Background
Multiple sclerosis (MS) is a central nervous system (CNS) autoimmune disease with symptoms that include neurological impairment and motor deficits. MS results from immune attack on myelin, which leads to axonal and neuronal degeneration. A commonly used MS animal model is experimental autoimmune encephalomyelitis (EAE). EAE does not occur spontaneously, but does mimic some of the pathological and histological hallmarks of MS. During EAE, T cells recognizing components of myelin become activated, migrate to the CNS and cause autoimmune inflammation [
1], which results in CNS infiltration of CD4+, CD8+ T cells and B cells. The inflammatory process includes secretion of proinflammatory T helper1 (Th1) cytokines [
2] and an imbalance between Th1, T helper2 (Th2) and regulatory T cells [
3,
4]. When the ratio of Th1 to Th2 cells favors a predominantly Th2 profile, the proinflammatory properties of Th1 cytokines are countered and the severity of autoimmune diseases is alleviated [
5,
6]. Administration of soluble Tim-2, which is expressed preferentially by differentiated Th2 cells, to mice prior to EAE induction, results in Th2 cytokine overproduction and EAE symptom amelioration [
7]. Recently another subclass of Th cells, the Th17, have been shown to be involved in the modulation of EAE symptoms, acting primarily through the cytokine IL-17 [
8].
Microglia, which are macrophage-related cells resident in the CNS, play crucial roles in CNS injury [
9‐
11]. Tools to study microglial involvement include pharmacologic small molecules that stimulate or block their activation. Tuftsin (threonine-lysine-proline-arginine, TKPR) promotes phagocytic activity for cells of monocytic origin that express tuftsin receptors, such as neutrophils, macrophages and microglia [
12,
13]. Tuftsin-positive cells are recruited to sites of inflammation, and the avidity and specificity of tuftsin for its receptor are sufficiently strong to enable exploitation of tuftsin for imaging and therapeutic purposes [
14‐
16].
MIF (the tripeptide threonine-lysine-proline, tuftsin fragment 1–3, TKP) [
17] inhibits macrophage/microglial activation by an unknown mechanism. In retrograde retinal ganglion cell degeneration, MIF retards neuronal death, enhances axonal regeneration, and elicits morphological transformation of activated microglia into oval, less ramified shapes [
18]. MIF is an effective inhibitor of microglial activation and neurodegeneration in the mouse hippocampus during episodes of excitotoxicity [
19].
An endogenous factor that triggers microglial activation is the serine protease tPA, which converts plasminogen into plasmin. tPA activity increases ten-fold in MS lesions and MS patients' cerebrospinal fluid during the acute disease phase, but is not increased in chronic MS [
20,
21]. tPA mRNA and activity increase in mice over the course of EAE [
22]. tPA's binding partner, annexin II [
23] and the remainder of the plasminogen activation system [
24] are also upregulated in MS lesions.
tPA-deficient (tPA
-/-) mice display altered EAE course compared to wild-type mice [
22]. The onset of symptoms is delayed, indicating a contribution of tPA to the disease process; however, the extent of disease eventually exceeds that observed in wild-type mice and lasts longer, revealing an additional role for tPA in the recovery process. tPA is critical for neuropathology in other model systems such as excitotoxicity: tPA
-/- mice are less susceptible to glutamate-induced neurodegeneration in the hippocampus [
25]. Interestingly, early pharmacological blocking of AMPA/KA glutamate receptors results in EAE amelioration, indicating that glutamate-induced excitotoxicity contributes to EAE neurological malfunction [
26,
27]. Excitotoxicity is accompanied by microglial activation and further glutamate release. A component of the complex tPA role in EAE may include alterations in microglial dynamics, since tPA
-/- mice exhibit attenuated microglial activation [
25]. Supporting this hypothesis, active MS and EAE lesions are characterized by activated microglia [
28], which have been shown to promote neurodegeneration in systems that model ischemic episodes [
29].
In this study, we examine the consequences of altering the timing of macrophage/microglial activation during the course of EAE, and show that manipulating this pathway at the onset of clinical symptoms improves outcome, potentially by promoting a bias towards a Th2 phenotype.
Discussion and conclusion
The data presented n the current study indicate that administration of macrophage/microglial modulators at different points during the course of EAE can dramatically affect the outcome of the disease. We used 4 different modalities for modifying macrophage/microglial activation in MOG-injected wild-type mice, of which three resulted in improved EAE clinical scores. MIF treatment as EAE symptoms start, or tuftsin treatment either before or at the time of symptom onset were effective, whereas pre-treatment with MIF was of limited benefit. The complexity of the disease does not readily allow us to offer a direct explanation of the molecular events that underlie the differences in disease outcome with the various modalities of manipulations of microglial activation. One correlation that connects the three successful modalities is the observation of a balanced T cell response with a predominance of a Th2 fate for the activated T cells (Fig.
7). Another factor that could come into play is the requirement for macrophages/microglia to migrate to local sites of injury. The MIF macrophage/microglial inhibitor may block migration more effectively than morphological activation (Fig.
1), which could still confer a (modestly) beneficial outcome, and accelerated activation by tuftsin might lead to in situ morphological activation of the macrophages/microglia than the usual chemotactic migration and proliferation followed by local morphological activation. This model would provide an explanation for why fewer activated macrophages/microglia are observed after tuftsin treatment in the areas of interest. Additional possibilities are discussed below. Regardless, however, the benefit of the intervention is clear.
In our previous work, we found that mice deficient in tPA exhibit an altered progression of EAE symptoms that included the timing of clinical disease onset and the recovery from disease [
22]. As these mice have attenuated microglial activation, we explored the question here of whether it was this deficiency that was driving the altered EAE response by systemically delivering modulators of macrophage/microglial activation and evaluating their effect on the progression of EAE. Although using systemic delivery is most relevant clinically, one concern about it is whether the administered compounds reached the CNS in therapeutic levels. Our data indicate that the compounds delivered affected the status of cells in the CNS. Furthermore, when administering MIF/TUF prior to the induction of EAE, we observed in some cases dramatic effects very early on (for example in the case of tuftsin delivery at day-1 in tPA-deficient animals), ostensibly before efficient BBB breakdown.
Many treatments for MS have focused on controlling blood-brain barrier permeability; inflammation is linked to the opening of the blood-brain barrier, since it allows infiltration of inflammatory cells into the CNS. Activated microglia release cytokines and chemokines that draw and activate leukocytes via the compromised blood-brain barrier [
35]. Numerous agents have been used that are either anti-inflammatory themselves, or increase the secretion of anti-inflammatory cytokines and decrease that of pro-inflammatory cytokines [
36].
The activation process of the endogenous microglia, which converts them from resting ramified cells to immunocompetent inflammatory ones, is associated with antigen presentation, myelin and tissue breakdown, production of reactive oxygen and nitrogen species and pro-inflammatory cytokines [
37,
38]. In the absence of activation, such as in the presence of an activation inhibitor like MIF, microglia are unable to mediate these effects [
18]. The inhibition of microglial activation could thus be responsible for the diminished demyelination observed in the MIF-infused mice.
It is possible, on the other hand, that demyelination does occur in the MIF-infused mice, albeit to a lower degree. However, any myelin debris that is present might fail to be cleared due to the absence of activated macrophages/microglia. Consistent with this possibility, Luxol Fast Blue would stain degradation products of myelin lipoproteins that have not been phagocytosed by the inactivated macrophages/microglia, thus explaining the increased LFB staining despite the parallel symptomatology of MIF-infused and PBS-infused wt mice. Therapeutic (day 7) administration of MIF severely abrogated EAE symptoms. Therefore, the timing of macrophage/microglial inhibition could therefore be crucial to the outcome of the disease. The absence of activated microglia at the onset of the disease appears to have a beneficial effect.
Prophylactic activation of macrophages/microglia in tPA-deficient mice, which normally exhibit attenuated microglial activation [
22], resulted in early onset of symptoms at day 3 that persisted for the duration of the experiment. Shaked
et al., have shown in a model of optic nerve crush injury that earlier onset of phagocytic activity and antigen presentation by microglia results in resistance to injury and neuronal survival [
9]. It is possible that early activation of microglia could have ameliorated EAE in a similar manner, by recruiting and interacting with the adaptive immune response rather than worsening it, potentially inducing protective autoimmunity.
Studies on protective autoimmunity have found that systemic T-cell responses are triggered by injury to CNS axons. The absence of mature T cells in some mouse strains results in impaired CNS recovery [
39]. Thus early activation of microglia may have ameliorated the disease by presenting antigen to T helper cells and subsequently coordinating the resulting adaptive immune response. As suggested by Shaked
et al, the balance between protective autoimmunity and autoimmune disease may be determined by the timing and intensity of microglial activation and initial immune response [
9]. The Th2, anti-inflammatory switch that is evident in tPA-deficient mice after use of tuftsin provides further support to the idea that tuftsin may promote protective autoimmunity.
The protection conferred by early microglial activation diminished when the activation was delayed. Tuftsin administration at day 7 in tPA
-/- mice resulted in a very similar EAE course to that of PBS-infused mice. The therapeutic window for protection may be suboptimal when microglia are activated late, as demonstrated by Shaked
et al. [
9].
Our attempts to activate prematurely and in a sustained manner wild-type microglia did not always result in greater macrophage/microglial activation. In wt mice infused with tuftsin at d-1, greater levels of macrophage/microglial activation were observed at day 12 in comparison to wt PBS mice. However, when macrophage/microglial activation in wt PBS mice is detectable, at day 23 and day 30, the activation mediated by tuftsin seems to be reversed and fewer activated macrophages/microglia are observed (Fig
3C). This result suggests that there may be a control mechanism that does not allow sustained superactivation of macrophages/microglia. Despite the increased reaction however, the EAE symptoms are dampened. It is possible that macrophage/microglial activation during the induction phase of EAE once again acts to protect (precondition) against the disease. Once macrophage/microglial activation is induced normally by the disease process, tuftsin is no longer effective, potentially due to inability to superactivate the cells. In that case, the therapeutic window has already been exploited in the early stages.
Tuftsin infusion in wild-type mice at the onset of disease did not result in exaggerated macrophage/microglial activation at any timepoint (Fig
4C). Despite this result however, the disease course was severely abrogated. It is possible that premature activation of macrophage/microglial cells resulted in a paradoxical dampening of activation and reduced EAE intensity because of loss of antigen presentation, myelin and tissue breakdown, reactive oxygen species and pro-inflammatory cytokines, as mentioned above.
One explanation for the efficacy of MIF and tuftsin is that they both act eventually as anti-inflammatory agents, as they both can function as ACE inhibitors. Therefore in the context of EAE this function could result in reduction of inflammation and limited infiltration of immune cells from the systemic circulation [
31]. Indeed, in a model of heart failure, it has been shown that ACE inhibitors reduce the ratio of Th1 cytokines to Th2 cytokines, which is indicative of a switch away from inflammation [
40]. Furthermore, it has been shown that use of an ACE inhibitor, captopril, has a beneficial effect on EAE in Lewis rats [
32]. On the other hand, while it is true that MIF and tuftsin may be acting as ACE inhibitors/anti-inflammatory agents, this is not universally true, as shown in Figs.
1 and
4, where although the two compounds are delivered, there is little change in EAE severity.
As the first line of defense in the CNS, microglia are critical determinants of the outcome of local injury. The timing and intensity of macrophage/microglial activation appear to be crucial to the course of the disease. Whether this effect is mediated by the interplay with T cells of the adaptive immune response and/or by modulation of inflammation, this study suggests that careful modulation of macrophage/microglial activation may be a viable therapeutic approach.
Methods
All work with mice was approved by the Department of Laboratory Animal Resources at the State University of New York at Stony Brook. Mice were maintained under pathogen-free conditions at 21°C under a 12-hour light/dark cycle. Access to food and water was ad libitum.
Induction of EAE
EAE was actively induced using myelin oligodendrocyte glycoprotein (MOG) 35–55 (MEVGWYRSPFSRVVHLYRNGK), as previously described [
22,
41]. MOG 35–55 was synthesized by Quality Controlled Biochemicals and purified using reverse-phase (C18) HPLC (QCB, Biosource, MA).
MOG35-55 (300 ug) was thoroughly homogenized with Freund's Adjuvant (Sigma, St. Louis, MO) containing 500 ug mycobacterium tuberculosis (Difco, Detroit, MI). This emulsion (200 ul) was injected into the flank of female mice (wild-type and tPA-/-), aged 6–10 weeks (day 0) along with 500 ng of pertussis toxin (List Biological Laboratories, Campbell, CA), which was injected ip in a volume of 200 ul. Two days later (day 2), the pertussis toxin was injected for a second time. On day 7, a second MOG injection was given in the opposite flank.
Evaluation of EAE symptoms
An experimenter blinded to treatment conditions and genotypes monitored behavioral symptoms and weighed the animals daily. Symptom severity was assessed on a scale of 0 to 5 with intermediate scores being denoted by graduations of 0.5. The scale is as follows: 0, no symptoms; 1, loss of tail tone; 2, wobbly gait; 3, hindlimb paralysis; 4, forelimb paralysis; 5, moribund or dead [
42].
Time-controlled drug delivery
Alzet miniosmotic pumps (Durect, Cupertino, CA) were used to ensure time-controlled compound delivery. 14-day pumps (rate of infusion 0.5 ul/hr, 200 ul total volume) were filled with either PBS, 500 uM MIF (Sigma, St. Louis, MO) or 500 uM tuftsin (American Peptide Company, Sunnyvale, CA) and incubated overnight at 37°C, according to manufacturer's instructions.
Adult wild-type and tPA-/- female mice (6–10 weeks old) were deeply anesthetized using i.p. atropine (0.6 mg/kg body weight) and 2.5% avertin (0.02 ml/g body weight). Pumps were implanted subcutaneously in the back of the animal for 14 days. Pumps were replaced at d14 with fresh 14-day pumps and were maintained for the duration of the experiment. The pumps containing PBS were implanted at the same time as the respective MIF and tuftsin pumps.
In early control experiments we confirmed that placement of a PBS pump either prior to (day -1) or after (day 7) EAE induction did not alter the course of disease. Therefore, all data for wild-type mice or tPA-/- mice infused with PBS were pooled together from 4 independent experiments. Importantly, wt- or tPA-/--PBS mice were used in every single experiment and ran as controls side-by-side with the experimental groups.
Immunohistochemistry and histological stains
Spinal cords were harvested from mice at various timepoints over the course of the disease, and were fixed in 4% paraformaldehyde and 20% sucrose in PBS. The spinal cords were divided in three equal sections. The sections of each spinal cord were embedded in Tissue-Tek (Miles, Elkhart, IN) optimal cutting temperature compound, frozen on dry ice, and stored at -80°C until use. Coronal sections were obtained using a cryostat (Leica, Nussloch, Germany) and mounted onto slides (Superfrost Plus, Fisher Scientific), such that all three initial sections were represented. Slides were stored at -80°C until use.
After inhibiting endogenous peroxidase activity using 0.3% hydrogen peroxide, sections were blocked with serum overnight. F4/80, an antibody revealing macrophages/microglia, at 1:100 (Serotec, Raleigh, NC), was added to the sections for 1 hr at room temperature [
43]. The sections were incubated with secondary antibody (Vector Labs) for 1 hour at room temperature, the ABC reagent (Vector Laboratories, Burlingame, CA) was added and diaminobenzidine was applied for visualization of the avidin-biotin complex [
29]. Slides were then successively dehydrated, dipped in xylene and then coverslipped using Permount (Fisher Scientific, Pittsburgh, PA). In addition to F4/80 other markers were also used to visualizing the status of microglial activation, such as Isolectin B4, Iba1, and 5-D-4 (data not shown).
To evaluate the levels of myelination of individual sections, slides were dehydrated and incubated overnight at 56°C in 0.1% Luxol Fast Blue (Sigma, St. Louis, MO) in 95% ethanol and glacial acetic acid. The slides were then rinsed in 95% ethanol and distilled water and differentiated successively in 0.1% lithium carbonate and 70% ethanol. After dehydration and xylene treatment, the slides were coverslipped using Permount. The intensity of LFB labeling was quantified on multiple sections in each animal and was averaged and plotted.
Angiotensin Converting Enzyme (ACE) assay
For the standard curve, varying volumes of 0.1 units/ml of ACE were incubated with 200 ul of 6.25 mM hyppuric acid (substrate) in 125 mM borate buffer. To test for inhibition of ACE activity, varying volumes of 0.5 mM MIF or Tuftsin were preincubated for 1 hour at room temperature before adding 200 ul of substrate. All samples were incubated with substrate for 90 minutes at 37°C in glass test tubes. The reaction was stopped by addition of 250 ul of 20 mM EDTA in borate buffer. 2 ml of borate buffer and 1.5 ml of 160 mM cyanuric chloride (resuspended in spectrophotometric grade Dioxane) were added. Tubes were centrifuged for 10 minutes at 6000×g. Absorbance of supernatants was read in a spectrophotometer at 405 nm against distilled water [
44].
T-bet and Gata-3 quantitative RT-PCR
RNA was extracted from spinal cord homogenates using Trizol (Invitrogen, CA). cDNA was synthesized using SuperScript™ II Reverse Transcriptase (Invitrogen, CA) as per the recommended protocol. Two μl of the diluted cDNA was used in a 20-μl realtime PCR reaction volume containing 3 mM MgCl2, 0.5 μM of each primer, and all other components as recommended by LightCycler® FastStart DNA Master SYBR Green I kit (Roche Applied Science). The reactions were performed on LightCycler® instrument (Roche Applied Science).
The primers used for PCR were:
T-bet (forward): GCCAGGGAACCGCTTATATG
T-bet (reverse): TCCCCCAAGCAGTTGACAGT
GATA3 (forward): CTGACTATGAAGAAAGAAGGCATCCAG
GATA3 (reverse): AAGTAGAAGGGGTCGGAGGAACTCT
β-Actin (forward): GGCCACTGCCGCATCCTCTT
β-Actin (reverse): AGAGCCTCAGGGCATCGGAAC
The PCR program for T-bet was 95°C for 10 min, then 40 cycles at 95°C (10 s), 62°C (5 s), and 72°C (20 s), followed by the standard melting curve. The PCR program for GATA3 was 95°C for 10 min, then 40 cycles at 95°C (10 s), 58°C (5 s), and 72°C (20 s), followed by the standard melting curve. The PCR program for β-Actin was 95°C for 10 min, then 45 cycles at 95°C (10 s), 65°C (5 s), and 72°C (5 s), followed by the standard melting curve.
Statistics
All EAE graphs were analyzed using GraphPad Prism. The Wilcoxon test for nonparametric data was performed to compare differences between drug treatment and PBS EAE. Statistical analysis was done for three EAE parameters: onset, severity and recovery. Timepoints for analysis were chosen based on first and last day of each of the parameters for all mice in a set. Student's T-tests were performed to compare myelination levels between the control and experimental group at each timepoint. P values are listed on the relevant graphs.
Authors' contributions
MB performed the EAE experiments (monitoring behavioral scores and weight of animals) and the ACE experiments, statistical analysis and wrote the first draft of the manuscript. MW assisted in the EAE experiments, did F4/80 and CD3 immunostainings, LFB stainings and quantifications and the real-time PCR experiments. SET designed experiments, analyzed results, finished the writing of the manuscript, oversaw the project. All authors read and approved the final manuscript.