbapenemases. ESBL production was confirmed among by phenotypic screening containing 1 μg/ml of cefotaxime and ceftazidime followed by combined disc diffusion test as per CLSI guidelines (2017). PCR assay was carried out with primers specific for several commonly occurring beta – lactamases genes viz.; bla TEM, bla SHV, bla OXA, bla VEB, bla GES, bla PER and bla CTX-M types [1820] bla NDM [21], bla OXA-48, bla VIM, bla IMP and bla KPC [22]. Two separate multiplex PCR assays were performed. Reactions were run under the following conditions: initial denaturation at 95 °C for 5 min; 32 cycles of 95 °C for 1 min, 54 °C for 1 min and 72 °C for 1 min; and a final elongation at 72 °C for 7 min. The amplicons of the reaction with blaCTX-M primers were further sequenced to identify the exact variant.

Horizontal transferability assay

Total Plasmid content was extracted by QIAprep Spin Miniprep Kit (Qiagen, Germany) and isolated plasmids were subjected to transformation by heat shock method using Escherichia coli DH5α as recipient. Transformants were selected on to the Luria Bertani agar (Hi-Media, Mumbai,India) containing 2 μg/ml of kanamycin. Conjugation assay was performed where the isolates harbouring 16S rRNA methyltransferase genes, acted as donor and azide resistant E.coli J53 was used as recipient. Mating was performed where both the donor and recipient cells were cultured in LB broth (Hi-Media) till it attained optical density at 600 nm (OD600) of 0.8–0.9. Cells were mixed at a ratio of 1:5 donor-to-recipient and transconjugant was selected on LB medium (Hi Media,Mumbai,India) containing 2 μg/ml of kanamycin and 100 μg/ml of sodium azide. Transformants and transconjugants were further screened for the presence of 16S methyltransferase genes, ESBLs and carbapenemase genes as obtained in parent isolates.

Plasmid incompatibility typing

All the transformants and transconjugants were selected for this experiment. Plasmids were characterized by PCR-based replicon typing (PBRT) to identify the different incompatibility (Inc.) types. PBRT targeted 18 different replicon types viz. FIA, FIB, FIC, HI1, HI2, I1-Iy, L/M, N, P, W, T, A/C, K, B/O, X, Y, F, and FIIA performing 5 multiplex PCR and 3 simplex PCR [23].

Multilocus sequence typing (MLST)

Multilocus sequence typing (MLST) was carried out for all 16S rRNA methyl transferase producing E.coli using the protocols and conditions described on the E. coli MLST website (http://​mlst.​warwick.​ac.​uk/​mlst/​dbs/​Ecoli/​documents/​primersColi-html). Sequence types were determined after analysing by using centre for genomic epidemiology MLST analysis tool (https://​cge.​cbs.​dtu.​dk/​services/​MLST/​).

Results

Antimicrobial susceptibility testing showed that majority of the isolates were susceptible to meropenem (296/329) followed by imipenem (293/329), cefepime (282/329) aztreonam (281/329), ceftazidime (279/329), cefotaxime (276/329) and ceftriaxone (276.329) whereas ciprofloxacin showed moderate activity (165/329). Among them, a total of 117 isolates were found to be resistant to at least one of the aminoglycoside antibiotics viz.; gentamicin, tobramycin, amikacin, netilmicin and kanamycin.

Detection of 16S rRNA methyltransferase genes

Of 117 isolates, it was observed that 77 (65.8%) were positive for 16S rRNA methyltransferase genes. Among them, isolates harbouring rmt C (n = 12) were more in numbers followed by armA (n = 11), rmtD (n = 9), rmt F (n = 8), rmtB (n = 6), npmA (n = 5), rmtH (n = 4), rmtE (n = 1) and rmtG (n = 1). Combination of multiples genes were also observed in some isolates. These were as; armA + rmtF (n = 3), rmtG+ rmtH (n = 3), armA + rmtF (n = 3), armA + rmtE (n = 3), rmtC+ rmtD (n = 3), armA + rmtA (n = 2) and armA + rmtF + rmtC + rmtD (n = 3). The details of their distribution is given in Table 2.
Table 2
PCR assay results of 16S rRNA methyltransferase genes with co-existing ESBLs and Carbapenemase
Sl. no
16S rRNA methyltransferase genes harbouring isolates
Co-existing ESBLs
Co- existing carbapenemase
Sequence Types
1
rmtC (n = 12)
CTX-M-15(n = 9)
-
NDM (n = 1)
-
ST3906
2
armA(n = 11)
CTX-M-15(n = 3)
VEB (n = 1)
NDM (n = 2)
OXA-48 (n = 1)
ST4410
3
rmtD(n = 9)
CTX-M-15(n = 5)
-
NDM (n = 2)
OXA-48 (n = 1)
ST3906
4
rmtF (n = 8)
CTX-M-15(n = 2)
-
NDM (n = 1)
OXA-48 (n = 1)
ST1341
5
rmtB (n = 6)
CTX-M-15(n = 3)
-
NDM (n = 2)
OXA-48 (n = 2)
Unknown
6
npmA (n = 5)
CTX-M-15(n = 2)
VEB (n = 1)
NDM (n = 1)
-
Unknown
7
rmtH (n = 4)
CTX-M-15(n = 7)
PER (n = 1)
NDM (n = 3)
OXA-48 (n = 1)
ST4410
8
rmtE (n = 1)
CTX-M-15(n = 1)
-
NDM (n = 2)
-
Unknown
9
rmtG(n = 1)
CTX-M-15(n = 1)
-
NDM (n = 3)
OXA-48 (n = 1)
Unknown
10
armA +rmtF(n = 6)
CTX-M-15(n = 3)
-
NDM (n = 1)
-
ST4410
11
rmtG+ rmtH (n = 3)
CTX-M-15(n = 2)
-
NDM (n = 1)
-
ST4410
12
armA+rmtE(n = 3)
CTX-M-15(n = 1)
-
NDM (n = 2)
-
ST4410
13
rmtC+ rmtD (n = 3)
CTX-M-15(n = 1)
-
-
OXA-48 (n = 1)
ST3906
14
armA+rmtA (n = 2)
CTX-M-15(n = 1)
-
NDM (n = 1)
-
ST4410
15
armA+rmtF+rmtC+rmtD (n = 3)
CTX-M-15(n = 1)
-
NDM (n = 1)
OXA-48 (n = 1)
ST3906

Co-existing ESBLs and Carbapenemases

Among the 16S RMTases producing isolates 42 of them were confirmed to be ESBL positive by phenotypic methods as thirty nine of them were harbouring only blaCTX-M-15 and a combination of blaVEB + blaCTX-M-15 and blaPER + blaCTX-M was observed in two and in a single isolate respectively. Twenty three of them were blaNDM positive and 9 isolates harboured OXA-48 like genes (Table 2).

Horizontal transferability

All the resistance genes detected were conjugatively transferable and transformants carrying the 16SrRNAmethyl transferase genes along with ESBLs and carbapenemases could be selected in the media containing kanamycin. On performing PCR based replicon typing, it was observed that in all the isolates 16SrRNAmethyl transferase genes with coexisting ESBLs and carbapenemases were carried within I1 Inc. type plasmid.

MLST analysis

While analysing multilocus sequence typing data it was found that E.coli isolates harbouring rmtH,armA and rmtF were of sequence type 4410. Additionally ST 1341 was found to carry rmtF gene. E.coli ST3906 was carrying rmtC and rmtD. Isolates harbouring rmtB,rmtG,rmtEand npmA gene were found to be of unknown Sequence types.

Discussion

Aminoglycosides are potent and broad spectrum antibiotic which is often used to treat hospital acquired infections. Probably, this is the reason why different aminoglycoside modifying enzymes (AMEs) and methyl transferase enzymes are evolved in bacteria that are propagated and maintained among strains in hospital environment. These strains are needed to be detected and dissected in order to track their movement and potential lateral transfer of resistance determinants. The first 16 s rRNA methyl transferase gene armA was reported from Poland and subsequently rmtA gene was discovered from Japan [24]. Since then, it is reported from different part of the world. In India six variants are reported till date [24]. A recent study from Nepal has showed coexistence of DIM-1, NDM-1 and VIM-2 with rmtB4 and rmtF2 [25] where two novel variants of resistance genes were identified. In the current study we found ten different types of acquired 16S rRNA methyltransferase types along with CTX-M-15, VEB, PER, NDM and OXA-48 like beta-lactamases. Presence of co-existing ESBLs and carbapenemases are quite alarming as these would severely compromise combination therapy.
In our setting acquired 16S rRNA methyltransferase genes along with other beta-lactamase genes were found to be associated with Inc. I1 group of plasmid. Therefore, this broad host range plasmid was the genetic vehicle for horizontal transfer of aminoglycoside, cephalosporin and carbapenem resistance in this part of the India. In the current study three sequence types of E. coli were responsible for expansion and propagation of this multidrug resistant trait in this setting. In a similar study from US E.coli ST448 was found to harbour rmtE1 type along with extended spectrum beta-lactamases [26]. However, the three sequence types of E. coli obtained in this study is not reported elsewhere to be associated with aminoglycoside resistance.

Conclusions

The expansion of the three sequence types of E.coli ST4410, ST1341 and ST3906 appear to be potential risky local sequence types and of clinical concern that may complicate infection control program. Therefore, further investigations should be undertaken to trace the origin and evolution of these clones thereby preventing or atleast slowing down their spread.

Supplementary information

Supplementary information accompanies this paper at https://​doi.​org/​10.​1186/​s12879-020-05264-4.

Acknowledgements

The authors would like to acknowledge Jawaharlal Nehru Memorial Trust for providing scholarship to Jayalaxmi Wangkheimayum and DBT project BT/PR24255/NER/95/716/2017 dated 05.10.2018.
The study was approved by Institutional ethical committee of Assam University, Silchar and Institutional ethical committee, Silchar Medical College and Hospital. Informed consent from patient was obtained.
N/A.

Competing interests

None to declare.
Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://​creativecommons.​org/​licenses/​by/​4.​0/​. The Creative Commons Public Domain Dedication waiver (http://​creativecommons.​org/​publicdomain/​zero/​1.​0/​) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Anhänge

Supplementary information

Literatur
4.
Zurück zum Zitat Wangkheimayum J, Paul D, Dhar D, Nepram R, Chetri S, Bhowmik D, Chakravarty A. Amitabha Bhattacharjee; Occurrence of Acquired 16S rRNAMethyltransferase-Mediated Aminoglycoside Resistance in Clinical Isolates of Enterobacteriaceaewithin a Tertiary Referral Hospital of Northeast India. Antimicrob Agents Chemother. 2017;61:e01037–16 https://doi.org/10.1128/AAC.01037-16.CrossRef Wangkheimayum J, Paul D, Dhar D, Nepram R, Chetri S, Bhowmik D, Chakravarty A. Amitabha Bhattacharjee; Occurrence of Acquired 16S rRNAMethyltransferase-Mediated Aminoglycoside Resistance in Clinical Isolates of Enterobacteriaceaewithin a Tertiary Referral Hospital of Northeast India. Antimicrob Agents Chemother. 2017;61:e01037–16 https://​doi.​org/​10.​1128/​AAC.​01037-16.CrossRef
5.
Zurück zum Zitat Bogaerts P, Galimand M, Bauraing C, Deplano A, Vanhoof R, De Mendonca R, Rodriguez-Villalobos H, Struelens M, Glupczynski Y. Emergence of ArmA and RmtB aminoglycoside resistance 16S rRNAmethylases in Belgium. J Antimicrob Chemother. 2007;59:459–64 https://doi.org/10.1093/jac/dkl527.CrossRef Bogaerts P, Galimand M, Bauraing C, Deplano A, Vanhoof R, De Mendonca R, Rodriguez-Villalobos H, Struelens M, Glupczynski Y. Emergence of ArmA and RmtB aminoglycoside resistance 16S rRNAmethylases in Belgium. J Antimicrob Chemother. 2007;59:459–64 https://​doi.​org/​10.​1093/​jac/​dkl527.CrossRef
9.
Zurück zum Zitat Yamane K, Wachino J, Suzuki S, Kato H, Shibayama K, Kimura K, Kumiko K, Satoshi I, Ozawa Y, Toshifumi K, Arakawa Y. 16S rRNAmethylase-producing, gram-negative pathogens, Japan. Emerg Infect Dis. 2007;13:642–6.CrossRef Yamane K, Wachino J, Suzuki S, Kato H, Shibayama K, Kimura K, Kumiko K, Satoshi I, Ozawa Y, Toshifumi K, Arakawa Y. 16S rRNAmethylase-producing, gram-negative pathogens, Japan. Emerg Infect Dis. 2007;13:642–6.CrossRef
12.
Zurück zum Zitat Clinical and Laboratory Standards Institute. Performance standards for antimicrobial susceptibility testing; twenty-first informational supplement. M100-S27. Wayne: Clinical and Laboratory Standards Institute; 2017. Clinical and Laboratory Standards Institute. Performance standards for antimicrobial susceptibility testing; twenty-first informational supplement. M100-S27. Wayne: Clinical and Laboratory Standards Institute; 2017.
14.
Zurück zum Zitat Davis MA, Baker KN, Orfe LH, et al. Discovery of a gene conferring multiple-aminoglycoside resistance in Escherichia coli. Antimicrob Agents Chemother. 2010;54:2666–9.CrossRef Davis MA, Baker KN, Orfe LH, et al. Discovery of a gene conferring multiple-aminoglycoside resistance in Escherichia coli. Antimicrob Agents Chemother. 2010;54:2666–9.CrossRef
15.
Zurück zum Zitat Hidalgo L, Hopkins KL, Gutierrez B, Ovejero CM, Shukla S, Douthwaite S, et al. Association of the novel aminoglycoside resistance determinant RmtF with NDM carbapenemase in Enterobacteriaceae isolated in India and the UK. J Antimicrob Chemother. 2013;68:1543–50 https://doi.org/10.1093/jac/dkt078.CrossRef Hidalgo L, Hopkins KL, Gutierrez B, Ovejero CM, Shukla S, Douthwaite S, et al. Association of the novel aminoglycoside resistance determinant RmtF with NDM carbapenemase in Enterobacteriaceae isolated in India and the UK. J Antimicrob Chemother. 2013;68:1543–50 https://​doi.​org/​10.​1093/​jac/​dkt078.CrossRef
19.
20.
Zurück zum Zitat Lee S, Park YJ, Kim M, Lee HK, Han K, Kang CS. Prevalence of ambler class a and D β-lactamases among clinical isolates of Pseudomonas aeruginosa in Korea. J Antimicrob Chemother. 2005;56:122–7.CrossRef Lee S, Park YJ, Kim M, Lee HK, Han K, Kang CS. Prevalence of ambler class a and D β-lactamases among clinical isolates of Pseudomonas aeruginosa in Korea. J Antimicrob Chemother. 2005;56:122–7.CrossRef
21.
Zurück zum Zitat Yong D, Toleman MA, Giske CG, Cho HS, Sundman K, Lee K. Characterization of a new Metallo-β-lactamase gene, blaNDM-1, and a novel erythromycin esterase gene carried on a unique genetic structure in Klebsiellapneumoniae sequence type 14 from India. Antimicrob Agents Chemother. 2009;53:5046–54 https://doi.org/10.1128/AAC.00774-09.CrossRef Yong D, Toleman MA, Giske CG, Cho HS, Sundman K, Lee K. Characterization of a new Metallo-β-lactamase gene, blaNDM-1, and a novel erythromycin esterase gene carried on a unique genetic structure in Klebsiellapneumoniae sequence type 14 from India. Antimicrob Agents Chemother. 2009;53:5046–54 https://​doi.​org/​10.​1128/​AAC.​00774-09.CrossRef
24.
Zurück zum Zitat Doi Y, Arakawa Y. 16S ribosomal RNA methylation: emerging resistance mechanism against aminoglycosides. Clin Infect Dis. 2007;45:88–94.CrossRef Doi Y, Arakawa Y. 16S ribosomal RNA methylation: emerging resistance mechanism against aminoglycosides. Clin Infect Dis. 2007;45:88–94.CrossRef
25.
Zurück zum Zitat Tada T, Shimada K, Satou K, Hirano T, Pokhrel BM, Sherchand J, Kirikae T. Metallo-β-lactamases (DIM-1, NDM-1, VIM-2) and a 16S rRNAmethyltransferase (RmtB4, RmtF2) producing Pseudomonas aeruginosa in Nepal. Antimicrob Agents Chemother. https://doi.org/10.1128/AAC.00694-17. Tada T, Shimada K, Satou K, Hirano T, Pokhrel BM, Sherchand J, Kirikae T. Metallo-β-lactamases (DIM-1, NDM-1, VIM-2) and a 16S rRNAmethyltransferase (RmtB4, RmtF2) producing Pseudomonas aeruginosa in Nepal. Antimicrob Agents Chemother. https://​doi.​org/​10.​1128/​AAC.​00694-17.
Metadaten
Titel
Expansion of acquired 16S rRNA methytransferases along with CTX-M-15, NDM and OXA-48 within three sequence types of Escherichia coli from northeast India
verfasst von
Jayalaxmi Wangkheimayum
Mohana Bhattacharjee
Bhaskar Jyoti Das
K. Melson Singha
Debadatta Dhar Chanda
Amitabha Bhattacharjee
Publikationsdatum
01.12.2020
Verlag
BioMed Central
Erschienen in
BMC Infectious Diseases / Ausgabe 1/2020
Elektronische ISSN: 1471-2334
DOI
https://doi.org/10.1186/s12879-020-05264-4

Weitere Artikel der Ausgabe 1/2020

BMC Infectious Diseases 1/2020 Zur Ausgabe

Leitlinien kompakt für die Innere Medizin

Mit medbee Pocketcards sicher entscheiden.

Seit 2022 gehört die medbee GmbH zum Springer Medizin Verlag

Erhebliches Risiko für Kehlkopfkrebs bei mäßiger Dysplasie

29.05.2024 Larynxkarzinom Nachrichten

Fast ein Viertel der Personen mit mäßig dysplastischen Stimmlippenläsionen entwickelt einen Kehlkopftumor. Solche Personen benötigen daher eine besonders enge ärztliche Überwachung.

Nach Herzinfarkt mit Typ-1-Diabetes schlechtere Karten als mit Typ 2?

29.05.2024 Herzinfarkt Nachrichten

Bei Menschen mit Typ-2-Diabetes sind die Chancen, einen Myokardinfarkt zu überleben, in den letzten 15 Jahren deutlich gestiegen – nicht jedoch bei Betroffenen mit Typ 1.

15% bedauern gewählte Blasenkrebs-Therapie

29.05.2024 Urothelkarzinom Nachrichten

Ob Patienten und Patientinnen mit neu diagnostiziertem Blasenkrebs ein Jahr später Bedauern über die Therapieentscheidung empfinden, wird einer Studie aus England zufolge von der Radikalität und dem Erfolg des Eingriffs beeinflusst.

Costims – das nächste heiße Ding in der Krebstherapie?

28.05.2024 Onkologische Immuntherapie Nachrichten

„Kalte“ Tumoren werden heiß – CD28-kostimulatorische Antikörper sollen dies ermöglichen. Am besten könnten diese in Kombination mit BiTEs und Checkpointhemmern wirken. Erste klinische Studien laufen bereits.

Update Innere Medizin

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.