Background
Colorectal cancer (CRC) is the third most common and second leading cause of cancer death in the world [
1]. Although significant progress has been made in the treatment of CRC in recent decades, the prognosis is still poor, especially in the distant metastasis of advanced-stage tumors [
2,
3]. Therefore, finding novel potential biomarkers for early diagnosis and prediction of CRC metastasis and further elucidating the precise molecular mechanisms can provide improved treatment for CRC patients.
Circular RNAs (circRNAs), a class of non-coding RNAs, are characterized by a covalent bond linking the 3’and 5′ ends generated by backsplicing [
4]. Most circRNAs result from a non-canonical form of alternative splicing, a process mediated by spliceosomes or by group I and group II ribozymes [
5]. Genome-wide analyses of RNA sequencing data have showed evolutionary conservation and abundance of circular RNAs [
6,
7]. CircRNAs can be generated from exons, called exonic circular RNAs [
6,
8], or from introns, called intronic circular RNAs, or a mix of both called circRNAs [
9,
10]. CircRNAs have been found to function as endogenous miRNA sponges since some circRNAs possess miRNA binding sites, allowing them to arrest miRNA activity [
11]. Besides, circRNAs also function as RNA-binding protein (RBP) sequestering agents as well as transcription regulators to modulate gene expressions [
12‐
14]. Emerging evidences suggest that circRNAs are closely related to human diseases, especially cancers, and can serve as better biomarkers because of their abundance and stability. Recently, several circRNAs have been found to be associated with CRC tumorigenesis or metastasis, such as circCCDC66, hsa_circ_001569, ciRS-7-A, and circHIPK3 [
15‐
19]. These studies demonstrate that the regulation of circRNA expression is tightly controlled under distinct circumstances, and that the investigations into circRNA are still in their infancy. The functions and underlying mechanisms of circRNAs in the epithelial–mesenchymal transition (EMT) process of human cancers, such as CRC, remain unclear. EMT is the key to tumor metastasis [
20,
21]. EMT converts epithelial cells to a mesenchymal-like phenotype and is associated with the loss of cell contacts, production of the type-III intermediate filament protein vimentin, and increases in cell migration and invasion [
22].
In this study, we identified a molecular effector mechanism of circPTK2 (hsa_circ_0005273 in circBase:
http://www.circbase.org) in CRC using circRNA microarray, bioinformatics, and functional studies. We found that circPTK2 was elevated in CRC tissues and positively associated with tumor growth and metastasis. CRC patients with increased circPTK2 expression were positively correlated with poorer survival rates. Further mechanism studies showed that circPTK2 could promote EMT of CRC cells in vitro and in vivo by targeting vimentin protein on sites Ser38, Ser55 and Ser82. We further demonstrated that the interaction of circPTK2 and vimentin mediated the regulation of CRC by knockdown or overexpression of vimentin. In addition, we showed that tail vein injection of shRNA specifically targets circPTK2 blunt tumor metastasis in a patient-derived CRC xenograft model. In concert, we identified that circPTK2 is a promising biomarker for early diagnosis of CRC metastasis and provides a potential therapeutic target for CRC.
Methods
Patients and specimens
All samples used in this study were in compliance with the informed consent and agreement of patients as well as the ethical regulations (No. 2017ZDKYSB165) of Southeast University, China.
Fresh tumor tissue and corresponding adjacent noncancerous tissues were collected from CRC patients, which included a test set (consisting of 61 CRC cases enrolled from the Jiangsu Tumor Hospital) and a validation set (consisting of 131 CRC cases enrolled from the Affiliated Hospital of the Xuzhou Medical College), between 2014 and 2016. Tumor stage was defined according to the criteria of the sixth edition of TNM classification of the International Union Against Cancer (UICC, 2009). Detailed information of CRC patients is presented in Additional file
7: Table S1.
To determine whether circRNA serves as a blood-based early biomarker for CRC detection, peripheral blood samples were collected simultaneously with the tumor tissues mentioned above. Meanwhile, peripheral blood samples were also collected from sex- and age-matched healthy donors enrolled from the Nanjing Hospital of Chinese Medicine from 2014 to 2016. Criteria for healthy control exclusion included those with a history of diabetes, obesity (BMI over 30), hypertension (systolic blood pressure over 120 mm of mercury (mm Hg) and/or diastolic blood pressure over 80 mmHg), clinically diagnosed chronic cardiovascular diseases, chronic kidney diseases, chronic gastrointestinal diseases, and respiratory diseases. Detailed information of healthy control is presented in Additional file
7: Table S1. Because the total RNA extracted from six samples was unqualified, and six blood samples were not collected, these samples were not counted in. Therefore, the sample size finally included in the statistics is 186.
For the construction of tissue microarray (TMA), the CRC and adjacent non-tumor tissues (5 cm from the tumoral margins) were collected from two independent cohorts as previously reported [
23]. The test cohort (376 patients) was recruited from the Affiliated Hospital of Xuzhou Medical College between 2007 and 2011. A validation cohort consisting of 702 patients was recruited from the Jiangsu Tumor Hospital between 2007 and 2011. All of the patients were followed-up by a trained clinical specialist through in-person or family contact from the time of diagnosis to death, or last follow-up (the last follow-up was in June 2016). The maximum follow-up time was 112.7 months and the median survival time (MST) was 75.0 months. Detailed information on these patients is listed in Additional file
8: Table S2 [
23]. Because 105 samples were lost during antigen retrieval or without relevant cells present in the core, the number of sample size finally included in the statistics is 973.
Cell culture and in vitro experiments
Human CRC cell lines (HCT15, SW620, SW480 and LOVO) and 293 T were purchased from American Type Culture Collection (ATCC) (Manassas, VA).
Details are provided in Additional file
10.
CircRNA microarray
Six pairs of CRC tissues (3 colon and 3 rectal carcinomas) and the corresponding adjacent noncancerous tissues, as well as six adenomas (all tubulovillous adenomas) were utilized for circRNA microarrays. The specimens were obtained from patients undergoing surgery in the Jiangsu Tumor Hospital in 2015; detailed information is shown in Additional file
9: Table S3.
Details are provided in Additional file
10.
Tissue/serum preparation and RNA isolation
Details are provided in Additional file
10.
RNAscope
circPTK2 expression levels in CRC cells, fresh paraffin-embedded tissues, and TMA were assayed with the BaseScopeTM Reagent Kit v2-RED (Advanced Cell Diagnostics, Newark, CA) according to the manufacturer’s instructions. Briefly, samples were incubated with circPTK2 probes (NM_153831.3, nt2804–2485) at 40 °C for 2 h. For the fresh paraffin-embedded tissues, the samples were rehydrated for 15 min and digested with protease for 30 min before incubation with the probe. After hybridization, a series of single amplification procedures were performed. circPTK2 expression levels were ultimately visualized with Fast Red.
CircRNA in situ hybridization (RNA-ISH)
Tissue microarray (TMA) slides were de-paraffinized using xylene for three 5-min washes; rehydrated with an ethanol gradient via 5-min washes in 100, 95, and 80% ethanol; and then treated with 20 μg/mL Proteinase K (Roche Diagnostics, Indianapolis, IN) for 10 min at 37 °C. After that, the slides were fixed in 4% formaldehyde (Thermo Scientific, Rockford, IL) for 10 min, rinsed twice using 0.13 M 1-methylimidazole, and re-fixed with 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC, Thermo Scientific) for 1 h. The 1% H2O2 was used to block endogenous peroxidases, and the slides were pre-hybridized at 50 °C for 30 min in the hybridization buffer [50% formamide (American Bioanalytical)], 5 × SSC (American Bioanalytical, Natick, MA), 50 μg/mL heparin (Sigma-Aldrich, St. Louis, MO), 0.1% Tween 20 (Sigma-Aldrich, St. Louis, MO), and 500 μg/mL yeast tRNA (Invitrogen, Carlsbad, CA), with a pH = 6. Next, the slides were hybridized with 200 nM double digoxigenin (DIG) LNA modified.
The staining of circPTK2 in the TMA was scored independently by two pathologists blinded to the clinical data using the following criterion: Category A: the intensity of immunostaining was scored from 0 to 3 (0, negative; 1, weak; 2, moderate; and 3, strong); Category B: the percentage of immunoreactive circPTK2 was deemed as 1 (0–25%), 2 (26–50%), 3 (51–75%), and 4 (76–100%). The circPTK2 score was calculated by multiplying Category A and Category B.
In vivo experiments
All animal experiments were conducted with the approval of the Center for New Drug Evaluation and Research, China Pharmaceutical University (Nanjing, China) in a 12-h light and 12-h dark turnover environment, and in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals. The animals were housed in standard pathogen-free (SPF) conditions at 24 °C ± 2 °C, with 40 to 70% relative humidity. Water and a basal diet were given ad libitum. The nude mice were purchased from the Model Animal Research Center of Nanjing University (China). Of note, 5 × 106 cells less than 15 passage after the initial drug selection were implanted in the flank site of 6-week-old female nude mice (n = 3/group). Fourteen days later, images were taken by an in vivo imaging system (IVIS) Spectrum (PerkinElmer, USA). The tumor, liver, and lung tissues were harvested, and the biochemical luciferase activities in the homogenate of tissues were determined by a luminometer (Sirius, Berthold Detection Systems, Germany).
Quantitative real-time PCR analysis
For mature circRNA expression analysis, 1 μg of total RNA was converted to cDNA using a One Step PrimeScript® circRNA cDNA Synthesis Kit (Takara, Shiga, Japan). After reverse transcription, quantitative real-time PCR analysis was performed using the SYBR Premix Ex Taq kit (Takara, Shiga, Japan) along with the specific circRNA LNA™ PCR primer sets designed by Exiqon (Denmark). GAPDH was used as a normalization control for all of the samples. All of the experiments were performed in triplicates. The primers were 5′-AATGCCTGTGAACCCATAGTG-3′ (forward) and 5′- CTGACAGCATGAGCATCCCT − 3′ (reverse) for circPTK2.
Lentivirus stable transduction
Lentiviruses were generated by co-transfection of the expression vector of interest with the packaging plasmids psPAX2 and pMD2G.
Details are provided in Additional file
10.
Western blotting
For western blotting assays, proteins isolated from tissues were incubated with primary antibody detecting vimentin and E-cadherin (1: 1000 dilution; cell signaling), and β-actin (1:1000 dilution; cell signaling) was used as a control.
Details are provided in Additional file
10.
siRNA, shRNA, and plasmid construction and cell transfection
siRNAs targeting circPTK2 and vimentin were designed and synthesized by RiboBio (Guangzhou, China).
Details are provided in Additional file
10.
Immunohistochemistry (IHC) staining
Tissues were fixed with 4% paraformaldehyde, dehydrated, embedded in paraffin and sectioned at 4 μm. Sections were deparaffinized, rehydrated and incubated with 3% H2O2. After antigen repair and being blocked, the slides were incubated with rabbit monoclonal antibody against vimentin (1:100) (Cell Signaling Technology, USA) at 4 °C overnight. Subsequently, the slides were incubated with secondary antibody at room temperature for 30 min and then incubated with streptavidin peroxidase complex. Staining was performed using 3, 3-diaminobenzidine (DAB) substrate kit for peroxidase reaction and counterstained with hematoxylin. Finally, the slides were analyzed with a light microscope.
Biotin-labeled RNA pull-down and mass spectrometry analysis
Biotin-labeled RNA for liner sequence of circPTK2 was generated by an in vitro transcription reaction with the Biotin RNA Labeling Mix (Roche, Mannheim, Germany) and T7 RNA polymerase (Roche, Mannheim, Germany), and then treated with RNase-free DNase I (Takara, Japan). After incubation with guide oligonucleotide targeting circular junction, the liner probe was then circularized using T4 RNA ligase I, treated with RNase R. After purified with RNeasy Mini Kit (Qiagen, Inc., Valencia, CA, USA), the biotin-labeled RNA probe (3 μg) was then incubated with cell extracts from CRC cells at room temperature (RT) for 2 h, and treated with 35 μl of Streptavidin C1 magnetic beads (Invitrogen) for 1 h. after washed, the retrieved protein was detected by western blot or mass spectrometry analysis (CapitalBio Technology, Beijing, China).
Patient-derived tumor xenograft (PDTX) models
Briefly, fresh human CRC tissues were washed twice with cold PBS containing penicillin (500 U/mL) and streptomycin (500 μg/mL), and transplanted subcutaneously into the right flanks of NCG mice. When the tumor volume reached 250 mm3 (V = 0.5 × length × width2), xenografts were resected and passaged into additional NCG mice. Successfully xenografted CRC tumor models were passaged and banked after three passages in vivo. For isolation of the PDTX tumor cells, xenografts were disaggregated mechanically, and washed twice using PBS with penicillin (500 U/mL), streptomycin (500 μg/mL), gentamicin (100 mg/L), and amphotericin B (2.5 mg/L). Next, the tumor mass was digested in culture medium containing type II/IV collagenase (1 mg/mL) and DNase (1 mg/mL) at 37 °C for 1 h with gentle shaking. After filtration through a 80 μm filter (BD Biosciences, San Jose, CA), the cell suspension was centrifuged at 300 g for 5 min at 4 °C. The pellets were resuspended using Dulbecco’s Modified Eagle Medium (DMEM) and seeded in 6-well plates for further experimentation. Subsequently, mice bearing lower circPTK2-expressing xenografts were injected with control and circPTK2-overexpressing lentivirus by tail vein, whereas mice bearing higher circPTK2-expressing xenografts were injected with control shRNA and circPTK2 shRNA lentivirus by tail vein. Twenty-one days later, mice were killed and liver sections were subjected to H&E staining and autofluorescence assay.
Details are provided in Additional file
10.
Statistical analysis
Data are shown as mean ± standard error of the mean (SE). The 2-ΔΔ Ct method was used to analyze the results of real-time PCR in all of the experiments. Differences in the circRNA levels of the tissues were analyzed using the Wilcoxon rank-sum test. The receiver operating characteristic (ROC) curves plotted by R package’s “pROC” were applied to estimate the diagnostic value of CIRC on CRC detection [Robin X, et al. pROC: an open-source package for R and S+ to analyze and compare ROC curves. BMC Bioinformatics 12, 77 (2011)].
The time-dependent ROC curve analysis was used to calculate the best cutoff value of circRNA. The different values of the follow-up time were evaluated through the performances of different scores by plotting (t, AUC[T]). The probability of difference in overall survival (OS) was ascertained by Kaplan-Meier curves, and the significance was detected by a log-rank test. Univariate or multivariate Cox regression analysis was applied to estimate the crude hazard ratios (HRs), adjusted HRs, and corresponding 95% confidence intervals (CIs). Statistical analysis was performed using SAS software 9.4, GraphPad Prism, and significance was set at P < 0.05.
Discussion
In this study, we found circPTK2, a circRNA derived from PTK2 gene with unknown molecular functions, was elevated and associated with poor prognosis. In vitro and in vivo studies showed that circPTK2 possesses oncogenic capability according to promoting cell proliferation, migration, and metastasis. To the best of our knowledge, this is the first report that exhaustively investigates the expression, regulation, function, and clinical implication of circPTK2 (hsa_circ_0005273) in CRC.
Compared with other RNAs, such as miRNAs and lncRNAs, circRNAs are more suitable as potential cancer biomarkers. First, the lack of 5′ or 3′ ends makes circRNAs highly resistant to RNase activity [
6,
12,
28]. Second, they often express in a tissue- and developmental-stage-specific manner; and third, they are plentiful in various tissues and body fluids including blood, plasma, serum, and even in exosomes, making them potential candidates for liquid biopsy biomarkers [
29,
30]. As expected, there are already many circRNAs recognized as cancer biomarkers. CiRS-7 and circHIPK3 were respectively identified to be promising prognostic biomarkers in CRC [
17,
19]. In the present study, we found that circPTK2 might act as a potential biomarker for early diagnosis of CRC metastasis.
A previous study reported that circPTK2 (hsa_circ_0003221) promotes the proliferation and migration of bladder cancer cells [
31]. One recent study suggested circPTK2 (hsa_circ_0008305) inhibits TGF-β-induced epithelial- mesenchymal transition and metastasis by controlling TIF1γ in non-small cell lung cancer [
32]. Together with our study, all these three circRNAs (hsa_circ_0005273, hsa_circ_0008305, and hsa_circ_0003221) were derived from the same pre-mRNA PTK2. However, they have distinctive sequences. CircRNA hsa_circ_0008305 with a spliced sequence length of 584 nt in circBase is back-spliced of seven exons (exons 8, 9, 10, 11, 12, 13 and 14) of PTK2. CircRNA hsa_circ_0005273 with a spliced sequence length of 357 nt is back-spliced of three exons (exons 27, 28, and 29). CircRNA hsa_circ_0003221 with a spliced sequence length of 625 nt is back-spliced of five exons (exons 3, 4, 5, 6 and 7). Therefore, the functions of these three circRNA may be distinguished.
CircRNAs have been reported to interact with different proteins to form specific circRNPs that subsequently influence modes of action of associated proteins [
33]. For example, circANRIL was bound to the essential 60S-preribosomal assembly factor pescadillo homolog 1 (PES1) and suppressed ribosome biogenesis in vascular smooth muscle cells and macrophages, resulting in nucleolar stress and cell death, which are key cellular events in atherosclerosis [
14]. CircMbl was also found to be associated with multifunctional protein MBL, which promotes the biogenesis of circMbl that is produced from the same gene locus. This circRNA could then sponge out the excess MBL protein by binding to it [
34]. Our results suggesting physical binding to circPTK2 to vimentin, which is distinguished from circPTK2 (hsa_circ_0008305), acting as a sponge for miR-429 / miR-200b-3p in non-small cell lung cancer cells and hereby inhibiting EMT in lung cancer cells [
32]. Recently, some circRNAs with tumor suppressive properties have been found to play important roles in tumorigenesis and metastasis, and can be used as therapeutic targets for cancer. CircITGA7 was found to inhibit the proliferation and metastasis of CRC cells by inhibiting the Ras signaling pathway and promoting ITGA7 transcription. Furthermore, hsa_circ_0014717 suppressed CRC growth by upregulating P16 expression [
35]. These indicate that circRNAs are gradually becoming carcinogenic stimulators or tumor suppressors in cancer.
Vimentin is a type 3 intermediate filament protein that is an critical marker of mesenchymal cells in EMT. It is responsible for maintaining cell shape and stabilizing cytoskeletal interactions. Vimentin serves as an organizer of many key proteins involved in cell attachment and migration [
36]. Vimentin is a potential cancer therapeutic target, since it is overexpressed in a number of cancers, and influences cell shape and motility in the process of EMT that occurs during metastasis [
37,
38]. Current studies have shown that phosphorylation of vimentin serine residues inhibits subunit polymerization, then promoting the decomposition of vimentin filaments and increasing the solubility of the protein [
39]. For example, Protein kinase A (PKA) phosphorylates vimentin mainly at Ser38 and Ser72 sites, resulting in decreased filament formation in vivo, which indicates that phosphorylation mainly regulates the decomposition of vimentin intermediate filaments [
40]. During mitosis, CDK1 phosphorylated vimentin at Ser55. This phosphorylation provides a PLK binding site for vimentin-PLK interaction. PLK further phosphorylated vimentin at Ser82, which may be a memory phosphorylation site and lead to the marked disassembly of vimentin filaments [
41,
42]. We found that circPTK2 (hsa_circ_0005273) promoted expression of vimentin via physically binding to its phosphorylation sites Ser38, Ser55 and Ser82.
Limitation of our study should be mentioned. It remains unclear that the regulatory mechanism of circPTK2 to promote CRC growth, and whether any miRNAs or other transcription factors are involved in the regulation of circPTK2 to metastatic process of CRC. CircPTK2 plays a part in tumor progression and metastasis. Therefore, how circPTK2 regulates CRC progression and metastasis warrants further investigation.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.