Comparative analysis of the profiles of IgG subclass-specific responses to Plasmodium falciparum apical membrane antigen-1 and merozoite surface protein-1 in naturally exposed individuals living in malaria hypoendemic settings, Iran

This study was carried out in Chabahar, Sistan and Baluchistan Province in south-eastern Iran. In this area, most of the patients are adults and may experience several infections by P. falciparum and P. vivax. In this investigation, 101 blood samples were obtained from suspected patients attended at the Malaria Health Center in Chabahar Public Health Department in Sistan and Baluchistan Province from May 2006 to 2012. Before blood collection, an informed consent was obtained from adults or parents or legal guardians of children who were participant in this study. The diagnosis of malaria was made by microscopic examination of blood smears stained with Giemsa. All P. falciparum-positive samples were verified by molecular diagnosis using the 18ssrRNA gene as described previously [56]. The control blood samples (n = 30) were obtained from the residents in Tehran (Iran) with no known pervious exposure to malaria. From all subjects, 2 ml venous blood was collected for both Plasmodium DNA detection and serum collection in EDTA tubes. The collected blood samples were transported on-ice to the main laboratory in the Institut Pasteur Iran. The majority of the patients were male (75.2%) with a mean age of 29.9 ± 12.6 years (ranged between 4 to 75 years old). The patients’ travel histories were obtained by a physician prior to sampling. The demographic information of the examined groups is shown in Table 1. This study was approved by the Ethical Review Committee of Research in Institut Pasteur Iran.

Parasite genomic DNA was prepared from the whole blood by using the commercially available DNA Purification Kit (Promega, Madison, WI, USA). The DNA was dissolved in 30 μl TE buffer (10 mM Tris–HCl, pH 8.0, 0.1 mM EDTA) and kept at −20°C until use. In this study, for the expression of recombinant PfAMA-1 (rPfAMA-1), DNA samples with known sequences of PfAMA-1 (GenBank accession no. KC413989) were selected based on previous study [57]. Amplification of PfAMA-1 fragment corresponding to amino acids 96–542 (nucleotides: 286–1626) was performed using the following primers:

PfAMA-1-AF:AGCGGAGGATCCAGCATTGAAATAGTAGAAAGAAG, BamHI site (italic)

PfAMA-1-AR: AGGGCCAAGCTTCATAAGTTGGTTTATGTTCAG, HindIII site (italic)

The PCR was performed at 95°C for 5 min, 30 cycles at 94°C for 1 min, 60°C for 1 min, 72°C for 1 min, followed by 60°C for 2 min and final extension at 72°C for 30 min. The PCR products were analysed by electrophoresis on 1% agarose gel under an ultraviolet light and purified by QIA quick Gel Extraction Kit (Qiagen, Germany). The gel-purified PCR products were cloned into pGEM-T Easy Vector (Promega, USA) and transformed into Escherichia coli DH5α. The transformed clones were selected on the Luria-Bertani agar medium, containing 100 μg/ml ampicillin, 1.5 mM isopropyl-β-D-thiogalactopyranoside (IPTG), and 0.04% X-gal. Positive clones were confirmed by plasmid isolation, followed by digestion with EcoRI, and the cloned fragments were then sequenced. Fragments corresponding to the PfAMA-1 sequence were excised with restriction enzymes (BamHI and HindIII) and ligated to the BamHI-HindIII sites of vector pQE-30 (Qiagen, Germany), which provides a poly-histidine (6-His) tag in N-terminus to facilitate further purification. The ligation mixtures were transformed into competent E. coli DH5α cells, and the recombinant clones were selected on ampicillin plates. The open reading frame was confirmed by sequencing, and this construct was used to transform E. coli M15 (pREP4) expression host (Qiagen, Germany).

rPfAMA-1 was expressed in E. coli M15. Briefly, overnight cultures from single colonies of PfAMA-1-specific E. coli were expanded in TB (Terrific broth; pH 7.2), containing ampicillin (100 μg/ml) and kanamycin (25 μg/ml) with shaking (150 rpm) at 37°C until an optical density (OD) of 0.6 to 0.7 at 600 nm was reached. The expression of PfAMA-1 was induced with 0.5 mM IPTG (Sigma, USA). The culture was further grown for 4 h, and the E. coli cells were harvested by centrifugation and kept in −80°C until use. PfAMA-1 was expressed in inclusion bodies, and the cell pellet was dissolved in denaturation buffer (8 M Urea, 30 mM imidazole, 20 mM Tris–HCl, and 1 M NaCl, pH 7.9). The cells were lysed on ice by sonication (Ultraschallprozessor, Germany) with 10 cycles, each consisting of 20- second (s) pulses with 20-s intervals. The bacterial lysate was centrifuged at 14,000 × rpm at 4°C for 30 min. The supernatant was incubated with Ni²⁺-nitrilotriacetic acid agarose resin (Ni-NTA Agarose, Qiagen, Germany) at 4°C for 2 h, and the resin was packed into a column and was washed with a 10-column volume of wash buffer (6 M urea, 20 mMTris-HCl, 1 M NaCl, and 60 mM imidazole, pH 7.9). The bound protein was eluted with a buffer, containing 4 M urea, 200 mM imidazole, 20 mM Tris–HCl, and 300 mM NaCl, pH 7.9. The fractions containing PfAMA-1 was desalted with Econo-Pac 10DG columns (BioRad, USA) according to the manufacture’s manual and then concentrated with a concentrator (Eppendorf, Germany). The eluted proteins were analysed under reducing (with 1% SDS and 2% β-mercaptoethanol [2ME]) and non-reducing conditions (with SDS and without 2ME) by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE, 12%). The concentration of the protein was determined using Bradford’s assay by a spectrophotometer (Eppendorf, Germany). To confirm the purified recombinant proteins, Western blot assay was carried out by standard protocols using anti-His antibody (Penta His Antibody; Qiagen) and with P. falciparum-infected human sera that reacted with rPfAMA-1 under both reducing and non-reducing conditions. Protein migration at different sizes on SDS-PAGE in the presence and absence of 2ME indicates the presence of a disulfide bound, suggesting that all recombinant proteins had a tertiary shape in their antigens.

rPfMSP-1₁₉ was expressed as described previously [11]. Briefly, rPfMSP-1₁₉ protein was expressed in E. coli BL21. Overnight cultures from single colonies of PfMSP-1₁₉₋ specific E. coli were expanded in TB (pH 7.2) containing ampicillin (100 μg/ml) at 37°C with shaking (150 rpm) until an OD of 0.6-0.7 at 600 nm was reached. In addition, the expression of GST-PfMSP-1₁₉ was induced with 0.5 mM IPTG (Sigma, USA). The culture was further grown for 4 h, and the E. coli cells were harvested by centrifugation and kept in −70°C until use. The cell pellet was dissolved in PBS 1× (pH 7.4) and lysed on ice with 10 sonication cycles (Ultraschall-Prozessor, Germany), each consisting of 20-s pulses at 20-s intervals. The bacterial lysate was centrifuged at 14,000 × g at 4°C for 30 min. The supernatant was incubated with glutathione 4B Sepharose resin (Amersham Biosciences, USA) at 4°C for 1 h, and the resin was packed into a column. The column was washed with PBS 1×, pH 7.4 (10-column volume). The bound protein was eluted with a buffer, containing 50 mM Tris–HCl and 10 mM reduced glutathione, pH 8. The fractions containing PfMSP-1₁₉ were desalted with Econo-Pac 10 DG columns (BioRad, USA) according to the manufacturer’s manual and then concentrated with a concentrator (Eppendorf, Germany). The eluted proteins were analysed under reducing (with 1% SDS and 2% 2ME) and non-reducing conditions (with SDS and without 2ME) by SDS-PAGE (12%), and the concentration of the protein was determined using Bradford's assay by a spectrophotometer (Eppendorf, Germany).

Inbred BALB⁄c female mice (6–8 weeks old) were obtained from Laboratory Animal Science Department, the Institut Pasteur Iran. Mice groups (n = 7) were immunized subcutaneously at the base of tail with 30 μg and 35 μg of the rPfAMA-1and rPfMSP-1₁₉, respectively. In priming and boosting, the antigens were then emulsified in complete Freund's adjuvant (CFA, Sigma, St. Louis, MO, USA) and with incomplete Freund's adjuvant (IFA, Sigma) in 1:1 ratio. The mice control groups were immunized with PBS alone, PBS in Freund's adjuvant and rGST alone. The animals were boosted on days 14 and 28 and bled on days 0 (pre-immune), 21, and 35 of first immunization.

IFAT assay was performed to test the ability of the anti-PfAMA-1 and anti-PfMSP-1₁₉ sera of immunized mice, to recognize the native form of both antigens on merozoite surface and to determine the similarity between epitopes in recombinant forms and corresponding native proteins. For this purpose, multispot slides of parasites were prepared from P. falciparum culture, air-dried and then fixed in cold acetone for 10 min. Polyclonal mouse sera diluted (1:100–1:12,800) in PBS were added to the spots and incubated in a wet chamber for 60 min. After washing three times with PBS (pH 7.4), each well was covered with 20 μL of the fluorescein-conjugated anti-mouse polyvalent IgG (1:40) and then left in a wet chamber for 40 min. Again, after washing three times with PBS, coverslips were placed on each slide and examined under a fluorescence microscope (Nikon E200, Tokyo, Japan) with an oil immersion objective (100×). The serum samples obtained from normal mice were used as negative controls.

In the present study, IgG antibody responses of individuals during acute infection to rPfAMA-1 and rPfMSP-1₁₉ antigens (as single or in combination) were measured by an ELISA as described previously with some modifications [11]. In brief, Maxisorp flat-bottomed 96-well microplates (Grainer, Labortechnic, Germany) were coated duplicate with 200 ng of either rPfAMA-1 or rPfMSP-1₁₉ and in combination of rPfAMA-1and rPfMSP-1₁₉ (100 ng and/or 200 ng of each antigen/well) or GST alone (as control) in 0.06 M carbonate-bicarbonate buffer (pH 9.6) and then incubated at 4°C overnight. The plates were washed with PBS-Tween (PBS-T) and blocked with bovine serum albumin (BSA)-PBS-0.05% Tween. Serum was added in duplicate at a dilution of 1:200 (in BSA-PBS-0.05% Tween, 100 μl/well). After washing with PBS-T, the plates were incubated with horseradish peroxidase-conjugated goat anti-human IgG (Sigma, USA) at 1:35,000 concentration. Finally, the enzyme reaction was developed with o-phenylediamine dihydrochloride-H₂O₂ (OPD, Sigma, USA) and stopped with 2 N H₂SO₄. The OD was measured using an ELISA microplate reader (Biotech, USA) at 490 nm. All samples were re-tested if there was a discrepancy of greater than 20% between the duplicates. Standardization of the plates was achieved using positive-control serum pools on each plate. Background (determined from the wells with either no serum or GST) was subtracted from the mean of each sample, and a cut-off value was determined as the mean plus three standard deviations from the 30 negative control serum samples which were included in each assay.

A database was generated with SPSS 20.0 for windows (SPSS Inc., USA). As the antibody levels were not normally distributed, non-parametric tests were used. Differences in the proportions of IgG-positive subjects were assessed using the McNemar's test or Chi square comparison of proportions as appropriate. Furthermore, differences between the mean absorbance of antigens alone or in combination were analysed by using Wilcoxon Signed Ranks test or Friedman test as appropriate. The Spearman’s correlation test was also used to assess the association between antibody levels with age as well as exposure. P values < 0.05 were considered statistically significant. The sensitivity of each test was measured by dividing the number of positive IgG sera to total numbers of sera obtained from P. falciparum-infected individuals.