Background
Esophageal cancer (EC), a malignancy that affects the esophagus, has a five-year survival rate of less than 20% [
1,
2] and has become a public health concern. Esophageal squamous cell carcinoma (ESCC) accounts for approximately 80% of ECs and constitutes the fastest-growing EC subtype in East Asia [
3,
4]. Although the therapeutic strategies for ESCCs have improved, poor prognosis and treatment of patients with this cancer have become a major concern for stakeholders in the health sector [
5]. In addition to chemotherapy and radiotherapy, traditional surgical techniques often fail to prevent the metastatic spread and recurrence of this cancer. Therefore, there is an urgent need to explore novel targets that may serve as effective therapeutic biomarkers for ESCC.
In this study, we sought to identify and characterize the molecules that contribute to the development of ESCC. First, we identified 15-hydroxyprostaglandin dehydrogenase (HPGD) gene located on chromosome 4q34.1 as a potential candidate. The
HPGD gene consisting of 10 exons encodes an alcohol dehydrogenase protein, and participates in the metabolism of prostaglandins and in other cellular processes [
6,
7]. The
tumor suppressive role of HPGD has been observed in several cancers [
8‐
10]. A previous study reported decreased expression of HPGD in ESCC tissues [
11]. However, the relationship between HPGD and ESCC requires further investigation.
MicroRNAs (miRNAs) have also been linked to cancer progression. They are small single stranded non-coding RNA molecules (containing approximately 23 nucleotides) that perform their biological functions by binding to target mRNAs. As post-transcriptional regulators, miRNAs impair the stability of their target mRNAs, resulting in translational inhibition [
12,
13]. Several miRNAs are associated with cancer processes, and have also been identified as potential diagnostic markers in various human cancers [
14,
15]. In this study, using through bioinformatics analyses we screened two crucial miRNAs (miR-31-5p and miR-106b-5p) that may target HPGD and enable ESCC progression. According to the data from the starBase, miR-106b-5p expression is more robustly upregulated compared to that of miR-31-5p in ESCC samples, and therefore we focused on the role of miR-106b-5p in ESCC. In fact, miR-106b has been extensively studied since 2008, and many studies have shown the critical biological functions of miR-106b in tumorigenesis, such as in cell proliferation, metastasis, and apoptosis [
16‐
18], anti-miR-106b has been proposed as a promising approach for cancer therapy [
16,
19,
20]. Other cancers linked to miR-106b-5p include colorectal, breast, and gastric carcinomas [
21‐
23]. Downregulation of miR-106b augments ESCC tumorigenesis by promoting cell proliferation and epithelial-mesenchymal transition (EMT) [
24‐
26]. However, only one study has shown that miR-106b-5p also promotes cell migration and invasion by enhancing EMT in ESCC [
25]. Other potential mechanisms underlying miR-106b-5p-mediated ESCC remain unclear.
This study aimed to investigate the role of the miR-106b-5p/HPGD axis in ESCC cell progression in vitro with the objective of providing insights for ESCC therapies.
Materials and methods
Microarray analysis
Two mRNA (GSE38129 and GSE17351) and one miRNA (GSE114110) expression profile was downloaded from the GEO DataSet (
https://www.ncbi.nlm.nih.gov/gds/). GSE38129 included ESCC and adjacent normal samples from 30 Chinese patients, whereas GSE17351 included ESCC and adjacent normal samples from five American patients. With adjusted
P-value (adj. P) < 0.05, and log fold change (logFC) < − 1, the differentially expressed genes (DEGs) were screened using the limma 3.26.8 package. For the miRNAs, Limma 3.26.8 was applied to analyze the differentially expressed miRNAs in ESCC with adj.
P < 0.05, and logFC > 1. Metascape (
https://metascape.org/gp/index.html) was used to analyze the key biological processes associated with these DEGs. Their expression in normal and esophageal carcinoma (ESCA) tissues was analyzed using UALCAN, with data obtained from the cancer genome atlas (TCGA). StarBase (
http://starbase.sysu.edu.cn) was used to analyze miRNA expression in ESCA tissues and to predict the miRNAs that bind to HPGD. TargetScan was also used to predict the miRNAs that could bind to HPGD. Finally, DEGs and miRNAs were overlapped using the Venny 2.1.0.
Tissue samples and cell lines
ESCC tissue specimens (
n = 45) and paired adjacent normal esophageal samples (
n = 45) were collected from patients at Huangshi Central Hospital, Wuhan, China between October 2016 and February 2019. The protocol was approved by the Ethics Committee of the Huangshi Central Hospital, and all patients read and completed the informed consent forms to participate in the study. All tissues were stored at − 80 °C, and the clinical data pertaining to individual patients with ESCC are listed in Table
1.
Table 1
Clinical characteristics of 30 ESCC patients
Gender | | | | 0.181 | | | 0.626 |
Male | 27 | 16 | 11 | | 13 | 14 | |
Female | 18 | 7 | 11 | | 10 | 8 | |
Age (years) | | | | 0.349 | | | 0.758 |
> 50 | 24 | 15 | 9 | | 11 | 13 | |
≤ 50 | 21 | 8 | 13 | | 12 | 9 | |
Histology differentiation | | | | 0.018 | | | 0.013 |
Poorly | 14 | 3 | 11 | | 8 | 6 | |
Middle | 22 | 13 | 9 | | 7 | 15 | |
Well | 9 | 7 | 2 | | 8 | 1 | |
Weight loss | | | | 0.302 | | | 0.167 |
> 5% | 19 | 8 | 11 | | 12 | 7 | |
≤ 5% | 26 | 15 | 11 | | 11 | 15 | |
TNM stage | | | | 0.014 | | | 0.013 |
Stage I | 15 | 12 | 3 | | 3 | 12 | |
Stage II | 21 | 9 | 12 | | 14 | 7 | |
Stage III | 9 | 2 | 7 | | 6 | 3 | |
KPS | | | | 0.048 | | | 0.017 |
> 90 | 29 | 18 | 11 | | 11 | 18 | |
70–90 | 16 | 5 | 11 | | 12 | 4 | |
Human ESCC cell lines (KYSE30, KYSE180, KYSE450, and KYSE510) and normal esophageal epithelial cells (Het-1A) were purchased from ATCC (Manassas, VA, USA). All cell lines used in this study were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Cat#: A4192101, Gibco, Waltham, MA, USA) containing 10% fetal bovine serum (Cat#: 10099141, Gibco) and incubated at 37 °C in an incubator containing 5% CO2.
RNA isolation and RT-qPCR
RT-qPCR and RNA isolation were performed according to methods described previously [
27]. RNA isolation from the cell samples was performed using TRIzol Reagent (Invitrogen, Waltham, MA, USA). cDNA was obtained from the extracted RNA using the PrimeScript First Strand cDNA Synthesis Kit (Takara, Dalian, China). Gene expression was quantitated by RT-qPCR using SYBR Premix Ex Taq (Takara) on an ABI Prism 7900 Detector System (Life Technologies Inc., Waltham, MA, USA). miRNA and mRNA expressions were normalized to that of U6 and β-actin, respectively. The data were analyzed using the 2
−ΔΔCT method. The primer sequences used are listed in Table
2.
Table 2
The primer sequences for RT-qPCR
miR-106b-5p | Forward: TGCGGCAACACCAGTCGATGG |
Reverse: CCAGTGCAGGGTCCGAGGT |
U6 | Forward: ATTGGAACGATACAGAGAAGATT |
Reverse: GGA ACGCTTCACGAATTTG |
HPGD | Forward: CTCTGTTCATCCAGTGCGAT |
Reverse: CTCCCGAGTAAAGGACCCACA |
MAL | Forward: TCTTTTACCTCAGCGCCTCA |
Reverse: CGGCCAGTTAACACCATCTG |
GAPDH | Forward: AGCCACATCGCTCAGACAC |
Reverse: GCCCAATACGACCAAATCC |
Cell transfection
MiR-106b-5p inhibitor, miR-106b-5p mimic, and their corresponding negative controls, were purchased from Shanghai Tuoran Co., Ltd. The corresponding sequences are listed in the Supplemental Table
1. A full-length HPGD cDNA was synthesized (Shanghai Tuoran Co. Ltd.) and cloned into pcDNA3.1 plasmid. Puromycin (4 μg/mL) was used to select stably transfected cells. KYSE450 and KYSE510 cells (3 × 10
5 cells) were transfected with 50 nM miR-106b-5p inhibitor, miR-106b-5p mimic, or miR-NC using Lipofectamine 3000 Reagent (Invitrogen, Waltham, MA, USA). The cells were cultured for 48 h before performing subsequent experiments as described previously [
28].
Cell counting Kit-8 (CCK-8) assay
CCK-8 assay was performed to investigate cell viability [
29] (Cat#: K1018; APExBIO, China). Briefly, KYSE450 and KYSE510 cells (3 × 10
3 cells) were seeded in a 96-well plate. At the indicated times, CCK-8 (10 μL) reagent was added to the wells with cells, and the cells were incubated further for 2 h. Finally, the optical density (OD) was measured at 450 nm with a multimode-plate-reader (Tecan, Switzerland).
BrdU assay
BrdU assay was performed according to a previously reported method [
30]. First, KYSE450 and KYSE510 cells (3 × 10
3 cells) were cultured in 96-well plates for 24 h followed by 12 h of serum starvation. After another 8 h, serum was added back to the cells. The BrdU Cell Proliferation Assay Kit (Cat#: 6813, CST, Danvers, MA, USA) was used to label cells for 8–12 h without removing the treatment media. Finally, the OD was measured at 450 nm.
Cell adhesion assay
Cell adhesion assays were performed based on the methodology used in a previous study [
22]. KYSE450 and KYSE510 cells (3 × 10
3 cells) were cultured in 96-well plates. Collagen I solution (40 μg/mL; Cat#: C7661, Sigma-Aldrich, St. Louis, MO, USA) was added to the wells and the plates were stored overnight at 4 °C. The transfected cells were cultured in serum-free DMEM for 8 h. Cells were treated with 10 mM EDTA (in DMEM) for 10 min to dissociate them from the dishes. After collecting and resuspending the cells in DMEM with 0.1% BSA (2 × 10
5 cells/mL), the cells suspension (100 μL) was added to a air-dried 96-well plate for another 30 or 60 min. After incubation, 100 μL DMEM was added to remove the non-adherent cells and the dishes were further incubated for 4 h. Subsequently, the MTT substrate (Cat#: CT01, Sigma) (10 μL/well) was applied to the treated cells for 2 h at 30 °C. Next, 100 μL of DMSO was added to each well containing the lysed cells. Finally, the absorbance was measured at 570 nm.
Cells were disassociated, suspended, and plated in a 6-well culture plate at a density of 100 cells/well. After culturing for 14 days at 37 °C, the cells were washed twice with PBS and stained with Giemsa solution. Colonies larger than 75 μm in diameter or containing more than 50 cells were counted as a positive colony.
Wound healing assay
Cells were plated in a 6-well plate and once they reached more than 90% confluence, the cell monolayer was scratched with a 200 μL pipette tip to produce a wound. After removing the floating cells, fresh medium (without serum) was added to the wells and the cells were cultured at 37 °C for 24 h. Images of cells at the same location were captured at 0 h and 24 h using an Olympus IX51 inverted microscope (Olympus, Tokyo, Japan), and the wound healing rate was calculated as percent wound width covered = (width at 0 h - width at 24 h)/width at 0 h × 100%.
Cell invasion assay
Transwell inserts coated with Matrigel (40 μg/well, BD Biosciences, San Jose, CA, USA) were used to assess cell invasion. Cells (2 × 105) in serum-free medium were added to the upper chamber of the Transwell, and 600 μL of medium containing 10% FBS was added to the lower chamber. After 48 h of culture at 37 °C, the cells that had penetrated the membrane and adhered to the surface of the lower membrane were fixed with methanol, stained with Giemsa, and photographed under a light microscope (Leica Microsystems, Wetzlar, Germany).
Cell cycle analysis
Cells were collected 48 h after transfection and fixed overnight in 70% ethanol at 4 °C. Next, the DNA was stained using a cell cycle detection kit (KeyGen, Nanjing, China). Briefly, the cells were treated with RNase A and stained with 50 μg/mL propidium iodide. The DNA content was analyzed by flow cytometry using a FACS Calibur system (Becton Dickinson, Franklin, NJ, USA). Data were collected and processed using FlowJo FACS analysis software (Tree Star, Ashland, OR, USA).
Caspase-3/7 activity assay
The apoptotic ability of ESCC cells was assessed using the caspase-3/7 Assay Kit (Cat#: G8090, Promega, Madison, Wisconsin, USA) as described previously [
27]. According to the manufacturer’s guidelines, both the ESCC cell lines (3 × 10
3 cells) were cultured in 96-well plates. Next, the detection solution was prepared, and caspase 3/7 buffer was added to the bottle containing the caspase 3/7 substrate. After adding the mixed solution (100 μL/well) to the 96-well plate containing cells at 80% cell density, the mixture was incubated at room temperature for 2 h. Finally, OD values were measured at 450 nm.
Animal studies
Five-week-old female nude mice (5-weeks old) purchased from Shanghai SIPPR-BK Laboratory Animal Co. Ltd. (Shanghai, China) for the in vivo studies. Animal experiments were carried out in strict accordance with the Regulations for the Administration of Affairs Concerning Experimental Animals. KYSE510 cells (2 × 10
6) from the inhibitor-NC and miRNA inhibitor transfected groups were collected and resuspended in 2 mL PBS. Cells were injected subcutaneously into the backs of the nude mice. Tumor size was measured with calipers every fifth day. The tumor volume (V) was calculated using the following formula: V = length × Width
2 × 1/2. All the mice were euthanized 25 days after implantation by asphyxiation with carbon dioxide. The mice were placed into the euthanasia chamber and filled with CO
2 at 30% chamber volume /min. When the mice were unconscious and stopped breathing, the CO
2 flow was maintained for 1 min. The mice death was confirmed as cardiac arrest and did not respond to the toe-pinching reflex [
28]. Tumors from the resected mice were weighed and photographed immediately.
The lung tissues were resected, fixed in 10% formaldehyde solution, dehydrated in an ethanol gradient, embedded in paraffin, and cut into slices of 4 μm thickness. After deparaffinization, the samples were stained with haematoxylin and eosin. The slices were then mounted and observed under a light microscope (Leica Microsystems).
Luciferase assay
The pmiRGLO-HPGD3′-UTR-Wt and pmiRGLO-HPGD3′-UTR-mutated vectors were constructed by Guangzhou Boxin Biotechnology Co. Ltd. (China). KYSE450 and KYSE510 cells (3 × 105 cells) were co-transfected with pmiRGLO HPGD 3′-UTR-Wt or HPGD 3’UTR-Mut and either miR-NC or miR-106b-5p. At post 48 h post-transfection, luciferase was assessed with the Luciferase Assay Kit (Cat#: #16185, Thermo Scientific, Waltham, MA, USA) according to the manufacturer’s instructions and normalized to the firefly luciferase levels used as an internal control.
RNA pull down assay
Biotin-labeled negative control (Bio-NC) and miR-106b-5p (Bio-miR-106b-5p) used in this study were provided by RiboBio (China). The two Bio-miRNA mimics were first transfected into KYSE450 and KYSE510 cells. After for 48 h lysis buffer supplemented with the protease and RNase inhibitors was added to the cells. Streptavidin beads (Cat#: #88817, Thermo Scientific) were washed and added to the cell lysates. The cells were incubated overnight at 4 °C. Subsequently, the beads were washed twice, and the RNA was eluted and purified using the RNeasy Mini Kit (Cat#: 74104, QIAGEN, Germany). Finally, HPGD enrichment was detected by RT-qPCR analysis.
Western blotting analysis
Proteins from the cells were denatured and quantified. First, proteins (30 μg) were separated on a 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) gel. Next, the gels were electroblotted onto polyvinylidene difluoride (PVDF) membranes for hybridization. After blocking with 5% milk, the membranes were incubated with the following antibodies: anti-HPGD (1:1000, Cat#: ab187160, Abcam, UK), anti-Bax (1:2000, Cat#: ab32503, Abcam), anti-Bcl-2 (1:2000, Cat#: ab182858, Abcam), and β-actin (1:2000, Cat#: ab8226, Abcam) overnight at 4 °C. Then, the membranes were incubated with the corresponding secondary antibodies; goat anti-rabbit IgG H&L (HRP) (1:10000, Cat#: ab97051, Abcam) for HPGD and goat anti-mouse IgG H&L (HRP) (1:10000, Cat#: ab175783, Abcam, UK) for β-actin, at room temperature for 3 h. Next, ECL reagents (Bio-Rad, California, USA) were used to detect the protein bands. Finally, the density in each band was quantified using Image J software (ImageJ 1.48v, NIH, Maryland, USA).
Statistical analysis
Experimental data presented as the means ± standard deviation (SD) were analyzed using the paired Student’s t-tests for two-group comparisons and one-way ANOVA with Dunnett’s post hoc for multiple group comparisons using SPSS software (version 19.0; IBM Corp., Armonk, NY, USA). Three independent repeats were performed for each experiment. Significance was set at p < 0.05.
Discussion
MiR-106b-5p has been implicated in several types of cancers [
22,
29]. In this study, we provide data to support that miR-106b-5p has a tumor-promoting effect and mediates tumor progression. Using bioinformatics analysis, we first identified miR-31-5p and miR-106b-5p as two potential miRNAs that target HPGD and participate in ESCC. Because of its higher differential expression in ESCC tissues compared to miR-31-5p, we further investigated the function of miR-106b-5p. Our findings showed an increase in miR-106b-5p expression and a decrease in HPGD expression in ESCC samples. In addition, miR-106b-5p inhibited the expression of HPGD at both mRNA and protein levels. In addition, miR-106b-5p promoted proliferation, colony formation, adhesion, migration, and invasion, and induced cell cycle, but inhibited apoptosis of ESCC cells. Silencing of miR-106-5p inhibited tumor growth and lung metastasis in vivo.
A previous study documented the ability of miR-106b-5p to inhibit the invasion and metastasis of colorectal cancer (CRC) cells [
17]. In another study, low expression of miR-106b-5p correlated with poor survival of patients with CRC [
21]. Only a single study reported that miR-106b-5p promotes cell migration and invasion via enhancement of EMT by targeting SMAD family member 7 (Smad7) [
25]. As cell viability, proliferation, adhesion, and apoptosis were the key characteristics of cancer cells [
22,
30,
31], we evaluated these cellular functions through a series of assays. Consistently, upregulation of miR-106b-5p was observed in ESCC tissues and cells that promoted the progression of ESCC by enhancing the viability, proliferation, colony formation, adhesion, migration, and invasive ability of the cells, and induced cell cycle progression and suppressed apoptosis of ESCC cells. We also showed that silencing of miR-106-5p inhibited tumor growth and lung metastasis in vivo.
Several studies have demonstrated that HPGD functions as a tumor suppressor gene in various cancers [
8‐
10]. The downregulation of HPGD caused by activation of interleukin-1β led to a poor prognosis in pancreatic cancer patients, and reduction of HPGD expression was associated with tumorigenesis [
8]. In the context of breast cancer, HPGD acts as a tumor suppressor, and the upregulation of HPGD was found to reduce tumorigenesis in athymic mice [
9]. Another study showed that HPGD expression and activity was decreased in CRC tissues [
10]. However, a previous studies reported a decrease in HPGD expression in ESCC tissues [
11], and in an isolated human metastasizing esophageal cancer cell line [
32], suggesting that HPGD may contribute to ESCC development. Based on previous studies and our bioinformatics analysis, we suspected that HPGD was a potential tumor suppressor gene in ESCC and that miR-106b-5p may bind to the 3’UTR of HPGD to regulate ESCC progression. Cytological assays revealed that miR-106b-5p contributed to the progression of ESCC by enhancing cell proliferation, colony formation, adhesion, migration, and invasion, and induced cell cycle progression, while inhibiting cell apoptosis. In addition, a previous study demonstrated that HPGD suppresses colon cancer aggressiveness through the STAT3 and AKT pathways [
33]. Therefore, future studies should investigate this pathway to confirm this interaction in ESCC.
Several studies have shown that each miRNA targets multiple mRNAs [
34]. Furthermore, miR-106b-5p has been reported to target different mRNAs in a variety of cancers. For example, Gao et al. [
35] found that miR-106b-5p regulates the growth of clear cell renal cell carcinoma by targeting PDCD. Another study revealed that miR-106b-5p regulates the migration and invasion of CRC cells by targeting FAT4 [
36]. Therefore, in future research, we need to further study other mRNA targets that are regulated by miR-106b-5p in ESCC, to better understand the miRNA-mRNA regulatory networks in ESCC.
Immortalized cell lines and primary cells are indispensable tools in the study of cancer pathogenesis and have been shown to share similar pathophysiological changes [
37]. However, some studies have found that there are some differences between cell lines and primary cells in their protein properties, morphology, and metabolic activity [
38]. Therefore, it is necessary to isolate and culture primary cancer cells from tumor tissues of ESCC patients to further understand the effects of miR-106b-5p/HPGD in ESCC. In addition, the epidemiology and pathogenesis of ESCC varies worldwide [
39]. Our study only investigated the association between the expression of miR-106b-5p and HPGD, and the characteristics of patients from China. To identify biomarkers of ESCC, the association between the expression of miR-106b-5p and HPGD and characteristics needs to be analyzed in patients from different parts of the world.
Conclusion
In summary, our data suggest that miR-106b-5p and HPGD affect ESCC progression. More specifically, our findings indicated that miR-106b-5p accelerates proliferation, colony formation, adhesion, migration, invasion, and induces cell cycle progression, but represses apoptosis in vitro by targeting HPGD. In vivo, silencing of miR-106b-5p inhibits tumor growth and lung metastasis. Thus, miR-106b-5p and HPGD represent promising targets for the diagnosis and treatment of ESCC.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.