Background
Hepatocellular carcinoma (HCC) is a common and aggressive cancer, with an increasing incidence globally, especially in China [
1]. Despite technical advances and improved surgical treatment, the rate of tumor recurrence and metastasis after curative resection remains high [
2,
3]. Exploring the molecular mechanisms underlying the initiation, progression and metastasis of HCC is vital as it may provide new therapeutic targets, leading to improvements in the long-term survival of patients with HCC [
4]. Although the genetic events responsible for HCC initiation and progression are not clear, they involve at least three carcinogenic pathways: the p53, NF-κB and transforming growth factor (TGF-β) signaling pathways [
5‐
7].
The TGF-β signaling pathway is particularly pertinent to the current study, as it is known to play a central role in tumorigenesis and tumor progression by regulating many critical cellular processes, including cell proliferation, apoptosis and epithelial-mesenchymal transition (EMT) [
7]. Furthermore, TGF-β has been shown to have a central role in the growth of hepatocytes [
8]. With regard to the progression of HCC, it has previously been shown in HCC cell lines, such as Hep3B, HepG2, PLC/PRF5, that TGF-β signaling triggers EMT [
9], characterized by lower E-cadherin expression and high vimentin expression in vitro [
10]. There is also convincing evidence that TGF-β signaling can induce EMT in mouse hepatocytes
in vitro [
11]. Subsequent studies revealed the mechanism to be the result of TGF-β-induced activation of the SNAIL transcription factor, a key mediator of EMT, and repression of epithelial markers, such as E-cadherin [
12]. The Smad protein family is known to play a key role in the TGF-β signaling, particularly Smad4, the ubiquitination of which is a key regulatory step in TGF-β signaling [
13]. Indeed, loss of inactivation of Smad4 has been linked with multiple cancers, including pancreatic, colorectal, and gastrointestinal cancers [
14‐
16].
Protein ubiquitination is a reversible, post-translational modification that regulates various aspects of cellular physiology, including protein degradation and cell signaling [
17]. Deubiquitinating enzymes (DUBs) are ubiquitin-specific proteases that can cleave ubiquitin from its substrate [
18]. Among approximately 100 DUBs encoded by the human genome, the ubiquitin-specific peptidase 9, X-linked (USP9X/FAM), is implicated in multiple physiological pathways [
19]. USP9X has been shown to regulate multiple cellular functions, and increased expression of USP9X in tumors is significantly associated with poor prognosis for patients with multiple myeloma [
20]. Numerous targets of USP9X have been identified so far, including AF-6, β -catenin, NUAK1, MARK4, ErbB2, EFA6, Smad4, Mcl1, ASK1 and survivin [
21].
Recently, microRNA (miRNA) mimics and anti-sense microRNAs have been focused on as potential therapeutics for HCC due to their stability and predominant uptake by the liver [
22]. MiRNAs bind to the 3′ untranslated region (UTR) to suppress translation of target genes [
23]. An increasing body of evidence indicates that miR-26b is downregulated in breast cancer [
24], nasopharyngeal carcinoma [
25], colorectal cancer [
26] and in hepatocellular carcinoma [
27]. miR-26b has also been associated with hepatocellular carcinoma development and worst outcome after liver cancer therapy [
28,
29]. However, to date, the role of miR-26b in hepatocellular carcinoma tumorigenesis and metastasis is incompletely understood.
The goal of the current study was to investigate the role of miR-26b in HCC. We found that the expression of miR-26b was decreased in HCC cells and tissues from HCC patients with advanced grades of disease. Mimicry of miR-26b in Huh7 and Hep3B cells resulted in diminished proliferation, migration and invasiveness, accompanied by a low expression level of USP9X. Further, we identified USP9X as a target of miR-26b, which was confirmed by luciferase analysis, Western blotting examination. Our study provides evidence that miR-26b acts as tumor suppressor in HCC, and is an important negative regulator of USP9X.
Methods
Human HCC tissue
Liver samples collected from patients with HCC and control liver samples were collected for research purposes, with the patient’s prior consent and approval from the Second Affiliated Hospital of Guangzhou Medical University and the Guangzhou Women and Children’s Medical Center.
Cell culture
The following human HCC cell lines were studied: HepG2, MHCC97H, Hep3B, MHCC97L, HCCC9810, BEL-7402, Huh7 and QGY-7703. All cells were grown in DMEM medium (Invitrogen, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (HyClone, Logan, Utah, USA) and 1% penicillin/streptomycin.
Manipulation of miR-26b expression levels
The miR-26b mimics, negative control (micrON™ miRNA Mimic Negative Controls and micrOFF™ miRNA Inhibitor Negtive Controls) and miR-26b inhibitor were purchased from RiboBio (Guangzhou, Guangdong, China). The final concentrations of transfection is 20 nM.
Construction of USP9X plasmids
The region of the human USP9X 3′-UTR, from 1041 to 1486 were generated by PCR amplification from DNA isolated from HepG2 cells. The amplified fragment was then cloned into the pEGFP-C1 (Clontech, Mountain View, CA, USA) and pGL3 vector (Promega, Madison, Wisconsin, USA). The primers selected were as follows: USP9X -3′UTR-GFP-up, 5′ CCGCTCGAGCCAGTGACGTGGAAGTCATC 3′; USP9X -3′UTR-GFP-dn, 5′ CGGGGTACCCACCACAGGACAAAAAGTTCTTC 3′; USP9X -3′UTR-luc-up, 5′ CGGGGTACCCCAGTGACGTGGAAGTCATC 3′; and USP9X -3′UTR-luc-dn, 5′ CCGCTCGAGCACCACAGGACAAAAAGTTCTTC 3′.
Cell transfections
Transfection of the plasmids, miRNA and miRNA inhibitor was performed using Lipofectamine 2000 (Invitrogen, Carlsbad, USA) according to the manufacturer’s instructions.
Western blotting
Cells were harvested in sampling buffer (62.5 mmol/L Tris-HCl [pH 6.8], 10% glycerol, 2% SDS) and heated for 5 min at 100°C. The concentration of extracted proteins was determined by the Bradford assay using a commercial kit (Bio-Rad, Berkeley, CA, USA ). Equal quantities of protein were separated by electrophoresis on 12% SDS/polyacrylamide gels and transferred onto polyvinylidene difluoride membranes (Roche, Indianapolis, Indiana, USA). The membranes were then probed with rabbit primary antibodies against USP9X(#5751S), E-cadherin(#9835S), Vimentin(#3877P) and GFP(#2955S) (Cell Signaling Technology, Danvers, Massachusetts, USA). The expression level of the target protein was determined with horseradish peroxidase-conjugated anti-rabbit/anti-mouse IgG (#31212/ #31160) and enhanced chemiluminescence (Pierce, Rockford, Illinois, USA), according to the manufacturer’s protocol. The membranes were stripped and reprobed with an anti-β-actin mouse monoclonal antibody (BOSTER, Wuhan, Hubei, China) to serve as a loading control.
RNA extraction and real-time quantitative PCR
Total miRNA from cultured cells and fresh surgical HCC tissues was extracted using the mirVana miRNA Isolation Kit (# AM1561, Ambion, Austin, Texas, USA), according to the manufacturer’s protocol. Complimentary DNA was synthesized from 5 ng of total RNA using the TaqMan miRNA reverse transcription kit (Applied Biosystems, Foster City, California, USA). The expression level of miR-26b was quantified using a miRNA-specific TaqMan MiRNA Assay Kit (Applied Biosystems), using an Applied Biosystems 7500 Sequence Detection system. The expression level of miRNA was defined based on the threshold cycle (Ct), and relative expression levels were calculated using the 2-ΔΔCt method, using the expression level of the U6 small nuclear RNA as a reference gene.
Cell migration assay
The migration assay was performed using a transwell chamber, consisting of 8 mm membrane filter inserts (Corning, New York, USA) coated with Matrigel (BD Biosciences, California, USA). Briefly, cells were trypsinized and suspended in serum-free medium. Next, 1.5 × 105 cells were added to the upper chamber, and the lower chamber was filled with medium containing 10% FBS. After 36 h incubation, cells that had invaded the lower chamber were fixed with 4% paraformaldehyde, stained with hematoxylin, and counted using a microscope.
Wound healing assay
The wound healing assay was performed using HepG2 and Huh7 cells. Cells were trypsinized and seeded in equal numbers into 6-well tissue culture plates, and allowed to grow until confluent (approximately 24 h). Following serum starvation for 24 h, an artificial homogenous wound (‘scratch’) was created onto the cell monolayer with a sterile 100 μL tip. After scratching, the cells were washed with serum-free medium, complete media was added, and microscopic images (20× magnification) of the cells were collected at 0, 12, and 24 h.
3D morphogenesis assay
Twenty-four-well dishes were coated with Growth Factor Reduced Matrigel (BD Biosciences, California, USA), and covered with growth medium supplemented with 2% Matrigel. Cells were trypsinized and seeded at a density of 104 cells/well. The medium was replaced with 2% Matrigel every 3 to 4 days and microscopic images (20× magnification) were captured at 2 day intervals for 2 to 3 weeks.
Dual luciferase reporter assay
Cells (3.5 × 104) were seeded in triplicate in 24-well plates and allowed to settle over 24 h. Next, 100 ng of pGL3-USP9X-3′UTR (wt/mut), or control-luciferase plasmid plus 1 ng of pRL-TK renilla plasmid (# E2810. Promega, Madison, Wisconsin, USA) were transfected into the cells using Lipofectamine 2000 (Invitrogen Co., Carlsbad, California, USA), according to the manufacturer’s recommendations. Luciferase and renilla signals were measured 48 h after transfection using the Dual Luciferase Reporter Assay Kit (Promega, Madison, Wisconsin, USA), according to the manufacturer’s protocol. Three independent experiments were performed and the data are presented as the mean ± SD.
Statistical analysis
A two-tailed Student’s t-test was used to evaluate the statistical significance of the differences between two groups of data in all pertinent experiments. A P-value less than 0.05 was considered to be statistically significant. All statistical analyses were performed using the SPSS 13.0 (IBM) statistical software package.
Microscopy
The microscopy we have used as:
Zeiss Axio Imager A1——Zeiss, Oberkochen, Germany
Zeiss Axiovert 40c——Zeiss, Oberkochen, Germany
Axiovert 200——Zeis, Oberkochen, Germany
Discussion
The goal of the current study was to investigate the role of miR-26b in EMT and the metastasis of HCC. During EMT, polarized epithelial cells acquire a mesenchymal phenotype; in the context of cancer, this transformation is associated with tumor invasiveness, metastasis, and resistance to chemotherapy [
5,
7,
23,
24]. A number of cytokines and growth factors are known to be induced during EMT, which amplifies the EMT program and promotes cell migration. These factors include the cytokines TGF-β, Wnt, Notch ligands, interleukin-like EMT-inducers [
6], hepatocyte growth factor [
8], epidermal growth factor [
30] and platelet-derived growth factor [
31].
The levels of transcription factors driving EMT are controlled by miRNAs [
33]. While miR-26a and miR-26b have been reported can regulate the NF-κB, TGF-β signal pathways [
34]. And miR-26b was downregulated in hepatic tumors, as compared to paired noncancerous tissue [
35]. Similarly, patients whose tumors had low miR-26 expression had a shorter survival time, although they were more likely to respond to interferon-α than patients whose tumors had high miR-26 expression [
28]. Several studies have confirmed that miR-26a and miR-26b are downregulated in NPC (nasopharyngeal carcinoma) [
36], CRC (colorectal cancer) [
37]. Mechanistically, miR-26 is thought to be growth suppressive; it has been shown that miR-26b acts through c-myc to block the G1/S transition [
19].
The role of TGFβ in EMT, tumor invasiveness and metastasis has been firmly established by in vitro and in vivo studies [
8,
32]. Interestingly, TGF-β-induced activation of Smad complexes (particularly Smad3 and 4) have been shown to play a crucial role during the induction of EMT [
32‐
35]. Ubiquitination of Smad4 is known to be a key regulatory step in the TGF-β signaling pathway, leading to the identification of the DUB USP9X as a required factor for Smad activity [
30,
32,
37]. In mammalian cells and Xenopus embryos, USP9X sustains both TGF-β and BMP signaling by deubiquitinating Smad4 and counteracting the inhibitory activity of Ecto/Tif1-c [
32]. Here, we identified USP9X as a novel target of miR-26b, such that miR-26b interacted with the 3′-UTR of USP9X to suppress its expression, with resultant effects on Smad4 expression and the TGF-β signaling pathway.
There is usually an inverse relationship between the expression level of a particular miRNA and its target [
31]
. Our conclusion that USP9X is a novel target gene of miR-26b is supported by several pieces of evidence: (1) the 3′-UTR of both human and murine USP9X mRNA contains a putative miR-26b binding site; (2) miR-26b suppresses the activity of a luciferase reporter gene fused with the 3′-UTR of USP9X mRNA, which is dependent on the miR-26b binding sequence; (3) miR-26b represses the endogenous expression of human/murine USP9X at both the mRNA and protein level. Our follow-up studies indicated that the ability of miR-26b to inhibit cancer cell invasion was mediated through its ability to downregulate USP9X expression.
USP9X was previously reported to regulate Smad4 transcriptional activity positively, thus we hypothesized that decreased USP9X expression would attenuate Smad4 function and TGF-β responsiveness in HCC cell lines [
38]. Our data demonstrate that transfection with a miR-26b mimic decreased Smad4 expression in both Huh7 and Hep3B cells, while transfection of a miR-26b inhibitor upregulated Smad4 expression. These results suggest that the effect of miR-26b on HCC cells may be mediated through Smad4, with a resultant effect on the TGF-β signaling pathway.
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
GS and YL carried out the molecular genetic studies, participated in the sequence alignment and drafted the manuscript. XY carried out the cell proliferation assays. JZ participated in immunoassays. ZX participated in the real-time PCR and immunoassays. HJ design of the study and performed the statistical analysis and helped to draft the manuscript. All authors read and approved the final manuscript.