Down-regulation of granulocyte-macrophage colony-stimulating factor by 3C-like proteinase in transfected A549 human lung carcinoma cells

To optimize the efficiency of transfection and expression of functional 3CL^pro in A549 lung cancer cell line, we constructed expression vector expressing SARS-CoV 3CL^pro wild type gene into a pEGFP-C3 vector (Figure 1A). An inactive 3CL^pro mutant, C145A (TGT→GCT), was also included in this study as a negative control [7]. Furthermore, the myc tag sequence was also introduced into the 3' end of the 3CL^pro and C145A genes for immunofluorescence analysis. The DNA fragments of CMV promoter, 3CL^pro wild type, and C145A 3CL^pro mutant were amplified by PCR using primers containing restriction enzyme sites as shown in Figure 1A. The expression constructs were further verified by 1% agarose gel electrophoresis after restriction enzymes digestion (Figure 1B). As expected, the 597 bp of PCMV and 956 bp of 3CL^pro (and C145A) fragments were excised from plasmids with appropriate restriction enzymes and were confirmed by DNA sequencing.

The plasmids of pEGFP-C3, pEGFP-3CL^pro, and pEGFP-C145A were successfully transfected into A549 cells respectively. The expression levels of 3CL^pro and C145A mRNA were determined by reverse transcription (RT)-PCR and the protein expression levels were analyzed using 2D western blots (Figure 2A and 2B). The results indicated that the expression of 3CL^pro and C145A mRNA reached the highest level in A549 cells at 12 to 24 hrs and slightly decreased their expression at 48 h after transfection. However, 2D western blots results indicated that the protein expression levels of 3CL^pro and C145A steadily increased with time up to 48 hrs after transfection. To track the locations of 3CL^pro and C145A proteins in transfected A549 cells, Myc-tagged 3CL^pro and C145A were detected using rhodamine-conjugated anti-Myc antibodies. The immunofluorescence microscopic images demonstrated 60-70% transfection efficiency (data not shown) and the localizations of c-myc tagged 3CL^pro and C145A were detected both in the cytoplasm and nucleus of transfected A549 cells compared to control EGFP (Figure 3).

Total RNA from A549 cells (C), EGFP (E) and pEGFP-3CL^pro (3CL^pro) transfected cells were collected at 12, 24, 48, and 72 hrs. As shown in Figure 4, expression of GM-CSF was demonstrated in 3CL^pro transfected cells, A549 cells and EGFP transfected cells (Figures 2A and 4A) by Multiplex PCR kits. The decreased percentage was observed in EGFP-3CL^pro transfected A549 cells compared to the EGFP transfected A549 cells at 6, 12, 24, 48, and 72 hrs is 9%, 17%, 25%, 49%, and 56%, respectively. There was significant decrease of GM-CSF in 3CL^pro transfected A549 cells after 24 hrs (p < 0.005). Additionally, there were no change to the mRNA expression of IL-1β, IL-6, IL-8, IL12p40, TNF-α, and TGF-β found in 3CL^pro transfected cells. To confirm the mRNA expression of GM-CSF, other primer pairs were used to amplify GM-CSF by semi-quantification RT-MPCR. As shown in Figure 4B, decreased expression of GM-CSF was noted in 3CL^pro transfected cells compared to GAPDH in A549 cells and EGFP transfected cells at 24, 48, and 72 hrs. A significant decrease of GM-CSF was observed in 3CL^pro transfected A549 cells after 24, 48, and 72 hrs with maximal reduction folds of vector control about 0.75, 0.53 and 0.45, respectively (p < 0.005).

As shown in Figure 5, the values of GM-CSF concentration in the culture mediums of EGFP transfected A549 cells at 6, 12, 24, 48, and 72 hrs were 2.047 ± 0.2(pg/ml), 9.928 ± 0.13(pg/ml), 11.657 ±.15 (pg/ml), 60.714 ±.0.18 (pg/ml), 88.926 ±.0.31 (pg/ml), respectively. The values of GM-CSF concentration in the culture mediums of 3CL^pro transfected A549 cells at 6, 12, 24, 48, and 72 hrs were 2.624 ± 0.13(pg/ml), 6.852 ± 0.17(pg/ml), 7.237 ±.0.11 (pg/ml), 37.313 ±.0.18 (pg/ml), 56.25 ±.0.31 (pg/ml), respectively. The values of GM-CSF concentration in the culture mediums of C145A transfected A549 cells at 6, 12, 24, 48, and 72 hrs were 4.431 ± 0.11(pg/ml), 14.424 ± 0.21(pg/ml), 22.281 ±.0.54 (pg/ml), 66.235 ±.0.68 (pg/ml), 85.715 ±.0.43 (pg/ml), respectively. A significant decrease of GM-CSF was observed in 3CL^pro transfected A549 cells compared to the EGFP-transfected and C145A-transfected A549 cells by an analysis of covariance (p = 0.0204 and 0.0236 respectively).

To investigate whether ERK1/2, p38, and JNK MAPK pathways and NF-κB were involved in 3CL^pro-mediated GM-CSF production in A549 cells [25, 26], we examined the expression levels of these MAP kinases and NF-κB by western blot analysis. As shown in Figure 6 (a bar graph including mean and standard deviation were provided in Additional File 1), the expression of NF-κB was reduced in 3CL^pro transfected cells at 48 hrs after transfection compared to cells transfected with EGFP. In contrast, over expression of 3CL^pro did not change the expression levels of ERK1/2, p38, and JNK in A549 cells significantly.

Plasmid pEGFP-C3 was obtained from CLONTECH (CLONTECH Laboratories, Palo Alto, CA, USA). This plasmid contains the EGFP variant and neomycin resistant genes under the control of the cytomegalovirus early gene promoter and the SV40 early gene promoter, respectively. Full-length 3CL^pro versions (wild type and mutant, C145A) and CMV promoter were amplified by PCR using primers containing suitable restriction sites for subcloning into the pEGFP-C3 vector (3CL^pro primers: 5' ATATGGTACCAgTGGTTTTAGGAAAATGGCATTC 3'/Kpn I, 5' GAGATGAGTTTCTGCTCTTGGAAGGTAACACCAGAGCATT 3', and ATATGGATCCCAGATCCTCTTCTGAGATGAGTTTCTGCTCTTGGAA 3'/BamH I; CMV promoter primers: 5' ATATCTCGAGTAGTTATTAATAGTAATCAATTAC 3'/XhoI and 5' ATATAAGCTTTAGCGCTAGCGGATCTGA 3'/Hind III). The PCR was performed with reagents containing a 0.2 μM primers mixture, 1.25 μM dNTP mixture, 1.5 μM MgCl ₂ , 10 ng templates, and 2.5 U DNA polymerase (Takara, Tokyo, Japan). Amplified DNA fragments were then ligated into the cloning site of the pEGFP-C3 vector (EGFP) and transformed into Escherichia coli DH5α competent cells, which were obtained from Life Technologies (Carlsbad, California, USA). Restriction enzyme digestion, PCR and DNA sequencing analysis (Mission Biotech, Taipei, Taiwan) were used to verify the plasmids.

The human lung carcinoma A549 cells were obtained from American type culture collection (ATCC) (Manassas, VA, USA) and were grown in Dulbecco's modified Eagle medium (DMEM) supplemented with 10% fetal bovine serum (FBS) (GIBCO-BRL, Carlsbad, California, USA) at 37°C in a 5% CO₂ incubator. A total of 1 × 10⁶ cells were grown to 70% confluence in 100 mm² culture plates before transfection. The transfection reaction was performed by using Lipofectamine plus reagents (Invitrogen, California, USA) with 2 μg of each plasmid, pEGFP-C3, pEGFP-3CL^pro, and pEGFP-C145A according to the manufacturer's instructions. The cells were then cultured in serum-free DMEM for 12 hrs at 37°C in a 5% CO₂ incubator and subsequently in DMEM with 10% FBS.

EGFP, 3CL^pro and C145A transfected A549 cells were cultured on sterile cover slides for overnight and fixed by methanol. Samples were blocked with 10% blocking serum and incubated with 3CL^pro antibody (Abcam Inc., Cambridge, MA) and rhodamine conjugated second antibody (Invitrogen Corporation; Grand Island, NY) separately. Nuclei were stained with DAPI (4',6-diamidino-2-phenylindole, Sigma, St. Louis, MO). All transfected A549 cells were observed with a Zeiss Axioplan-2 epifluorescence microscope equipped with appropriate fluorescence filters. Digital images of the cells were recorded by using a spot camera system.

All studies were carried out in a designated PCR-clean area. After treatments at 12-72 hrs, cell pellets were washed in DPBS twice and treated with Trizol mRNA lysis buffer for total RNA extraction. All samples were analyzed by reverse transcriptase Multiplex PCR (RT-MPCR) with messageScreenTM Human Inflammatory Cytokine Set 1 Multiplex PCR kits (Biosource, International, Inc., CA, USA) for a temporal and spatial distribution of mRNA expression of different cytokines. This method is an accurate and valid system to detect multiple gene expression by amplifying all the genes under the same conditions. The PCR derived DNA fragments, obtained by 25 PCR cycles, and was subjected to electrophoresis in a 1.7% agarose gel. The cDNAs encoding human granulocyte-macrophage-colony-stimulating factor (GM-CSF) and GAPDH were amplified by RT-PCR using the following primer pairs: 5'-TGAGTAGAGACACTGCTGCTG-3' (forward primer for GM-CSF cDNAs), 5'-TCAAAGGGGATGACAAGCAGAA-3' (reverse primer for GM-CSF cDNAs), 5'-CATGTTCGTCATGGGTGTGA-3' (forward primer for GAPDH cDNAs), and 5'-AGTGAGCTTCCCGTTCAGCTC-3' (reverse primer for GAPDH cDNAs). The amplification was performed in a 50 μl reaction volume containing 1× reaction buffer (Promega, Madison, Wisconsin, USA), 1.5 μM of MgCl₂, 200 μM of dNTPs, 1 μM of each primer and 2.5 units of Taq DNA polymerase (Promega, Madison, Wisconsin, USA) using a Perkin-Elmer Gene Amp PCR system 2400. Each cycle consists of denaturation at 95°C for 1 min, annealing at 55°C for 45 sec, and amplification at 72°C for 45 sec. The RT-PCR derived DNA fragments obtained by 30 PCR cycles were subjected to electrophoresis on a 1.7% agarose gel. Following staining with ethidium bromide, the gels were photographed and band intensity was measured under UV light using the Alphaimager 2200 (Alphalnnotech, San Leandro, CA, USA). The specific RNA level of every sample was expressed as the product's intensity. cDNA encoding glyceraldehyde- 3-phosphate dehydrogenase (GAPDH) was quantified and used to normalize the expression of GA-CSF and each cytokine for each sample.

The quantification of cytokine levels from the cell culture mediums was performed by duplication using ELISA kits for GM-CSF (Biosource International, Inc, CA, USA), according to the manufacturer's instructions. In each case, the optical density of known standards was used to construct a calibration curve and the mean cytokine values ± SD were then calculated for each sample.

Statistical analysis was performed using the paired t-test. A P value less than 0.05 was considered significant. GraphPad Prism software v5.01 (GraphPad Software Inc., USA) was employed for the analysis of covariance by comparing linear regression lines. Because the slopes differ so much, it is not possible to test whether the intercepts differ significantly.

The 2-DE procedure was performed as described elsewhere with minor modification [38]. Briefly, 100 μg of protein was loaded onto IPG strips (18 cm, pH 3-10, GE Healthcare) for analytic 2-DE analysis. The IPG strips were subsequently rehydrated on the IPGphor IEF system (GE Healthcare, Uppsala, Sweden) at 20°C and 30 V for 14 h. Subsequently, IEF was conducted at 8000 V for 56 kVh for analytic analysis. Strips were then treated with equilibration buffer containing dithiothreitol (Sigma, St. Louis, MO) and then alkylated with iodoacetate (Sigma, St. Louis, MO) for 15 min. The IPG strips were transferred onto 10-18% linear gradient polyacrylamide gels (18×18 cm) and the electrophoresis was performed at 45 mA per gel at 4°C.

Proteins that had been resolved on 12.5% SDS-PAGE or 2-DE gels were electroblotted onto PVDF membranes using a semi-dry apparatus (GE Healthcare, Uppsala, Sweden). The membranes were blocked for 1 h with 5% non-fat milk and 0.1% Tween-20 in PBS, followed by incubation with primary antibody (3CL^pro, NF-kB, ERK1/2, JNK, p38, GAPDH, Abcam Inc., Cambridge, MA) for 2 h at room temperature. After washing three times with PBS containing 0.05% Tween-20 (PBST), the primary antibody was detected with an anti-rabbit horseradish peroxidase-conjugated secondary antibody (Abcam Inc., Cambridge, MA) for 1 h at room temperature. Signals were developed with an enhanced chemiluminescence western blotting detection system (PerkinElmer, Boston, MA,).