Skip to main content
Erschienen in: Cancer Cell International 1/2024

Open Access 01.12.2024 | Research

USP5 facilitates bladder cancer progression by stabilizing the c-Jun protein

verfasst von: Hui-hui Zhang, An-qi Zhang, Peng Peng, Liang Huang, Cai-ying Liu, Xin-rui Nie, De-fu Hou, Xia Zhang, Shang-ze Li

Erschienen in: Cancer Cell International | Ausgabe 1/2024

Abstract

Background

Bladder cancer is the second most common genitourinary malignancy worldwide. The death rate of bladder cancer has increased every year. However, the molecular mechanism of bladder cancer is not sufficiently studied. Deubiquitinating enzymes (DUBs) play an important role in carcinogenesis. Several studies have demonstrated that USP5 associated with malignancy and pathological progression in hepatocellular carcinoma, colorectal and non-small cell lung cancer. However, the role of USP5 in bladder cancer need to be explored.

Methods

The USP5 expression was analysed using the web server GEPIA. To explore USP5 function in bladder cancer, we constructed USP5-knockout cell lines in T24 cells. A FLAG-USP5 (WT USP5) plasmid and a plasmid FLAG-USP5 C335A (catalytic-inactive mutant) used to overexpress USP5 in EJ cells. CCK8, colony formation, transwell and scratch assays were used to assess cell viability, proliferation and migration. RNA sequencing (RNA-seq) and dual-luciferase reporter assays were performed to screen the pathway. Coimmunoprecipitation and immunofluorescence were used to explore the interaction between USP5 and c-Jun. Cycloheximide (CHX) chase assays were performed to establish the effect of USP5 on c-Jun stability. Xenograft mouse model was used to study the role of USP5 in bladder cancer.

Results

USP5 expression is increased in bladder cancer patients. Genetic ablation of USP5 markedly inhibited bladder cancer cell proliferation, viability, and migration both in vitro and in vivo. RNA-seq and luciferase pathway screening showed that USP5 activated JNK signalling, and we identified the interaction between USP5 and c-Jun. USP5 was found to activate c-Jun by inhibiting its ubiquitination.

Conclusions

Our results show that high USP5 expression promotes bladder cancer progression by stabilizing c-Jun and that USP5 is a potential therapeutic target in bladder cancer.
Hinweise

Supplementary Information

The online version contains supplementary material available at https://​doi.​org/​10.​1186/​s12935-024-03222-7.
Hui-Hui Zhang and An-qi Zhang contributed equally to this work.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Introduction

Bladder cancer (BC), a carcinoma of the urothelial system, is one of the most common malignancies worldwide, with over 550,000 patients diagnosed and 190,000 succumbed to the disease worldwide every year [1]. Cigarette smoking, male sex, and advanced age contribute to the development of bladder cancer. Bladder cancer is classified into two subclasses: non-muscle-invasive bladder cancer (NMIBC) and muscle-invasive bladder cancer (MIBC). Tumours restricted to the urothelium and the lamina propria are classified as NMIBC, which is not life-threatening. NMIBCs account for approximately 70% of newly diagnosed BC cases, and the five-year survival rate of NMIBC is above 90% [2]. Tumours that invade the detrusor muscle are classified as MIBC. MIBC is accompanied by invasion and metastasis, which have increased the death rate annually. The five-year survival rate of MIBC is 50% [3]. NMIBCs are treated with endoscopic resection and adjuvant intravesical therapy. For patients with MIBC, radical cystectomy and urinary diversion or trimodal therapy with maximal endoscopic resection, radiosensitizing chemotherapy, and radiation is warranted [4]. The advent of checkpoint inhibitors, targeted therapies, and antibody-drug conjugates for immunotherapy has greatly improved the treatment of bladder cancer. Improved understanding of the molecular biology of bladder cancer is important for the development of diagnosis and treatment.
The c-Jun N-terminal kinase (JNK) pathway is a mitogen-activated protein kinase (MAPK) pathway [5]. JNK signalling is involved in many physiological processes and pathological conditions, including inflammation, neurodegenerative diseases and multiple tumorigenic processes [610]. JNK plays pivotal roles in aspects related to bladder cancer, such as tumorigenesis [11, 12], apoptosis [13], the chemotherapy response [14] and metastasis [15]. The transcription factor activator protein 1 (AP-1) may be activated by MAPKs, particularly JNK. c-Jun is a member of the Jun family and is a component of AP-1 complexes [16]. c-Jun was the first purely oncogenic transcription factor discovered. It is important in processes related to cellular homeostasis, including proliferation, apoptosis and survival. The relationship between c-Jun and tumorigenesis has been widely investigated [17, 18]. Usually, c-Jun is activated by JNK, which binds to the c-Jun transactivation domain and phosphorylates it at Ser63 and Ser73 [19]. c-Jun is degraded through a ubiquitination mechanism. Several studies have revealed that c-Jun is ubiquitinated by several E3 ubiquitin ligases [20, 21]. However, the regulation of the c-Jun by deubiquitinating enzymes (DUBs) requires further study.
The ubiquitin‒proteasome system is responsible for protein stability. DUBs remove ubiquitin moieties from substrates. DUBs can be classified into five families based on their sequence and structural homology [22]: Otubain proteases (OTUs), ubiquitin C-terminal hydrolases (UCHs), ubiquitin-specific proteases (USPs), Machado-Joseph disease proteases (MJDs), and JAB1/MPN/Mov34 metalloenzymes (JAMMs). USP5 is a cysteine deubiquitinating enzyme belonging to the USP family. The USP5 gene is located on chromosome 12p13 and encodes the 93.3-kDa protein USP5 [23]. Analysis of data in the Human Protein Atlas (https://​www.​proteinatlas.​org/​) revealed that USP5 is highly expressed in testicular cancer, prostate cancer, breast cancer and urothelial cancer. Several studies have demonstrated that USP5 plays an important role in cancers by targeting its substrates. In hepatocellular carcinoma (HCC) and colorectal cancer (CRC), USP5 is highly expressed and closely associated with malignancy and pathological progression [24]. In pancreatic ductal adenocarcinoma (PDAC), USP5 stabilizes FoxM1 to promote tumour growth [25]. In non-small cell lung cancer, USP5 promotes cell proliferation, colony formation and migration [26]. However, the role of USP5 in BC needs to be explored.
We found that USP5 was overexpressed in bladder cancer samples and that patients with high USP5 expression had an unfavourable prognosis. In vitro, USP5 overexpression promotes the proliferation and migration of EJ bladder cancer cells. Consistent with these results, USP5 deficiency inhibits the proliferation and migration of T24 bladder cancer cells. Through RNA sequencing (RNA-seq) and luciferase assays, we found that USP5 activates the JNK pathway. We showed that USP5 binds to and stabilizes c-Jun by mediating its deubiquitination, thereby promoting the JNK signalling cascade. Finally, we revealed a novel mechanism of USP5 in bladder cancer development and progression.

Materials and methods

Antibodies and plasmids

The following antibodies were used: rabbit polyclonal anti-USP5 (10473-1-AP, Proteintech, Wuhan, China); rabbit monoclonal anti-c-Jun (ab40766, Abcam, Waltham, USA, 1:2000 dilution); mouse anti-HA (M180-3, MBL, Japan, 1:5000 dilution); mouse anti-Flag (M185-11R, MBL, Japan, 1:5000 dilution); mouse anti-Myc (M192-3, MBL, Japan,1:5000 dilution); mouse anti-GAPDH (ANT011, AntGene, Wuhan, China, 1:5000 dilution); HRP-labelled goat anti-mouse IgG (H + L) (A0216, Beyotime, Shanghai, China, 1:5000 dilution); and HRP goat anti-rabbit IgG (H + L) (ANT020, AntGene, Wuhan, China, 1:5000 dilution).
The plasmids PHAGE-3×Flag-USP5(FLAG-USP5), pHAGE-3×HA-USP5 and pHAGE-3×HA-USP5 C335A (HA-USP5 C335A) were constructed according to the methods in the “Molecular Cloning Experiment Guide”. The plasmid pcDNA3.1-3xFlag-c-Jun (FLAG-c-Jun) was purchased from Youbio (F118284).

Xenografts

USP5−/− and parental T24 cells were collected and washed twice with PBS. A total of 5 × 106 cells were resuspended in 0.2 mL of PBS and inoculated into the flanks of 5 4-week-old female BALB/c nude mice. Tumours were measured every other day after the appearance of subcutaneous tumours. The tumour volume was calculated as follows: volume = (length×width2) × 0.5. 30 days after inoculation, the mice will be deeply anesthetized with isoflurane (5%) for approximately 3 min. Then, the mice were killed by cervical dislocation. All animal studies were conducted in accordance with the Guidelines of the China Animal Welfare Legislation and were approved by the Committee on Ethics in the Care and Use of Laboratory Animals of Hunan Normal University (permit number: 2,021,286). All efforts were made to minimize animal suffering.

Cell culture and cell lines

All cell lines were purchased from ATCC. HEK293T cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM, HyClone, Logan, USA). T24 cells were maintained in McCoy’s 5a medium (BasalMedia, Shanghai, China). EJ cells were maintained in RPMI 1640 medium (Gibco, Carlsbad, USA). The media were supplemented with 10% foetal bovine serum (FBS, Gibco, Carlsbad, USA) and 1% penicillin/streptomycin (Gibco, Carlsbad, USA). All cells were cultured at 37 °C in a 5% CO2 incubator. No mycoplasma contamination was detected.

Cell proliferation, colony formation, transwell and scratch assays

A Cell Counting Kit-8 (CCK8, BS350B, Biosharp, China) was used for cell proliferation assays. A total of 1 × 103 cells/well were seeded into 96-well plates. CCK8 solution (10 µL in 100 µL medium) was added to each well and incubated at 37 °C for 1 h. The optical density was measured at a wavelength of 450 nm. Colony formation was performed as we previously described. Briefly, 4 × 102 cells were cultured in 6-well plates for 14 days. Colonies were stained with 0.025% crystal violet, and images were acquired using a scanner. For transwell assays, medium with 40% FBS was added to the lower chamber, and serum-free medium was added to the upper chamber. Cells were seeded into the upper chamber. After 36–48 h, cells that migrated into the lower chamber were stained with 0.02% crystal violet. For the scratch assays, cells subjected to different treatments were seeded in 6-well plates. When the cells formed a confluent monolayer, a cell-free area was artificially created in the centre of each well. Images of the wounds were acquired every 12 h using a light microscope.

Western blot analysis

Cells were lysed with SDS lysis buffer (62.5 mM Tris-HCl (pH 6.8), 2% SDS, and 10% glycerol) at 95 °C for 10 min. Total protein was separated by 10% SDS‒PAGE and transferred to PVDF membranes (IPVH00010; Millipore, Billerica, MA, USA). The membranes were blocked with 5% skim milk for 1 h. The membranes were incubated with primary antibodies overnight at 4 °C. The next day, the membranes were washed in TBST and then incubated with HRP-labelled secondary antibodies at room temperature for 1 h. A Tanon 5500 chemiluminescence image analysis system (Tanon, Shanghai, China) was used to evaluate the chemiluminescence of the protein bands. GAPDH was used as the internal control.

Coimmunoprecipitation

Cells were lysed using NP-40 lysis buffer (20 mM Tris-HCl (pH 7.4), 150 mM NaCl, and 1% NP-40) in the presence of protease inhibitor cocktails. The lysates were centrifuged at 12,000 rpm for 10 min at 4 °C and then incubated with the approprioat antibody and rProtein A/G Magarose Beads (SM005002, SMART Lifesciences, China) overnight at 4 °C. The next day, the magarose beads were washed with lysis buffer 3 times. The immunoprecipitated proteins were boiled in 2 × SDS‒PAGE loading buffer for 10 min at 95 °C and separated using SDS‒PAGE.

Luciferase assay

HEK293T cells (30% confluence) were seeded into 24-well plates. The reporter plasmid (100 ng, contains 34 signaling pathways), pRL-CMV (5 ng) with the indicated gene-expressing plasmids (Flag-USP5, 500 ng) or empty vector were transient transfected into the HEK293T cells in each well. were transfected into the cells. After 48 h, luciferase reporter assays were performed with a dual luciferase assay kit (E1960, Promega, Beijing).

Immunofluorescence

Cells were fixed with 4% paraformaldehyde for 15 min, blocked with 0.1% Triton X-100 and then washed with PBS. The samples were then stained with a primary antibody and the corresponding secondary antibody. Finally, the slides were observed and digitally photographed using a confocal microscope (Leica TCS SP8 SR. Leica, Germany).

Immunohistochemistry and H&E staining

Bladder cancer tissue microarrays were purchased from Wuhan Shuangxuan Biotechnology Co., Ltd. (Cat. No. IWLT-N-140BL61, contains 64 bladder cancer tissues and 48 normal tissues). Immunohistochemistry examination with USP5 antibody at WuHan Servicebio Technology Co., Ltd. Tumors of each mouse were prepared for histopathological sections, and subjected to HE staining at WuHan Servicebio Technology Co., Ltd.

Obtaining USP5-knockout cell lines using CRISPR-CAS9

USP5-knockout cells were obtained by clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9-mediated genome editing [27]. Briefly, sgRNAs targeting USP5 exon 6 were designed via the CRISPR Design Tool (sgRNA-1: TGTGGGCGACGCTACTTCGA, sgRNA-2: TACCCGTTAGCTGTCAAGCT). The annealed sgRNA oligos were inserted into the lentiCRISPRv2 vector (Addgene plasmid 52,961) [28] to generate the USP5 knockout plasmids. Transfection and infection were performed using PEI MAX transfection reagent (Polysciences) according to the manufacturer’s instructions as previously described [29]. Positive cells were selected by puromycin (1 ug/ml). The western blot analysis was used for cell line identification.

Statistical analysis

All experiments were performed 3 times. Two-tailed unpaired Student’s t test was used to compare two groups of data. One-way ANOVA was used to compare multiple groups of data. A P value of less than 0.05 was considered significant. KEGG pathway enrichment analysis was performed using the BGI Dr.Tom.

Results

USP5 is overexpressed in bladder cancer

Several studies have shown USP5 overexpression in some types of cancer. We used the web server GEPIA (http://​gepia.​cancer-pku.​cn/​) to analyse USP5 expression in bladder cancer. As shown in Fig. 1A, USP5 expression was higher in tumour tissue than in normal tissue. Then, we performed overall survival analysis with data from GEPIA, and the results suggested that bladder cancer patients with high USP5 expression had poorer survival outcomes than those with low USP5 expression (Fig. 1B). To verify USP5 expression in bladder cancer, we analysed USP5 protein levels in bladder cancer tissues and adjacent bladder tissues from patients using immunohistochemistry (IHC). The results suggested that USP5 was obviously highly expressed in bladder cancer compared with normal tissue (Fig. 1C, D). All the results showed that USP5 is closely related to bladder cancer.

Overexpression of USP5 promotes cell proliferation and migration

To clarify the function of USP5 in bladder cancer cells, we examined USP5 expression levels using laboratory-preserved bladder cancer cell lines (UMUC3, T24, EJ) (Fig. S1). A FLAG-USP5 (WT USP5) plasmid and a plasmid expressing a catalytically inactive mutant (FLAG-USP5 C335A) were used to overexpress USP5 in EJ cells with low USP5 expression, and USP5 expression was measured by western blotting (Fig. 2A). We evaluated the effects of USP5 on proliferation and migration using colony formation, cell proliferation, transwell, and scratch assays. The colony formation and cell proliferation assay results showed that exogenous overexpression of USP5 increased colony numbers and cell proliferation, but overexpression of USP5 C335A did not have the same effects (Fig. 2B, C). The results of transwell and scratch assays also showed that overexpression of USP5 but not USP5 C335A significantly enhanced the migration ability of EJ cells (Fig. 2D, E). The above results suggested that USP5 overexpression but not USP5 C335A overexpression promotes bladder cancer cell survival, proliferation and migration.

USP5 deficiency inhibits cell proliferation and migration

For further validation, we constructed USP5-knockout cell lines using the CRISPR-CAS9 technique in T24 cells with high USP5 expression. Western blotting was used to examine the expression of USP5 (Fig. 3A). The results of the colony formation assay revealed that USP5 depletion dramatically decreased the colony formation capability of T24 cells (Fig. 3B). We next tested the effect of USP5 on the proliferation of T24 cells by a CCK8 assay. As shown in Fig. 3C, the proliferation of the knockout cells was substantially slower than that of the wild-type T24 cells. The scratch and transwell assay results also revealed a similar phenotype (Fig. 3D, E). Collectively, these findings indicated that knocking down USP5 markedly inhibited the proliferation, viability, and migration of T24 cells.

USP5 regulates the JNK pathway

To investigate the molecular mechanism of USP5 in bladder cancer, we performed RNA-seq analysis using USP5-deficient and WT T24 cells. KEGG pathway enrichment analysis was conducted to identify changes in signalling pathways (Fig. 4A). The results revealed that multiple signalling pathways involving numerous biological processes were affected in USP5-deficient cells. The ratio of total genes enriched by MAPK signalling pathway was the largest (Fig. 4B). We also performed luciferase pathway screening using cancer-related reporters in HEK293T cells to identify the underlying pathway. The results showed that USP5 expression noticeably activated the JNK reporter which belongs to the MAPK signalling pathway (Fig. 4C). Furthermore, JNK reporter activity was activated by USP5 in a dose-dependent manner (Fig. 4D).

USP5 interacts with and stabilizes c-Jun

We next investigated the relationship between USP5 and the JNK pathway. We examined the interaction of USP5 with several key proteins (Fig. S2). Immunofluorescence staining showed that USP5 and c-Jun were localized in the nucleus upon plasmid-mediated exogenous overexpression in HEK293T cells (Fig. 5A). Then, coimmunoprecipitation was used to indicate that USP5 interacts with c-Jun in T24 cells (Fig. 5B). We investigated whether USP5 affects the stability of c-Jun. The figure shows that c-Jun protein levels were increased when USP5 was overexpressed and that this increase occurred in a dose-dependent manner (Fig. 5C). Figure 5D shows that USP5 deficiency reduced c-Jun levels. To establish the effect of USP5 on c-Jun stability, we performed cycloheximide (CHX) chase assays to verify the time course of c-Jun degradation. The half-life of c-Jun increased after transfection of the USP5 plasmid (Fig. 5E), while the half-life of c-Jun was not increased by transfection of the USP5 C335A plasmid (Fig. 5F). The half-life of c-Jun was significantly reduced in USP5-deficient cells (Fig. 5G). Considering the function of USP5 as a DUB, we next investigated whether USP5 can reduce the ubiquitination of c-Jun. The results showed that the levels of ubiquitinated c-Jun were reduced by overexpression of WT USP5 compared with those in control cells. However, overexpression of USP5 C335A abolished this reduction (Fig. 5H).
In summary, these results show that USP5 interacts with c-Jun and regulates its stability by inhibiting its ubiquitination.

USP5 deficiency inhibits tumour formation in vivo

To investigate whether USP5 influences tumorigenesis in vivo, WT and USP5-knockout T24 cells were injected into the flanks of nude mice. As shown in Fig. 6A–C, the tumour volume in nude mice injected with USP5-knockout cells was significantly smaller than that in nude mice injected with the control T24 cells, and the tumours in the USP5-knockout group grew markedly slower than those in the WT T24 cell-injected group (Fig. 6D). The tumours were sectioned and stained with HE and an anti-Ki67 antibody (Fig. 6E, F). The results revealed that depletion of USP5 inhibited the activity of T24 cells in vivo. Altogether, these results indicate that USP5 potentially promotes bladder cancer growth in vivo.

Discussion

DUBs are essential for maintaining ubiquitin homeostasis and are required for diverse cellular functions. There are more than 100 DUBs encoded in the human genome. USP5, also called ubiquitin isopeptidase (ISOT), has been reported to be involved in multiple cellular processes, including stress responses, DNA repair and inflammatory responses [30]. USP5 has also been found to be associated with cancers, including breast, prostate, testicular and urothelial cancers. Several studies have revealed the role of USP5 in HCC, PDAC and CRC. However, the mechanism of USP5 in bladder cancer needs to be determined. First, we analysed the expression of USP5 in bladder cancer in the online GEPIA database, and the results suggested that USP5 is upregulated in bladder cancer patients. The results of IHC staining experiments with a tissue microarray were revealed that USP5 was highly expressed in bladder cancer compared with normal tissue. To determine the function of USP5 in bladder cancer, we constructed USP5-overexpressing and USP5-deficient cancer cell lines. The phenotype results suggested that USP5 promotes the development and progression of bladder cancer. Next, we performed RNA-seq analysis and luciferase pathway screening to explore the mechanism of USP5 in bladder cancer. The results pointed to the involvement of the JNK pathway. Previous studies have revealed that the JNK pathway is strongly associated with bladder cancer [31]. To explore how USP5 activates the JNK signalling pathway, we performed coimmunoprecipitation experiments to determine whether USP5 can interact with important molecules in the JNK signalling pathway. We verified the physical association between USP5 and c-Jun. We detected USP5 and c-Jun colocalization in the nucleus.
Posttranslational modifications, including phosphorylation, ubiquitination, and acetylation, are important to the function of c-Jun. Ubiquitination is responsible primarily posttranslational modification for the stability of c-Jun. Several studies have revealed that c-Jun is ubiquitinated by several E3 ubiquitin ligases [20, 32]. In 2018, Lin et al. published a paper in which they described that USP6 regulates the stability of the c-Jun protein [33]. We sought to determine whether USP5 could regulate the stability of the c-Jun protein. We further verified that overexpression of USP5 could stabilize the c-Jun protein. It has been reported that USP5 cleaves K6-linked, K29-linked, K48-linked, K63-linked and linear ubiquitin chains, especially Lys48-linked polyubiquitin chains [34]. To determine whether USP5 stabilizes the c-Jun protein by deubiquitination, we constructed a plasmid expressing the catalytically inactive mutant USP5 C335A. CHX chase assays and deubiquitination assays were performed, and the results suggested that USP5 stabilizes the c-Jun protein by inhibiting its ubiquitination. Considering the phosphorylation of c-Jun is closely related to its stability, further studies need to be performed to evaluate whether USP5 affects c-Jun phosphorylation. Finally, an in vivo xenograft mouse model was used to study the role of USP5 in bladder cancer. The results demonstrated that USP5 potentially promotes bladder tumour growth.
USPs involves in a wide range of pathological processes of malignancy, they have been considered targets for drug development. The development of USP inhibitors has also become a perspective and possibility for cancer therapy. Several USP5 inhibitors have been developed to treat human cancers. Such as WP1130 [35], PYR-41 [36] formononetin [24]. However, there was few findings suggest that USP5 could be a potential target for bladder cancer therapy. Our experimental results showed that USP5 is associated with poor prognosis in bladder cancer, Further studies need to be performed to evaluate whether this treatment strategy works against bladder cancer development and progression through specific inhibitors selectively targeting USP5.
In conclusion, our experimental results showed that USP5 is associated with poor prognosis in bladder cancer. USP5 plays an oncogenic role through deubiquitination of c-Jun, which is an important downstream target of the JNK pathway in bladder cancer. Our study reveals a new potential therapeutic target for bladder cancer.

Declarations

The animal study was reviewed and approved by Experimental Animal Ethics Committee of Hunan Normal University (permit number: 2021286).

Competing interests

The authors declare no competing interests.
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://​creativecommons.​org/​licenses/​by/​4.​0/​. The Creative Commons Public Domain Dedication waiver (http://​creativecommons.​org/​publicdomain/​zero/​1.​0/​) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Literatur
1.
Zurück zum Zitat Bray F, Ferlay J, Soerjomataram I, Siegel RL, Torre LA, Jemal A. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2018;68(6):394–424.CrossRefPubMed Bray F, Ferlay J, Soerjomataram I, Siegel RL, Torre LA, Jemal A. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2018;68(6):394–424.CrossRefPubMed
2.
3.
Zurück zum Zitat Charlton ME, Adamo MP, Sun L, Deorah S. Bladder cancer collaborative stage variables and their data quality, usage, and clinical implications: a review of SEER data, 2004–2010. Cancer. 2014;120(0 23):3815–25.CrossRefPubMed Charlton ME, Adamo MP, Sun L, Deorah S. Bladder cancer collaborative stage variables and their data quality, usage, and clinical implications: a review of SEER data, 2004–2010. Cancer. 2014;120(0 23):3815–25.CrossRefPubMed
4.
5.
Zurück zum Zitat Dhillon AS, Hagan S, Rath O, Kolch W. MAP kinase signalling pathways in cancer. Oncogene. 2007;26(22):3279–90.CrossRefPubMed Dhillon AS, Hagan S, Rath O, Kolch W. MAP kinase signalling pathways in cancer. Oncogene. 2007;26(22):3279–90.CrossRefPubMed
6.
Zurück zum Zitat Bubici C, Papa S. JNK signalling in cancer: in need of new, smarter therapeutic targets. Br J Pharmacol. 2014;171(1):24–37.CrossRefPubMed Bubici C, Papa S. JNK signalling in cancer: in need of new, smarter therapeutic targets. Br J Pharmacol. 2014;171(1):24–37.CrossRefPubMed
7.
Zurück zum Zitat Zhou YY, Li Y, Jiang WQ, Zhou LF. MAPK/JNK signalling: a potential autophagy regulation pathway. Biosci Rep 2015, 35(3). Zhou YY, Li Y, Jiang WQ, Zhou LF. MAPK/JNK signalling: a potential autophagy regulation pathway. Biosci Rep 2015, 35(3).
8.
Zurück zum Zitat Hammouda MB, Ford AE, Liu Y, Zhang JY. The JNK Signaling Pathway in inflammatory skin disorders and Cancer. Cells 2020, 9(4). Hammouda MB, Ford AE, Liu Y, Zhang JY. The JNK Signaling Pathway in inflammatory skin disorders and Cancer. Cells 2020, 9(4).
9.
Zurück zum Zitat Gkouveris I, Nikitakis NG. Role of JNK signaling in oral cancer: a mini review. Tumour Biol. 2017;39(6):1010428317711659.CrossRefPubMed Gkouveris I, Nikitakis NG. Role of JNK signaling in oral cancer: a mini review. Tumour Biol. 2017;39(6):1010428317711659.CrossRefPubMed
10.
Zurück zum Zitat Ni Z, Sun P, Zheng J, Wu M, Yang C, Cheng M, Yin M, Cui C, Wang G, Yuan L, et al. JNK Signaling promotes bladder Cancer Immune escape by regulating METTL3-Mediated m6A modification of PD-L1 mRNA. Cancer Res. 2022;82(9):1789–802.CrossRefPubMed Ni Z, Sun P, Zheng J, Wu M, Yang C, Cheng M, Yin M, Cui C, Wang G, Yuan L, et al. JNK Signaling promotes bladder Cancer Immune escape by regulating METTL3-Mediated m6A modification of PD-L1 mRNA. Cancer Res. 2022;82(9):1789–802.CrossRefPubMed
11.
Zurück zum Zitat Corteggio A, Urraro C, Roperto S, Roperto F, Borzacchiello G. Phosphatidylinositol-3-kinase-AKT pathway, phospho-JUN and phospho-JNK expression in spontaneously arising bovine urinary bladder tumours. J Comp Pathol. 2010;143(2–3):173–8.CrossRefPubMed Corteggio A, Urraro C, Roperto S, Roperto F, Borzacchiello G. Phosphatidylinositol-3-kinase-AKT pathway, phospho-JUN and phospho-JNK expression in spontaneously arising bovine urinary bladder tumours. J Comp Pathol. 2010;143(2–3):173–8.CrossRefPubMed
12.
Zurück zum Zitat Pan CW, Liu H, Zhao Y, Qian C, Wang L, Qi J. JNK2 downregulation promotes tumorigenesis and chemoresistance by decreasing p53 stability in bladder cancer. Oncotarget. 2016;7(23):35119–31.CrossRefPubMedPubMedCentral Pan CW, Liu H, Zhao Y, Qian C, Wang L, Qi J. JNK2 downregulation promotes tumorigenesis and chemoresistance by decreasing p53 stability in bladder cancer. Oncotarget. 2016;7(23):35119–31.CrossRefPubMedPubMedCentral
13.
Zurück zum Zitat Ji L, Zhong B, Jiang X, Mao F, Liu G, Song B, Wang CY, Jiao Y, Wang JP, Xu ZB, et al. Actein induces autophagy and apoptosis in human bladder cancer by potentiating ROS/JNK and inhibiting AKT pathways. Oncotarget. 2017;8(68):112498–515.CrossRefPubMedPubMedCentral Ji L, Zhong B, Jiang X, Mao F, Liu G, Song B, Wang CY, Jiao Y, Wang JP, Xu ZB, et al. Actein induces autophagy and apoptosis in human bladder cancer by potentiating ROS/JNK and inhibiting AKT pathways. Oncotarget. 2017;8(68):112498–515.CrossRefPubMedPubMedCentral
14.
Zurück zum Zitat Hua X, Xiang D, Guo M, Qian X, Chen R, Li T, Tian Z, Xu J, Huang C, Xie Q, et al. Induction of RAC1 protein translation and MKK7/JNK-dependent autophagy through dicer/miR-145/SOX2/miR-365a axis contributes to isorhapontigenin (ISO) inhibition of human bladder cancer invasion. Cell Death Dis. 2022;13(8):753.CrossRefPubMedPubMedCentral Hua X, Xiang D, Guo M, Qian X, Chen R, Li T, Tian Z, Xu J, Huang C, Xie Q, et al. Induction of RAC1 protein translation and MKK7/JNK-dependent autophagy through dicer/miR-145/SOX2/miR-365a axis contributes to isorhapontigenin (ISO) inhibition of human bladder cancer invasion. Cell Death Dis. 2022;13(8):753.CrossRefPubMedPubMedCentral
15.
Zurück zum Zitat Lee EH, Chung JW, Sung E, Yoon BH, Jeon M, Park S, Chun SY, Lee JN, Kim BS, Kim HT et al. Anti-metastatic effect of pyruvate dehydrogenase kinase 4 inhibition in bladder Cancer via the ERK, SRC, and JNK pathways. Int J Mol Sci 2022, 23(21). Lee EH, Chung JW, Sung E, Yoon BH, Jeon M, Park S, Chun SY, Lee JN, Kim BS, Kim HT et al. Anti-metastatic effect of pyruvate dehydrogenase kinase 4 inhibition in bladder Cancer via the ERK, SRC, and JNK pathways. Int J Mol Sci 2022, 23(21).
16.
Zurück zum Zitat Bejjani F, Evanno E, Zibara K, Piechaczyk M, Jariel-Encontre I. The AP-1 transcriptional complex: local switch or remote command? Biochim Biophys Acta Rev Cancer. 2019;1872(1):11–23.CrossRefPubMed Bejjani F, Evanno E, Zibara K, Piechaczyk M, Jariel-Encontre I. The AP-1 transcriptional complex: local switch or remote command? Biochim Biophys Acta Rev Cancer. 2019;1872(1):11–23.CrossRefPubMed
17.
Zurück zum Zitat Hao P, Zhang J, Fang S, Jia M, Xian X, Yan S, Wang Y, Ren Q, Yue F, Cui H. Lipocalin-2 inhibits pancreatic cancer stemness via the AKT/c-Jun pathway. Hum Cell. 2022;35(5):1475–86.CrossRefPubMed Hao P, Zhang J, Fang S, Jia M, Xian X, Yan S, Wang Y, Ren Q, Yue F, Cui H. Lipocalin-2 inhibits pancreatic cancer stemness via the AKT/c-Jun pathway. Hum Cell. 2022;35(5):1475–86.CrossRefPubMed
18.
Zurück zum Zitat Xiaohua Z, Xie Y, Huang W, Chen Z, Guo S. NAP1L1 promotes tumor proliferation through HDGF/C-JUN signaling in ovarian cancer. BMC Cancer. 2022;22(1):339.CrossRef Xiaohua Z, Xie Y, Huang W, Chen Z, Guo S. NAP1L1 promotes tumor proliferation through HDGF/C-JUN signaling in ovarian cancer. BMC Cancer. 2022;22(1):339.CrossRef
19.
Zurück zum Zitat Dérijard B, Hibi M, Wu IH, Barrett T, Su B, Deng T, Karin M, Davis RJ. JNK1: a protein kinase stimulated by UV light and Ha-Ras that binds and phosphorylates the c-Jun activation domain. Cell. 1994;76(6):1025–37.CrossRefPubMed Dérijard B, Hibi M, Wu IH, Barrett T, Su B, Deng T, Karin M, Davis RJ. JNK1: a protein kinase stimulated by UV light and Ha-Ras that binds and phosphorylates the c-Jun activation domain. Cell. 1994;76(6):1025–37.CrossRefPubMed
20.
Zurück zum Zitat Gao M, Labuda T, Xia Y, Gallagher E, Fang D, Liu YC, Karin M. Jun turnover is controlled through JNK-dependent phosphorylation of the E3 ligase itch. Science. 2004;306(5694):271–5.CrossRefPubMed Gao M, Labuda T, Xia Y, Gallagher E, Fang D, Liu YC, Karin M. Jun turnover is controlled through JNK-dependent phosphorylation of the E3 ligase itch. Science. 2004;306(5694):271–5.CrossRefPubMed
21.
Zurück zum Zitat Gu Q, Bowden GT, Normolle D, Sun Y. SAG/ROC2 E3 ligase regulates skin carcinogenesis by stage-dependent targeting of c-Jun/AP1 and IkappaB-alpha/NF-kappaB. J Cell Biol. 2007;178(6):1009–23.CrossRefPubMedPubMedCentral Gu Q, Bowden GT, Normolle D, Sun Y. SAG/ROC2 E3 ligase regulates skin carcinogenesis by stage-dependent targeting of c-Jun/AP1 and IkappaB-alpha/NF-kappaB. J Cell Biol. 2007;178(6):1009–23.CrossRefPubMedPubMedCentral
22.
Zurück zum Zitat Nijman SM, Luna-Vargas MP, Velds A, Brummelkamp TR, Dirac AM, Sixma TK, Bernards R. A genomic and functional inventory of deubiquitinating enzymes. Cell. 2005;123(5):773–86.CrossRefPubMed Nijman SM, Luna-Vargas MP, Velds A, Brummelkamp TR, Dirac AM, Sixma TK, Bernards R. A genomic and functional inventory of deubiquitinating enzymes. Cell. 2005;123(5):773–86.CrossRefPubMed
23.
Zurück zum Zitat Ansari-Lari MA, Muzny DM, Lu J, Lu F, Lilley CE, Spanos S, Malley T, Gibbs RA. A gene-rich cluster between the CD4 and triosephosphate isomerase genes at human chromosome 12p13. Genome Res. 1996;6(4):314–26.CrossRefPubMed Ansari-Lari MA, Muzny DM, Lu J, Lu F, Lilley CE, Spanos S, Malley T, Gibbs RA. A gene-rich cluster between the CD4 and triosephosphate isomerase genes at human chromosome 12p13. Genome Res. 1996;6(4):314–26.CrossRefPubMed
24.
Zurück zum Zitat Meng J, Ai X, Lei Y, Zhong W, Qian B, Qiao K, Wang X, Zhou B, Wang H, Huai L, et al. USP5 promotes epithelial-mesenchymal transition by stabilizing SLUG in hepatocellular carcinoma. Theranostics. 2019;9(2):573–87.CrossRefPubMedPubMedCentral Meng J, Ai X, Lei Y, Zhong W, Qian B, Qiao K, Wang X, Zhou B, Wang H, Huai L, et al. USP5 promotes epithelial-mesenchymal transition by stabilizing SLUG in hepatocellular carcinoma. Theranostics. 2019;9(2):573–87.CrossRefPubMedPubMedCentral
25.
Zurück zum Zitat Wierstra I. FOXM1 (forkhead box M1) in tumorigenesis: overexpression in human cancer, implication in tumorigenesis, oncogenic functions, tumor-suppressive properties, and target of anticancer therapy. Adv Cancer Res. 2013;119:191–419.CrossRefPubMed Wierstra I. FOXM1 (forkhead box M1) in tumorigenesis: overexpression in human cancer, implication in tumorigenesis, oncogenic functions, tumor-suppressive properties, and target of anticancer therapy. Adv Cancer Res. 2013;119:191–419.CrossRefPubMed
26.
Zurück zum Zitat Ma X, Qi W, Pan H, Yang F, Deng J. Overexpression of USP5 contributes to tumorigenesis in non-small cell lung cancer via the stabilization of β-catenin protein. Am J Cancer Res. 2018;8(11):2284–95.PubMedPubMedCentral Ma X, Qi W, Pan H, Yang F, Deng J. Overexpression of USP5 contributes to tumorigenesis in non-small cell lung cancer via the stabilization of β-catenin protein. Am J Cancer Res. 2018;8(11):2284–95.PubMedPubMedCentral
27.
Zurück zum Zitat Shalem O, Sanjana NE, Hartenian E, Shi X, Scott DA, Mikkelson T, Heckl D, Ebert BL, Root DE, Doench JG, et al. Genome-scale CRISPR-Cas9 knockout screening in human cells. Science. 2014;343(6166):84–7.CrossRefPubMed Shalem O, Sanjana NE, Hartenian E, Shi X, Scott DA, Mikkelson T, Heckl D, Ebert BL, Root DE, Doench JG, et al. Genome-scale CRISPR-Cas9 knockout screening in human cells. Science. 2014;343(6166):84–7.CrossRefPubMed
29.
Zurück zum Zitat Zhang HH, Li SZ, Zhang ZY, Hu XM, Hou PN, Gao L, Du RL, Zhang XD. Nemo-like kinase is critical for p53 stabilization and function in response to DNA damage. Cell Death Differ. 2014;21(10):1656–63.CrossRefPubMedPubMedCentral Zhang HH, Li SZ, Zhang ZY, Hu XM, Hou PN, Gao L, Du RL, Zhang XD. Nemo-like kinase is critical for p53 stabilization and function in response to DNA damage. Cell Death Differ. 2014;21(10):1656–63.CrossRefPubMedPubMedCentral
30.
Zurück zum Zitat Ning F, Xin H, Liu J, Lv C, Xu X, Wang M, Wang Y, Zhang W, Zhang X. Structure and function of USP5: insight into physiological and pathophysiological roles. Pharmacol Res. 2020;157:104557.CrossRefPubMed Ning F, Xin H, Liu J, Lv C, Xu X, Wang M, Wang Y, Zhang W, Zhang X. Structure and function of USP5: insight into physiological and pathophysiological roles. Pharmacol Res. 2020;157:104557.CrossRefPubMed
31.
Zurück zum Zitat Lee EH, Kim HT, Chun SY, Chung JW, Choi SH, Lee JN, Kim BS, Yoo ES, Kwon TG, Kim TH, et al. Role of the JNK pathway in bladder Cancer. Onco Targets Ther. 2022;15:963–71.CrossRefPubMedPubMedCentral Lee EH, Kim HT, Chun SY, Chung JW, Choi SH, Lee JN, Kim BS, Yoo ES, Kwon TG, Kim TH, et al. Role of the JNK pathway in bladder Cancer. Onco Targets Ther. 2022;15:963–71.CrossRefPubMedPubMedCentral
32.
Zurück zum Zitat Xia Y, Wang J, Xu S, Johnson GL, Hunter T, Lu Z. MEKK1 mediates the ubiquitination and degradation of c-Jun in response to osmotic stress. Mol Cell Biol. 2007;27(2):510–7.CrossRefPubMed Xia Y, Wang J, Xu S, Johnson GL, Hunter T, Lu Z. MEKK1 mediates the ubiquitination and degradation of c-Jun in response to osmotic stress. Mol Cell Biol. 2007;27(2):510–7.CrossRefPubMed
33.
Zurück zum Zitat Li L, Yang H, He Y, Li T, Feng J, Chen W, Ao L, Shi X, Lin Y, Liu H et al. Ubiquitin-specific protease USP6 regulates the Stability of the c-Jun protein. Mol Cell Biol 2018, 38(2). Li L, Yang H, He Y, Li T, Feng J, Chen W, Ao L, Shi X, Lin Y, Liu H et al. Ubiquitin-specific protease USP6 regulates the Stability of the c-Jun protein. Mol Cell Biol 2018, 38(2).
34.
Zurück zum Zitat Dayal S, Sparks A, Jacob J, Allende-Vega N, Lane DP, Saville MK. Suppression of the deubiquitinating enzyme USP5 causes the accumulation of unanchored polyubiquitin and the activation of p53. J Biol Chem. 2009;284(8):5030–41.CrossRefPubMed Dayal S, Sparks A, Jacob J, Allende-Vega N, Lane DP, Saville MK. Suppression of the deubiquitinating enzyme USP5 causes the accumulation of unanchored polyubiquitin and the activation of p53. J Biol Chem. 2009;284(8):5030–41.CrossRefPubMed
35.
Zurück zum Zitat Kapuria V, Peterson LF, Fang D, Bornmann WG, Talpaz M, Donato NJ. Deubiquitinase inhibition by small-molecule WP1130 triggers aggresome formation and tumor cell apoptosis. Cancer Res. 2010;70(22):9265–76.CrossRefPubMed Kapuria V, Peterson LF, Fang D, Bornmann WG, Talpaz M, Donato NJ. Deubiquitinase inhibition by small-molecule WP1130 triggers aggresome formation and tumor cell apoptosis. Cancer Res. 2010;70(22):9265–76.CrossRefPubMed
36.
Zurück zum Zitat Kapuria V, Peterson LF, Showalter HD, Kirchhoff PD, Talpaz M, Donato NJ. Protein cross-linking as a novel mechanism of action of a ubiquitin-activating enzyme inhibitor with anti-tumor activity. Biochem Pharmacol. 2011;82(4):341–9.CrossRefPubMed Kapuria V, Peterson LF, Showalter HD, Kirchhoff PD, Talpaz M, Donato NJ. Protein cross-linking as a novel mechanism of action of a ubiquitin-activating enzyme inhibitor with anti-tumor activity. Biochem Pharmacol. 2011;82(4):341–9.CrossRefPubMed
Metadaten
Titel
USP5 facilitates bladder cancer progression by stabilizing the c-Jun protein
verfasst von
Hui-hui Zhang
An-qi Zhang
Peng Peng
Liang Huang
Cai-ying Liu
Xin-rui Nie
De-fu Hou
Xia Zhang
Shang-ze Li
Publikationsdatum
01.12.2024
Verlag
BioMed Central
Erschienen in
Cancer Cell International / Ausgabe 1/2024
Elektronische ISSN: 1475-2867
DOI
https://doi.org/10.1186/s12935-024-03222-7

Weitere Artikel der Ausgabe 1/2024

Cancer Cell International 1/2024 Zur Ausgabe

Hodgkin Lymphom: BrECADD-Regime übertrifft die Erwartungen

05.06.2024 ASCO 2024 Kongressbericht

Das Kombinationsregime BrECADD mit Brentuximab vedotin ermöglichte in der Studie HD21 beim fortgeschrittenen klassischen Hodgkin-Lymphom eine unerwartet hohe progressionsfreie Überlebensrate von 94,3% nach vier Jahren. Gleichzeitig war das Regime besser tolerabel als der bisherige Standard eBEACOPP.

Antikörper-Drug-Konjugat verdoppelt PFS bei Multiplem Myelom

05.06.2024 ASCO 2024 Nachrichten

Zwei Phase-3-Studien deuten auf erhebliche Vorteile des Antikörper-Wirkstoff-Konjugats Belantamab-Mafodotin bei vorbehandelten Personen mit Multiplem Myelom: Im Vergleich mit einer Standard-Tripeltherapie wurde das progressionsfreie Überleben teilweise mehr als verdoppelt.

Neuer TKI gegen CML: Höhere Wirksamkeit, seltener Nebenwirkungen

05.06.2024 Chronische myeloische Leukämie Nachrichten

Der Tyrosinkinasehemmer (TKI) Asciminib ist älteren Vertretern dieser Gruppe bei CML offenbar überlegen: Personen mit frisch diagnostizierter CML entwickelten damit in einer Phase-3-Studie häufiger eine gut molekulare Response, aber seltener ernste Nebenwirkungen.

Brustkrebs-Prävention wird neu gedacht

04.06.2024 ASCO 2024 Kongressbericht

Zurzeit untersuchen Forschende verschiedene neue Ansätze zur Prävention von Brustkrebs bei Personen mit hohem Risiko. Darunter Denosumab, die prophylaktische Bestrahlung der Brust – und Impfungen.

Update Onkologie

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.