Background
Gastric cancer is the second leading cause of cancer death, and is the most common gastrointestinal malignancy in East Asia, Eastern Europe, and parts of Central and South America [
1]. Although the majority of the patients at an early stage of gastric carcinoma can be cured by surgery, more than half of those at an advanced stage of the disease die of carcinoma recurrence, even after undergoing curative gastrectomy [
2]. Therefore, better understanding of the pathogenesis and identification of the molecular alterations is essential for the development of useful indicators that aid novel effective therapies for gastric cancer [
3‐
5].
It is well known that protein-coding genes account for only 2% of the total genome, whereas the vast majority of the human genome can be transcripted into noncoding RNAs [
6‐
9]. Among them are long noncoding RNAs (lncRNAs), which are more than 200 nt in length with limited or no protein-coding capacity. LncRNAs are often expressed in a disease-, tissue- or developmental stage-specific manner making these molecules attractive therapeutic targets and pointing toward specific functions for lncRNAs in development and diseases, in particular human cancer [
10‐
13]. Multiple lines of evidence have revealed the contribution of lncRNAs as having oncogenic and tumor suppressor roles in tumorigenesis. A famous oncogenic lncRNA involved in tumor pathogenesis is known as HOTAIR (
Hox transcript antisense intergenic RNA), which has been consistently upregulated and identified as a strong prognosis marker of patient outcomes such as metastasis and patient survival in diverse human cancers. The studies also revealed that HOTAIR exerts its oncogenic functions via binding the PRC2 (polycomb repressive complex 2), which methylates histone H3 on K27 to promote gene repression [
14‐
16]. A similar mode of action is executed by the lncRNA ANRIL (
antisense non-coding RNA in the INK4 locus), a novel tumor suppressor interacting with the PRC2 complex to block the activity of
p15
INK4B
, a well-known tumor suppressor gene. Moreover, the depletion of ANRIL increases the expression of
p15
INK4B
and inhibits cellular proliferation tumorigenesis [
17]. Maternally expressed gene 3 (
meg3) also represents a tumor suppressor gene that encodes a MEG3 lncRNA
, which expression is lost in an expanding list of primary human tumors, and re-expression of MEG3 could induce cell growth arrest and promote cell apoptosis partly via the activation of P53 [
18]. Nevertheless, the overall pathophysiological contributions of lncRNAs to gastric cancer remain largely unknown.
In our current study, which seeks to determine the clinical significance and functions of dysregulated lncRNAs in gastric carcinogenesis, we investigated lncRNA GAS5 (Growth Arrest-Specific Transcript 5), which was previously shown to be consistently downregulated and identified as a tumor-suppressor lncRNA in prostate cancer cells, renal cell carcinoma cells and breast cancer cells [
19‐
21], though its functional significance has not yet been established. In this study, we demonstrated that decreased GAS5 expression was a characteristic molecular change in gastric cancer and investigated the effect of altered GAS5 level on the phenotypes of gastric cancer cells
in vitro and
in vivo. Then, we analyzed the potential relationship between this lncRNA level in tumor tissues and existing clinicopathological features of gastric cancer, as well as clinical outcome. Our findings suggest that lncRNA GAS5 may represent a novel indicator of poor prognosis in gastric cancer and may be a potential therapeutic target for diagnosis and gene therapy.
Methods
Tissue collection
89 gastric cancer samples were obtained from patients who had underwent surgery at Jiangsu province hospital between 2006 and 2008, and were diagnosed with gastric cancer (stages II, III, and IV; seventh edition of the
AJCC Cancer Staging Manual) based on histopathological evaluation. Clinical pathology information was available for all samples (Table
1). No local or systemic treatment was conducted in these patients before the operation. All specimens were immediately frozen in liquid nitrogen, and stored at -80°C until RNA extraction. The study was approved by the Research Ethics Committee of Nanjing Medical University, China. Informed consents were obtained from all patients.
Table 1
Clinicopathological characteristics and GAS5 expression in 89 patient samples of gastric cancer
Age (years)
| |
<50 | 46 (51.7) |
>50 | 43 (48.3.) |
Gender
| |
Male | 53 (59.6) |
Female | 36 (40.4) |
Location
| |
Distal | 36 (40.4) |
Middle | 35 (39.3) |
Proximal | 18 (20.2) |
Size
| |
>5 cm | 44 (49.4) |
<5 cm | 45 (50.6) |
Histologic differentiation
| |
Well | 6 (6.7) |
Moderately | 30 (33.7) |
Poorly | 43 (48.3) |
Undifferentiatedly | 10 (11.2) |
Invasion depth
| |
T1 | 21 (23.6) |
T2 | 26 (29.2) |
T3 | 23 (25.8) |
T4 | 19 (21.3) |
TNM Stages
| |
I | 15 (16.9) |
II | 34 (38.2) |
III | 35 (39.3) |
IV | 5 (5.6) |
Lymphatic metastasis
| |
Yes | 44 (49.4) |
No | 45 (50.6) |
Regional lymph nodes
| |
PN0 | 45 (50.6) |
PN1 | 16 (18.0) |
PN2 | 18 (20.2) |
PN3 | 10 (11.2) |
Distant metastasis
| |
Yes | 4 (4.5) |
No | 85 (95.5) |
Expression of GAS5
| |
Low expression | 44 (49.4) |
High expression | 45 (50.6) |
Cell lines and culture conditions
Five gastric cancer cell lines (SGC7901, BGC823, MGC803, MKN45, MKN28), and a normal gastric epithelium cell line (GES-1) were purchased from the Institute of Biochemistry and Cell Biology of the Chinese Academy of Sciences (Shanghai, China). Cells were cultured in RPMI 1640 or DMEM (GIBCO-BRL) medium supplemented with 10% fetal bovine serum (10% FBS), 100 U/ml penicillin, and 100 mg/ml streptomycin in humidified air at 37°C with 5% CO2.
RNA extraction and qRT-PCR analyses
Total RNA was extracted from tissues or cultured cells using TRIzol reagent (Invitrogen, Carlsbad, CA). For qRT-PCR, RNA was reverse transcribed to cDNA by using a Reverse Transcription Kit (Takara, Dalian, China). Real-time PCR analyses were performed with Power SYBR Green (Takara, Dalian China). Results were normalized to the expression of GAPDH. The PCR primers for GAS5 or GAPDH were as follows: GAS5 sense, 5’- CTTCTGGGCTCAAGTGATCCT-3’ and reverse, 5’- TTGTGCCATGAGACTCC ATCAG-3’; GAPDH sense, 5’-GTCAACGGATTTGGTCTGTATT-3’ and reverse, 5’-AGTCTTCTGGGTGGCAGTGAT-3’. qRT-PCR and data collection were performed on ABI 7500. The relative expression of GAS5 was calculated and normalized using the 2-ΔΔCt method relative to GAPDH.
Plasmid construct
To generate a GAS5 expression vector, the entire sequence of human GAS5 (NR_002578.2, 651 bp) was synthesized and subcloned into pCDNA3.1 vector with incorporate external NheI and BamHI sites, respectively (Invitrogen, Shanghai, China).
Transfection of gastric cancer cells
All plasmid vectors (pCDNA3.1-GAS5 and empty vector) for transfection were extracted by DNA Midiprep kit (Qiagen, Hilden, Germany). Gastric cells cultured in six-well plate were transfected with the pCDNA3.1-GAS5, empty vector, si-GAS5 or si-NC using Lipofectamine2000 (Invitrogen, Shanghai, China) according to the manufacturer’s instructions. Cells were harvested after 48 hours for qRT-PCR and western blot analyses. siRNAs for the human GAS5 (1#: 5’-CUUGCCUGGACCAGCUUAAUU-3’; 2#: CACCAUUUCAACUU CCAG CUUUCUG;3#: UACCCAAGCAAGUCAUCCAUGGAUA) and the negative control siRNA (5’-UUCUCCGAACGUGUCACGUUU-3’) were purchased from Invitrogen (Invitrogen, Carlsbad, CA).
Cell proliferation assays
A cell proliferation assay was performed with MTT kit (Sigma, St. Louis, Mo) according to the manufacturer's instruction. Viable cells were counted by trypan blue staining. For the colony formation assay, cells were placed into 6-well plate and maintained in media containing 10% FBS for 2 weeks. Colonies were fixed with methanol and stained with 0.1% crystal violet (Sigma, St. Louis, Mo). Visible colonies were manually counted.
Hoechst staining assay
SGC-7901 and BGC-823 cells transfected with pCDNA3.1-GAS5 or empty vector were cultured in six-well cell culture plates, and Hoechst 33342 (Sigma, St Louis, MO, USA) was added to the culture medium; changes in nuclear morphology were detected by fluorescence microscopy using a filter for Hoechst 33342 (365 nm). For quantification of Hoechst 33342 staining, the percentage of Hoechst-positive nuclei per optical field (at least 50 fields) was counted.
Western blot assay and antibodies
Cells protein lysates were separated by 10% SDS-polyacrylamide gel electrophoresis (SDS-PAGE), transferred to 0.22 μm NC membranes (Sigma) and incubated with specific antibodies. ECL chromogenic substrate was used to visualize the bands and the intensity of the bands was quantified by densitometry (Quantity One software; Bio-Rad, CA, USA). GAPDH antibody was used as control, Anti-E2F1, cyclinD1, P21 and cleaved caspase-3 (1:1000) were purchased from Cell Signaling Technology, Inc (CST).
4 weeks female athymic BALB/c nude mice were maintained under specific pathogen-free conditions and manipulated according to protocols approved by the Committee on the Ethics of Animal Experiments of the Nanjing medical University. SCG7901 cells transfected with pCDNA3.1-GAS5 or empty vector were harvested from six-well cell culture plates, washed with PBS, and resuspended at a concentration of 1 × 10
8 cells/mL. A volume of 100 μL of suspended cells was subcutaneously injected into a single side of the posterior flank of each mouse. The subcutaneous growth of tumor was examined every three days, and tumor volumes were calculated using the equation V = 0.5 × D × d
2 (V, volume; D, longitudinal diameter; d, latitudinal diameter) [
22]. At 18 days post injection, the mice were sacrificed and tumor weights were measured and also used for further analysis. This study was carried out in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health.
Statistical analysis
Statistical analysis was performed using the SPSS software package (version 20.0, SPSS Inc). Statistical significance was tested by a Student’s t-test or a Chi-square test as appropriate. Survival analysis was performed using the Kaplan-Meier method, and the log-rank test was used to compare the differences between patient groups.
Discussion
LncRNAs dysregulation may affect epigenetic information and provide a cellular growth advantage, resulting in progressive and uncontrolled tumor growth [
14‐
18]. Effective control of both cell survival and cell proliferation is critical to the prevention of oncogenesis and to successful cancer therapy. Therefore, identification of cancer-associated lncRNAs and investigation of their clinical significance and functions may provide a missing piece of the well-known oncogenic and tumor suppressor network puzzle.
GAS5 is a long ncRNA (~650 bases in humans) that was originally isolated from a screen for potential tumor suppressor genes expressed at high levels during growth arrest [
23]. Its encoding gene,
gas5, comprises 12 exons and encodes ten box C/D snoRNAs within its introns [
24]. Two mature GAS5 lncRNAs, GAS5a and GAS5b, have also been identified in humans due to the presence of alternative 5’-splice donor sites in exon 7, whereas GAS5b is the major isoform (NR_002578.2, 77 nt, simply called GAS5 in this study), and GAS5a has only 45 nt, missing 32 nt at the 3’ end [
25]. GAS5 has been shown to be aberrantly expressed in prostate cancer, renal cell carcinoma, breast cancer, head and neck squamous cell carcinoma (HNSCC), and glioblastoma multiforme [
19‐
21,
26]. For breast cancer and HNSCC, low GAS5 expression is an adverse prognostic factor for survival. Moreover, overexpression of GAS5 attributed to growth arrest of several cancer cell lines through regulation of apoptosis and cell cycle, under basal conditions or various cell death stimuli, including chemotherapeutic agents, suggesting its clinical significance in the development and therapy of cancer [
19‐
21]. These data demonstrate the potential tumor-suppressor role of GAS5; however, the relationship between expression of GAS5 and gastric cancer development and/or progression remains unclear.
Our studies were designed to investigate the expression and prognostic significance of GAS5 in patients with gastric cancer. GAS5 expression was retrospectively analyzed in 89 patients with gastric carcinoma. Results were assessed for association with clinical features and DFS/OS of gastric cancer patients after gastrectomy. Prognostic values of GAS5 expression and clinical outcomes were also evaluated by Cox regression analysis. The results showed that GAS5 expression was significantly decreased in gastric cancer tissues and cell lines. A lower expression of GAS5 was detected in tumor of larger size, higher tumor stage, deeper depth of invasion and more regional lymph nodes. In addition, the downregulation expression of GAS5 was associated with poor prognosis. Moreover, ectopic expression of GAS5 was demonstrated to decrease gastric cancer cell proliferation and induce apoptosis, while downregulation of endogenous GAS5 could promote cell proliferation in vitro and in vivo. Taken together, these findings indicate that GAS5 could function as a tumor suppressor via regulating cell growth and apoptosis, and may be useful in the development of novel prognostic or progression markers for gastric cancer.
Although GAS5 has been suggested to have a tumor-suppressive role, the underlying mechanism of GAS5-mediated gene expression having an impact on tumorigenesis is still elusive. Kino
et al. have found that GAS5 could structurally mimic the glucocorticoid receptor response element (GRE) to suppress GR-induced transcriptional activity of endogenous glucocorticoid- responsive genes [
25]. Zhang
et al. have provided a possible mechanism for GAS5 as a tumor suppressor, which may be attributed to its ability to suppress the oncogenic miR-21 in breast cancer [
27]. Nevertheless, since it’s highly possible that target genes of lncRNAs differ between specific tissues and cell types, specific target genes controlled by GAS5 for gastric pathogenesis remain unknown and deserve investigation. In this study, to explore the molecular mechanism by which GAS5 contributes to cell proliferation of gastric cancer, we investigated potential targets which were responsible for cell cycle arrest and cell growth inhibition. Our present experimental results confirmed that E2F1, as well as Cyclin D1, were functional targets of GAS5 in gastric cells. E2F1 expression has been found to be upregulated in mutiple cancers, and its overexpression contributes to many tumors development by acting as an important transcript factor regulating key regulator genes that controlling cell proliferation [
28,
29]. Cyclin D1 is one of the most important proteins to regulate cell cycle, and related with the development of many cancers. Cyclin D1 binds and activates CDK4/6, which subsequently phosphorylates tumor suppressor protein Rb and allows the cell cycle to progress through G1 into S [
30]. Furthermore, P21 expression has been shown to be reduced or lost in a variety of cancer types [
31]. A possible explanation is that P21 exerts its inhibitory control over the cell cycle primarily through direct binding to cyclins and CDKs, therefore preventing cell proliferation [
32]. Here, we also found P21 was a downstream regulator involved in GAS5-mediated growth arrest in gastric cancer cells. Taken together, these findings indicate that lncRNA GAS5 may function as a tumor suppressor and its deficiency or decreased expression could contribute to gastric cancer development; however, further studies are required to clarify GAS5 regulation of the above targets expression in gastric cancer cells.
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
SM, KR, DW and LXH were involved in the conception and design of the study. JFY, ZEBand LJH were involved in the provision of study material and patients. LYW, XR and XTP performed the data analysis and interpretation. SM wrote the manuscript. LXH and DW approved the final version. All authors read and approved the final manuscript.