Background
Today there is an increasing demand for the use of natural ingredients and their derivatives in the treatment of different health problems. Among them essential oils enjoy popularity, which are commonly used nowadays in cosmetics, health care, traditional medicine and food industry. Because of their antimicrobial activities, the application of the essential oils is widespread. They have a complex mode of action due to their multiple composition. The composition of essential oils is variable and the physiological action and organoleptic characteristic is dominated by the major constituent defined by chemotype [
1,
2].
The volatile essential oils can easily reach the upper and lower parts of the respiratory tract via inhalation. They possess both antimicrobial and anti-inflammatory effects, therefore they can provide an effective treatment against infections [
3‐
6]. After infection several molecular and cellular events play role in stimulating initial acute inflammation, which leads to the accumulation of leukocytes and plasma proteins induced by cytokines derived from protector cells like dendritic, mast, endothelial cells and macrophages [
7,
8].
Microglia, the immune cells of the central nervous system (CNS) are activated at inflammation process and produce inflammatory cytokines, which may impair the function of nerve cells causing cell death [
9]. Therefore, the role of the anti-inflammatory extracts and their components obtained from plants are highly important. Furthermore, neuroinflammation is responsible for several CNS diseases (e.g. neurodegenerative disorders, depression, sleep disorders, and stroke) [
10‐
12]. To prevent neuroinflammation there is possibility to cure these disorders. Some plant-derived bioactive molecules have been shown to have role in attenuating neuroinflammation [
11,
13‐
15]. Recent evidence has proven that the essential oils can transfer through the nasal mucosa during inhalation, can enter the blood circulation and pass through the blood-brain barrier [
16,
17].
Because of the great number of constituents, essential oils seem to have several potential cellular targets [
18]. Pérez et al. [
6] summarized the anti-inflammatory properties of some essential oils and their proposed or studied mechanism of action. These mode of actions include various processes, e.g. modulation of lipoxygenase enzymatic activity, nitric oxide (NO) inhibition, inhibition of secretion of proinflammatory cytokines like tumour necrosis factor α (TNFα) and interleukin-1β (IL-1β), and inhibition of NF-κB activation.
Essential oil of thyme (
Thymus vulgaris L.) is utilized as complementary therapy of acute and chronic diseases of the respiratory tract [
19,
20]. The diverse biological activities of thyme oil are related to its main phenolic compounds, thymol and carvacrol [
21,
22]. The anti-inflammatory effect of thyme oil and some of its main components has been widely studied and proved using mice models [
23,
24] and cells like THP-1 (human acute monocytic leukaemia cell line) [
25], J774A.1 (murine macrophage cell line) [
26,
27], human polymorphonuclear neutrophils [
28] and RAW 264.7 (murine macrophage cell line) [
29].
In our previous studies we have demonstrated the antibacterial activity of thyme essential oil against some respiratory pathogens [
30,
31]. Due to its antimicrobial and anti-inflammatory potency, it may offer an effective treatment in neuroinflammation. However, its role in the mechanism of neuroinflammation is not fully understood [
11].
The aim of this study was to examine the anti-inflammatory effect of three chemotypes of thyme essential oil and their main compounds on lipopolysaccharide (LPS)-induced BV-2 microglia. Furthermore, this study is the first in which the anti-inflammatory effect of geraniol and thujanol chemotypes of thyme oil (Thymus vulgaris L.) and their main compounds (geraniol and thujanol) was examined on BV-2 microglia.
Our results unravelled that thyme oil chemotypes and their main compounds possess anti-inflammatory effect on LPS-induced microglia via modulating the activation of NF-κB and C/EBPβ signalling pathways and decreasing the secretion of IL-6 and TNFα proinflammatory cytokines. It was demonstrated that chemotypes and the main compounds exerted different inhibitory effects on the examined signalling proteins. Based on our results we suppose that development of an essential oil product containing the major compounds of thyme essential oil in a proper ratio would be successful as complementary neurotherapeutics against neuroinflammation.
Methods
Essential oils
Three chemotypes of Thymus vulgaris essential oil, linalool (Lot number: OF16244), geraniol (Lot number: OF7289) and thujanol (Lot number: OF19102) were purchased from Panarom (Panarom Naturkozmetika Kft., Budapest, Hungary). Linalool, geraniol and thujanol essential oil standards were purchased from Sigma-Aldrich (Sigma-Aldrich Kft., Budapest, Hungary). Stock solutions of the chemotypes were produced by adding 100 μL of pure dimethyl sulfoxide (DMSO, Sigma-Aldrich Kft., Budapest, Hungary) to 900 μL of essential oil, therefore the stock solution contained 90% of essential oil and 10% of DMSO. The emulsions were mixed by vortexing then were diluted with phosphate buffered saline (PBS, Lonza Ltd., Basel, Switzerland) 200-fold, 500-fold and 1000-fold. Stock solutions of linalool and geraniol standards were prepared the same way as the chemotypes. Stock solutions of thujanol standard was prepared by solving 4 mg of thujanol in 1 mL of DMSO. Dilutions of the standard stock solutions were carried out the same way as in case of the essential oil chemotypes. For control experiments 10% DMSO stock solution was prepared in PBS and was diluted the same way as the essential oils, 200-fold, 500-fold and 1000-fold. The final concentrations of DMSO used in the experiments were 0.05, 0.02 and 0.01% according to the dilutions.
GC-MS analysis
The chemical composition of the thyme oil chemotypes was analysed by gas chromatography-mass spectrometry (GC-MS). A 1 μL of each essential oil sample was diluted in ethanol (10 μL/mL) then it was injected in split mode. The temperature of the injector was 250 °C, the split ratio was 1:10. The analyses were carried out with an Agilent 6890 N/5973 N GC-MSD (Santa Clara, CA, USA) system equipped with a Supelco (Sigma-Aldrich Kft., Budapest, Hungary) SLB-5MS capillary column (30 m × 250 μm × 0.25 μm). The GC oven temperature increased from 60 °C (3 min isothermal) to 250 °C at 8 °C /min (1 min isothermal). The carrier gas was high purity helium (6.0; at 1.0 mL/min (37 cm/s)) in a constant flow mode. The mass selective detector (quadrupole mass analyser) was operated in electron ionization mode at 70 eV in a full scan mode (41–500 amu at 3.2 scan/s). The data were analysed using MSD ChemStation D.02.00.275 software (Agilent Technologies, Santa Clara, CA). The identification of the compounds was carried out by comparing retention times and recorded spectra with the data of authentic standards involving the NIST 2.0 library. The calculation of the percentage was carried out by area normalization [
30].
Cell culture and treatments
BV-2 murine microglial cells (kind gift from Prof. László Tretter and his research group) were maintained in Dulbecco’s Modified Eagle Medium (DMEM; Lonza Ltd., Basel, Switzerland) supplemented with 10% fetal bovine serum (FBS, EuroClone S.p.A, Pero, Italy) and 1% penicillin/streptomycin (Lonza Ltd., Basel, Switzerland). The cells were cultured on poly-L-ornithine (Sigma-Aldrich Kft., Budapest, Hungary) coated dishes (Sarstedt Kft., Budapest, Hungary). BV-2 cells were seeded into 6-well plates and were cultured for 24 h before the treatments. The cells were treated with 200-fold diluted essential oil chemotypes and standards to determine their effects on cytokine production. Inflammatory condition was generated by LPS treatment (1 μg/mL, Escherichia coli O55:B5, Sigma-Aldrich Kft., Budapest, Hungary). Anti-inflammatory effects of essential oils were determined in three different experiments: LPS pretreatment for 24 h then essential oil treatment for 24 h; essential oil pretreatment for 24 h then LPS treatment for 24 h; and co-treatment with LPS and essential oils for 24 h. DMSO treated cells were used as controls. The final concentrations of DMSO used in the experiments were 0.05, 0.02 and 0.01% according to the dilutions. Each experiments were repeated at least three times. All experiments were carried out in a humidified atmosphere containing 5% CO2 at 37 °C.
Cell viability assay
BV-2 cells were plated onto 96-well plates using 5 × 103 cells/well. Cells were treated with essential oils and standards in 200-fold, 500-fold and 1000-fold dilutions for 6 h and 24 h. Viability of the BV-2 cells were measured using Cell Counting Kit-8 (CCK-8) cell viability assay (Sigma-Aldrich Kft., Budapest, Hungary) after the treatments. DMSO treated cells were used as controls of the essential oil treated cells, while the effect of DMSO on cell viability was determined by using untreated cells as controls. After each treatment 10 μL of WST-8 reagent was added to each well, then the plates were incubated for 1 h at 37 °C and 5% CO2. After incubation, 10 μL of 1% sodium-dodecyl sulphate (SDS, Molar Chemicals Kft., Halásztelek, Hungary) was added to each well to stop the reaction. The absorbance of the samples was measured at 450 nm using MultiSkan GO microplate spectrophotometer (Thermo Fisher Scientific Inc., Waltham, MA). Viability was expressed as percentile of the total cell number of the appropriate control.
Real-time PCR
BV-2 cells were treated the same way as described earlier, in 6-well culture dishes (3 × 10
5 cells/well). After the treatments, BV-2 cells were washed with PBS and then were collected after trypsinization. Total RNA was isolated from each sample using Quick RNA mini kit (Zymo Research, Irvine, CA). Complementary DNA was synthesised from 200 ng of total RNA using High capacity cDNA Reverse Transcription Kit (Applied Biosystems, Thermo Fisher Scientific Inc., Waltham, MA) according to the manufacturer’s protocol. Determination of gene expressions was performed in a CFX96 Real-time System (Bio-Rad Inc., Hercules, CA) using iTaq™ Universal SYBR® Green Supermix (Bio-Rad Inc., Hercules, CA) in a 20 μL of total reaction volume. Melting curves were generated after each quantitative PCR run to ensure that a single specific product was amplified. Relative quantification was calculated by the Livak (∆∆Ct) method using the Bio-Rad CFX Maestro software (Bio-Rad Inc., Hercules, CA). The expression level of the gene of interest was compared with the level of β-actin in each sample. These relative expression rates were then compared between the treated and the untreated samples. The relative expression of the controls was regarded as 1 [
31]. The mRNA expression of the treated cells were compared to the controls. The primer sequences used in this study are described in Table
1.
Table 1
Real-time PCR gene primer list
IL-6 forward | CTCTGCAAGAGACTTCCATCCA |
IL-6 reverse | GACAGGTCTGTTGGGAGTGG |
TNFα forward | GATCGGTCCCCAAAGGGATG |
TNFα reverse | CCACTTGGTGGTTTGTGAGTG |
β-actin forward | CTGTCGAGTCGCGTCCA |
β-actin reverse | TCATCCATGGCGAACTGGTG |
Enzyme-Linked Immunosorbent Assay (ELISA) Measurements
After each treatment of the cells, culture media of the control and treated cells were collected and stored at − 80 °C until the measurements. Secreted IL-6 and TNFα concentrations of the culture media were determined with mouse IL-6 and mouse TNFα ELISA Kits (Thermo Fisher Scientific Inc., Waltham, MA) according to the instructions of the manufacturer [
32].
Immunoblotting
BV-2 cells were seeded onto 6-well culture dishes (3 × 10
5 cells/well) and were treated after a 24 h incubation period. BV-2 cells were fractionated immediately after collection using Subcellular Protein Fractionation Kit for Cultured Cells (Thermo Fisher Scientific Inc., Waltham, MA) according to the manufacturer’s protocol. Protein contents of each protein fraction were measured with DC Protein Assay Kit (Bio-Rad Inc., Hercules, CA). The same amount of protein (15 μg) from each sample was loaded onto 10% or 12% SDS-polyacrylamide gels. After the electrophoresis the protein content of the gels were transferred by electro- blotting to nitrocellulose membranes (Pall AG, Basel, Switzerland). The membranes were blocked with 5% non-fat dry milk in TBST (Tris buffer saline, 0.1% Tween-20) for 1 h at room temperature [
33]. After the blocking step, the membranes were probed with the following polyclonal rabbit antibodies for overnight at 4 °C according to the manufacturer’s protocols: anti-NF-κB/p50 IgG (1:1000, Sigma-Aldrich Kft., Budapest, Hungary), anti-NF-κB/p65 IgG (1:2000, Cell Signaling Technology Europe, Leiden, The Netherlands) and anti-phospho-C/EBPβ IgG (1:1000, Thermo Fisher Scientific Inc., Waltham, MA). β-actin (1:2000; Sigma-Aldrich Kft., Budapest, Hungary) was used as housekeeping control in all Western blot experiments. Goat anti-rabbit HRP-conjugate was used as secondary antibody (1:3000; Bio-Rad Inc., Hercules, CA). Protein detection was carried out with WesternBright ECL chemiluminescent substrate (Advansta Inc., San Jose, CA). Optical densities of Western blots were determined using ImageJ software [
34], and were expressed as percentage of target protein/β-actin abundance.
Statistical analysis
The data presented are representative of at least three independent experiments. For all data,
n corresponds to the number of independent experiments. Real-time PCR and cell viability assays and ELISA measurements were carried out in triplicate in each independent experiments. Statistical analysis was performed using SPSS software (IBM Corporation, Armonk, NY, USA). Statistical significance was determined by Kruskal-Wallis one-way ANOVA non-parametric test using pairwise comparisons [
33]. Data are shown as mean ± standard deviation (SD). The difference between means was determined at 95% confidence intervals. Statistical significance was set at
p value < 0.05
.
Discussion
Large number of medicinal herbs and their extracts are used for treatments of various diseases. One of the most frequently examined plant is thyme (
Thymus vulgaris L.). Different chemotypes of the essential oils of this plant have been tested in the past and proved their antibacterial and antifungal activities, though at various effectiveness against the certain microbes [
21,
40].
It is clear that there are fundamental differences among essential oils and their chemotypes not only in their therapeutic but also in their basic effects on cultured cells [
41], which was proved by the viability assays carried out in time and concentration dependence. In addition plant extracts behave distinctly depending on the target cell: in a numerous experiments they were used not on cultured cells but against microbes directly [
42].
Nowadays it has been accepted that inflammation is playing a determining role in the development and seriousness of neurodegenerative diseases, like Alzheimer’s disease, Parkinson’s disease or multiple sclerosis [
43]. In the central nervous system astrocytes and microglia are responsible for mediating the immunoresponse against inflammatory agents [
43]. The essential oils are lipophilic and organic molecules, which are able to transfer across the epithelium in nasal mucosa. Upon passing through the epithelium they move into systemic circulation and cross the blood-brain barrier [
16], although the components of the essential oils show different permeability via the blood-brain barrier [
17]. Cheng et al. described that linalool can pass through the blood-brain barrier in mice [
44] and can reverse both neuropathological and behavioural impairments [
45]. Geraniol was successful in decreasing the impairments of motor behaviour in mouse model of Parkinson’s disease [
46]. Based on the neuroprotective and anti-aging effects of essential oils they can be used as complementary therapy in age related neurodegenerative diseases such as Parkinson’s disease, Alzheimer’s disease, Huntington’s disease and amyotrophic lateral sclerosis [
47].
We have been investigating the potential protective effect of
Thymus vulgaris essential oil chemotypes and their main compounds in an in vitro microglial cell culture system. As a model LPS was used to imitate bacterial infection in cell cultures and tested the effects of chemotypes of thyme essential oil [
48‐
50]. Relatively little is known about the interactions of these essential oils and the cells of the nervous system
. By Elmann et al. the effects of geranium oil was examined in primary rat microglia cell culture as the protective agent against inflammation mediated by LPS administration [
51]. Essential oil was added at the same time with LPS to the cultured cells. According to the authors, NO release and the expression of inducible NO synthase and cyclooxygenase 2 were reduced by the geranium oil treatment. These experiments are modelling neurodegenerative diseases which are related to neuroinflammation.
The post ischemic processes in the brain involve a large number of components. Among them the leaders are the proinflammatory cytokines, which are playing a basic role in the worsening of the damage of the blood brain barrier as well as the activation of microglial cells. The protective effect of linalool was examined in rats after a period of cerebral arterial occlusion [
52]. Also primary glial cells suffered less damage after glutamate challenge when treated with linalool. It is interesting that linalool was administered intranasal proving that these plant compounds can reach the cells of the central nervous system via the blood brain barrier by inhalation.
BV-2 rodent microglia are widely accepted models for examining those agents, which may be involved in induction of neurodegeneration by microglia activation. LPS is a component of the cell wall of Gram- negative bacteria and may be used in microglia cell culture to mimic inflammation and for testing potential anti-inflammatory molecules [
53]. The advantages of model cell culture experiments are the possibility of large number of variations in controlled circumstances. The temperature, composition of the cell culture medium are the same, while the timing and the concentrations of the different treatments are variable. Also it is possible to carry out the treatments in different order or at the same time. With these setups it was possible to imitate the preventive effect or the therapeutic effects of the different pharmaceutical molecules. In addition, there is a possibility to compare essential oils, chemotypes from the market, or produced in-house.
In our work definite alterations were revealed in the effects of essential oil chemotypes and their main compounds at the different experimental setups. These cellular changes were followed at mRNA and at protein levels in LPS treated cells and in cells without LPS challenge. In general the reduction in proinflammatory IL-6 and TNFα syntheses and secretions were seen at the presence of treatments.
A couple of comparisons were carried out in our experiments: the effects of three different chemotypes and standards on the survival of BV-2 cells as well as on the synthesis and secretion of IL-6 and TNFα. The latter changes were followed together with LPS treatment, in three versions: pretreatment with LPS, pretreatment with essential oils, or co-treatment with the two types of substances. We examined the NF-κB signalling pathway and the TNFα regulation activity in each of the three treatment versions mentioned above.
Essential oils by themselves had effect on IL-6 and TNFα mRNA syntheses and secretions. It was revealed several times that the mRNA synthesis and cytokine release are not always changing parallel. The protein synthesis and posttranslational modifications may have different regulatory signals than transcription or it is a possibility that the former processes need more time than the mRNA synthesis. The two proinflammatory cytokines show the same secretion pattern, with chemotypes e.g. linalool and geraniol exerting stronger effects. This phenomenon can be observed frequently, suggesting that a pure, single component can have limitations, a “mixture” in a plant extract is having more active compounds that may cooperate against inflammation. Elman et al. found that a single component of essential oil did not exert protective effect in neuroinflammation examined in primary microglia cells [
51].
Considering the changes of IL-6 and TNFα secretions depending on the relation of LPS and essential oil treatments in time, the best reduction of inflammatory cytokines could be reached by the pretreatment with the essential oils. In these experiments, there were a few surprises. In every setup (LPS pretreatment, essential oil pretreatment, co-treatment of LPS and chemotypes), the reduction of TNFα were grater, than that of the IL-6 at both mRNA and protein levels. In addition, occasionally standards had better effects, than chemotypes, but mainly at mRNA expression. At the essential oil pretreatment experiment the effect of linalool and geraniol was outstanding, proving at least two facts. Using these plant materials as prophylaxis against inflammation (or at least LPS effect) showed the best result. Also according to the research of other scientific groups these two substances in both standard and chemotype forms have specific effects on microglia/macrophages in neuronal injury, hypoxia and degeneration.
To explain the reason of alterations in proinflammatory cytokine production of BV-2 microglia, the transcription factor components of NF-κB, namely the level of chromatin-bound, active p50 and p65 were examined. When they act in heterodimer form [
54,
55], they activate the transcription of IL-6 and TNFα. Interestingly, standards caused large reduction of chromatin-bound proteins, especially linalool, both in the case of LPS pretreatment as well as in essential oil administration before LPS. Further investigating activations of cell signalling pathways, the level of chromatin-bound, phosphorylated C/EBPβ was determined Large differences could be seen in the levels of P-C/EBPβ in the effects of standards and chemotypes and co-treatments and pretreatments. Best effects could be observed in geraniol and thujanol chemotypes and linalool and geraniol standards, the latter ones in pretreatment only.
The presence of the additional components in the essential oil chemotypes revealed by GC-MS method may contribute to the effect of the main compounds (Table
3). It was proven that p-cymene, found in both thujanol and linalool chemotypes in 2.1 and 4.2%, possessed anti-inflammatory effects in mice and decreased leukocyte migration [
56]. γ-Terpinene found in the thujanol chemotype (2.9%) as well as α-terpineol (4.3%) were previously described as anti-inflammatory molecules, the latter one was able to decrease IL-6 mRNA level [
57,
58]. The terpinen-4-ol can suppress the production of inflammatory mediators in macrophages [
59] and may interact with the main components of thujanol (11.9%) and linalool (8.3%) thyme essential oil chemotypes. Linalyl acetate found in thujanol chemotype (2.9%) has been proven to provide anti-inflammatory effect on natural killer cell in a dose dependent manner [
60]. Nerol was also found in both geraniol (1.9%) and thujanol (4.2%) chemotypes, which was proven to decrease IL-13 and TNFα pro-inflammatory cytokines [
61]. The anti-inflammatory effect of geraniol chemotype may be supported by the presence of geranyl acetate (18.6%), β-caryophyllene (5.7%), geranyl propionate (2.2%) and elemol (2.2%) [
62‐
65]. The differences in the composition of the examined thyme essential oil chemotypes may contribute to their distinct effects on the regulation of IL-6 and TNFα pro-inflammatory cytokine syntheses in BV-2 microglia.
Based on our observations it can be concluded that geraniol (both chemotype and standard) has an outstanding effect on decreasing pro-inflammatory cytokine secretion. Moreover, the presence of additional components in the chemotypes may alter the effect of the main compounds since the chemotypes have better effect alone at the treatments, but in the presence of LPS (LPS pretreatment and LPS and essential oils together) they can achieve weaker inhibitory effect on the production of pro-inflammatory cytokines.
In summary, we may declare that BV-2 cells are good models to examine the neuroprotective effects of essential oil of thyme (Thymus vulgaris L.). These protective effects are caused by not the same components, which are responsible for the antibacterial effect of thyme. In many aspects essential oil chemotypes are more effective than standards, but standards could be seen to have large inhibitory effects on certain cell signalling components related to the activation of proinflammatory cytokines. This proves that the final change in the secreted levels of IL-6 and TNFα could not be explained merely by one transcription factor activity. There is also a possibility that the change in the activation of transcription factors is occurring in a different time frame than the examined period in our experiments.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.