Background
Methods
Patients and tumor specimens
Good responders | Poor responders | |
---|---|---|
Number of patients | 5 | 4 |
Mean age at diagnosis [95% IC] (years) | 14 [5-17] | 13.5 [13-16] |
Sex | ||
Male | 3 | 2 |
Female | 2 | 2 |
Tumor location | ||
Upper limb | 2 | 1 |
Lower limb | 3 | 3 |
Histological subtype | ||
Osteoblastic | 4 | 3 |
Osteoblastic and chondroblastic | 1 | 1 |
Mean tumor size [95% IC] (cm) | 12.5 [8-34] | 9 [6.7-25] |
Mean viable residual tumor cells [95% IC] (%) | 2.5 [1-4.5] | 25 [17-37] |
RNApreparation
SMART-Suppression Subtractive Hybridization (SMART: “switching mechanism at 5’ end of the RNA transcript”)
Cloning and analysis of subtracted clones
Quantitative Reverse Transcription Polymerase Chain Reaction (QRT-PCR)
Name gene | Oligo direct | Oligo reverse | PCR conditions | Cycle number | GeneInfo identifier |
---|---|---|---|---|---|
18S
| CTACCACATCCAAGGAAGGCA | TTTTTCGTCACTACCTCCCCG | 95°C 15 sec | 35 | 124517659 |
67°C 30 sec | |||||
ERK1
| CTAAAGCCCTCCAACCTGCT | CAGCCCACAGACCAGATGT | 95°C 15 sec | 45 | 158138506 |
60°C 30 sec | |||||
STAT3
| AAAGTCAGGTTGCTGGTCAAA | TGCCGTTGTTGGATTCTTC | 95°C 15 sec | 45 | 76253927 |
60°C 30 sec |
Immunohistochemistry (IHC) on tissue microarray sections (TMA)
Data analysis
Results
Patients
Whole cohort | |
---|---|
Number of patients | 52 |
Age | |
Mean age at diagnosis [95% IC]a (years) | 17.4 [5;80] |
Sex | |
Male (%) | 34 (65.4) |
Female (%) | 18 (34.6) |
Histologic response | |
Good responders | 24 |
Poor responders | 28 |
Histological diagnosis and subtype | |
High-grade osteosarcomas of central “conventional” type | 52 |
Osteoblastic (%) | 38 (73) |
Chondroblastic (%) | 5 (9.5) |
Telangiectasic (%) | 3 (6) |
Fibroblastic (%) | 2 (4) |
Mixed subtypeb (%) | 4 (7.5) |
Identification of differentially expressed genes by SSH in PR
Gene title | Gene symbol | Chromosomal location |
---|---|---|
Actin, alpha 1, skeletal muscle | ACTA1 | chr1q42.13-q42.2 |
Actin, beta | ACTB | chr7p15-p12 |
Actin, gamma 1 | ACTG1 | chr17q25 |
Actinin, alpha 1 | ACTN1 | chr14q24.1-q24.2|14q24|14q22-q24 |
ADAM metallopeptidase with thrombospondin type 1 motif, 20 | ADAMTS20 | chr12q12 |
v-akt murine thymoma viral oncogene homolog 2 | AKT2 | chr19q13.1-q13.2 |
Ankyrin repeat domain 11 | ANKRD11 | chr16q24.3 |
Annexin A2 | ANXA2 | chr15q21-q22 |
AT rich interactive domain 4B (RBP1-like) | ARID4B | chr1q42.1-q43 |
Actin-related protein 2/3 complex, subunit 2, 34 kDa | ARPC2 | chr2q36.1 |
ATPase family, AAA domain containing 3A | ATAD3A | chr1p36.33 |
ATP synthase, H + transporting, mitochondrial F0 complex, subunit E///major facilitator superfamily domain containing 7 | ATP5I///MFSD7 | chr4p16.3 |
Bromo adjacent homology domain containing 1 | BAHD1 | chr15q15.1 |
Breast carcinoma amplified sequence 3 | BCAS3 | chr17q23 |
Branched chain aminotransferase 2, mitochondrial | BCAT2 | chr19q13 |
Chromosome 14 open reading frame 112 | C14orf112 | chr14q24.2 |
Chromosome 14 open reading frame 2 | C14orf2 | chr14q32.33 |
Chromosome 20 open reading frame 194 | C20orf194 | chr20p13 |
Cell adhesion molecule 1 | CADM1 | chr11q23.2 |
Coiled-coil domain containing 28B | CCDC28B | chr1p35.1 |
Chaperonin containing TCP1, subunit 8 (theta) | CCT8 | chr21q22.11 |
Cell division cycle 34 homolog (S. cerevisiae) | CDC34 | chr19p13.3 |
Cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4) | CDKN2C | chr1p32 |
Carbohydrate (chondroitin 4) sulfotransferase 11 | CHST11 | chr12q |
Creatine kinase, brain | CKB | chr14q32 |
CDC28 protein kinase regulatory subunit 1B | CKS1B | chr1q21.2 |
CLPTM1-like | CLPTM1L | chr5pter-p15.3 |
Cornifelin | CNFN | chr19q13.2 |
Collagen, type V, alpha 1 | COL5A1 | chr9q34.2-q34.3 |
Catechol-O-methyltransferase | COMT | chr22q11.21-q11.23|22q11.21 |
Cytochrome c oxidase subunit VIa polypeptide 1 | COX6A1 | chr12q24.2|12q24.2 |
Cytokine receptor-like factor 1 | CRLF1 | chr19p12 |
Chondroitin sulfate glucuronyltransferase | CSGlcA-T | chr7q36.1 |
Casein kinase 2, alpha prime polypeptide | CSNK2A2 | chr16q21 |
cutA divalent cation tolerance homolog (E. coli) | CUTA | chr6pter-p21.31 |
dodecenoyl-Coenzyme A delta isomerase (3,2 trans-enoyl-Coenzyme A isomerase) | DCI | chr16p13.3 |
Dicarbonyl/L-xylulose reductase | DCXR | chr17q25.3 |
DEAD (Asp-Glu-Ala-As) box polypeptide 19A | DDX19A | chr16q22.1 |
DEAD (Asp-Glu-Ala-As) box polypeptide 19B///DEAD (Asp-Glu-Ala-As) box polypeptide 19A | DDX19A///DDX19B | chr16q22.1 |
DEAD (Asp-Glu-Ala-Asp) box polypeptide 39 | DDX39 | chr19p13.12 |
Eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein) | EEF1D | chr8q24.3 |
Eukaryotic elongation factor-2 kinase | EEF2K | chr16p12.1 |
Eukaryotic translation initiation factor 3, subunit H | EIF3H | chr8q24.11 |
Eukaryotic translation initiation factor 4 gamma, 3 | EIF4G3 | chr1p36.12 |
Fas apoptotic inhibitory molecule 3 | FAIM3 | chr1q32.1 |
FK506 binding protein 7 | FKBP7 | chr2q31.2 |
Kappa-actin | FKSG30 | chr2q21.1 |
Flavin containing monooxygenase 5 | FMO5 | chr1q21.1 |
Fibronectin 1 | FN1 | chr2q34 |
FERM domain containing 5 | FRMD5 | chr15q15.3 |
Golgi SNAP receptor complex member 2 | GOSR2 | chr17q21 |
Glypican 1 | GPC1 | chr2q35-q37 |
G protein-coupled receptor 108 | GPR108 | chr19p13.3 |
Ribosomal protein L23a///similar to ribosomal protein L23A///ribosomal protein L23a-like | hCG_16001///hCG_2001000///RPL23A | chr17q11///chr17q23.2///chr3q26.1 |
v-Ha-ras Harvey rat sarcoma viral oncogene homolog | HRAS | chr11p15.5 |
Heparan sulfate proteoglycan 2 | HSPG2 | chr1p36.1-p34 |
Insulin-like growth factor 2 mRNA binding protein 3 | IGF2BP3 | chr7p11 |
Inositol(myo)-1(or 4)-monophosphatase 2 | IMPA2 | chr18p11.2 |
Integrator complex subunit 1 | INTS1 | chr7p22.3 |
Importin 11 | IPO11 | chr5q12.1 |
Jumonji domain containing 2C | JMJD2C | chr9p24.1 |
KIAA0999 protein | KIAA0999 | chr11q23.3 |
Laminin, alpha 4 | LAMA4 | chr6q21 |
Lectin, galactoside-binding, soluble, 1 (galectin 1) | LGALS1 | chr22q13.1 |
Lamin A/C | LMNA | chr1q21.2-q21.3 |
Ribosomal protein S16///similar to 40S ribosomal protein S16 | LOC441876///RPS16 | chr19q13.1///chr1p36.21 |
Leucine-rich repeat containing 28 | LRRC28 | chr15q26.3 |
Microtubule-associated protein 1S | MAP1S | chr19p13.11 |
Mitogen-activated protein kinase 3 | MAPK3 (ERK1) | chr16p11.2 |
Major facilitator superfamily domain containing 5 | MFSD5 | chr12q13.13 |
Mitochondrial ribosomal protein S7 | MRPS7 | chr17q25 |
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4, 9 kDa | NDUFA4 | chr7p21.3 |
NADH dehydrogenase (ubiquinone) Fe-S protein 7, 20 kDa (NADH-coenzyme Q reductase) | NDUFS7 | chr19p13.3 |
NADH dehydrogenase (ubiquinone) flavoprotein 1, 51 kDa | NDUFV1 | chr11q13 |
Nuclear factor I/C (CCAAT-binding transcription factor) | NFIC | chr19p13.3 |
NOL1/NOP2/Sun domain family, member 5 | NSUN5 | chr7q11.23 |
NOL1/NOP2/Sun domain family, member 5B | NSUN5B | chr7q11.23 |
NOL1/NOP2/Sun domain family, member 5C | NSUN5C | chr7q11.23 |
Nucleoporin 214 kDa | NUP214 | chr9q34.1 |
Nucleoporin 85 kDa | NUP85 | chr17q25.1 |
PDZ domain containing 2 | PDZD2 | chr5p13.3 |
Periplakin | PPL | chr16p13.3 |
Protein phosphatase 1, regulatory (inhibitor) subunit 12B | PPP1R12B | chr1q32.1 |
Protein phosphatase 2 (formerly 2A), regulatory subunit A, alpha isoform | PPP2R1A | chr19q13.33 |
Protein kinase C substrate 80 K-H | PRKCSH | chr19p13.2 |
Protein arginine methyltransferase 2 | PRMT2 | chr21q22.3 |
RNA binding protein, autoantigenic (hnRNP-associated with lethal yellow homolog (mouse)) | RALY | chr20q11.21-q11.23 |
RNA binding motif protein 4 | RBM4 | chr11q13 |
RNA binding motif protein 4B | RBM4B | chr11q13 |
RNA binding motif protein 8A | RBM8A | chr1q12 |
Ribosomal protein L13 | RPL13 | chr16q24.3|17p11.2 |
Ribosomal protein L13a | RPL13A | chr19q13.3 |
Ribosomal protein L19 | RPL19 | chr17q11.2-q12 |
Ribosomal protein L23a | RPL23A | chr17q11 |
Ribosomal protein L31 | RPL31 | chr2q11.2 |
Ribosomal protein, large, P1 | RPLP1 | chr15q22 |
Ribosomal protein S12 | RPS12 | chr6q23.2 |
Ribosomal protein S14 | RPS14 | chr5q31-q33 |
Ribosomal protein S17 | RPS17 | chr15q |
Ribosomal protein S21 | RPS21 | chr20q13.3 |
Ribosomal protein S27 (metallopanstimulin 1) | RPS27 | chr1q21 |
Ribosomal protein S6 | RPS6 | chr9p21 |
RNA pseudouridylate synthase domain containing 4 | RPUSD4 | chr11q24.2 |
Ribosomal RNA processing 1 homolog B (S. cerevisiae) | RRP1B | chr21q22.3 |
Retinoid X receptor, alpha | RXRA | chr9q34.3 |
Synaptonemal complex protein SC65 | SC65 | chr17q21.2 |
Splicing factor, arginine/serine-rich 3 | SFRS3 | chr6p21 |
Serine hydroxymethyltransferase 2 (mitochondrial) | SHMT2 | chr12q12-q14 |
SIVA1, apoptosis-inducing factor | SIVA1 | chr14q32.33 |
SIVA1, apoptosis-inducing factor | SIVA1 | chr14q32.33 |
Solute carrier family 16, member 8 (monocarboxylic acid transporter 3) | SLC16A8 | chr22q12.3-q13.2 |
Solute carrier family 20 (phosphate transporter), member 2 | SLC20A2 | chr8p12-p11 |
Small nuclear ribonucleoprotein D3 polypeptide 18 kDa | SNRPD3 | chr22q11.23 |
Signal transducer and activator of transcription 3 (acute-phase response factor) | STAT3 | chr17q21.31 |
Serine/threonine kinase 24 (STE20 homolog, yeast) | STK24 | chr13q31.2-q32.3 |
T-cell, immune regulator 1, ATPase, H + transporting, lysosomal V0 subunit A3 | TCIRG1 | chr11q13.2 |
Testis-specific kinase 1 | TESK1 | chr9p13 |
Thymosin, beta 10 | TMSB10 | chr2p11.2 |
Transportin 3 | TNPO3 | chr7q32.1 |
Tetraspanin 9 | TSPAN9 | chr12p13.33-p13.32 |
Ubiquitin A-52 residue ribosomal protein fusion product 1 | UBA52 | chr19p13.1-p12 |
Vacuolar protein sorting 28 homolog (S. cerevisiae) | VPS28 | chr8q24.3 |
Williams-Beuren syndrome chromosome region 16 | WBSCR16 | chr7q11.23 |
WW domain containing oxidoreductase | WWOX | chr16q23.3-q24.1 |
X antigen family, member 1D///X antigen family, member 1C///X antigen family, member 1E///X antigen family, member 1///X antigen family, member 1B | XAGE1///XAGE1B///XAGE1C///XAGE1D///XAGE1E | chrXp11.22 |
Zinc finger protein 449 | ZNF449 | chrXq26.3 |
QRT-PCR validation of selected genes expressed in PR versus GR by SSH
Validation at protein level using immunohistochemistry for pSTAT3 and pERK1 (Tables 5 and 6)
IHC score | Good responders | Poor responders | p-value | |
---|---|---|---|---|
Phosphorylated STAT3 | 0 or 1 | 16 | 9 | 0.036 |
2 or 3 | 6 | 14 | ||
VPP(PR) = 14/20 = 70%/VPN(GR) = 16/25 = 64% | ||||
Phosphorylated ERK1 | 0 or 1 | 17 | 8 | 0.007 |
2 or 3 | 5 | 15 | ||
VPP(PR) = 15/20 = 75%/VPN(GR) = 17/25 = 68% | ||||
Phosphorylated STAT3 and ERK1 | Both 0-1 | 12 | 4 | 0.003 |
Intermediate | 8 | 7 | ||
Both 2-3 | 1 | 10 | ||
VPP(both/PR) = 10/11 = 91%/VPN(both/GR) = 12/16 = 75% |
IHC score | Good responders | Poor responders | p-value | |
---|---|---|---|---|
Phosphorylated STAT3 | 0 or 1 | 13 | 12 | 0.013 |
2 or 3 | 3 | 17 | ||
VPP(PR) = 17/20 = 85%/VPN(GR) = 13/25 = 52% | ||||
Phosphorylated ERK1 | 0 or 1 | 13 | 12 | 0.035 |
2 or 3 | 4 | 16 | ||
VPP(PR) = 16/20 = 80%/VPN(GR) = 13/25 = 52% | ||||
Phosphorylated STAT3 and ERK1 | Both 0-1 | 11 | 5 | 0.007 |
Intermediate | 5 | 10 | ||
Both 2-3 | 1 | 10 | ||
VPP(both/PR) = 10/11 = 91%/VPN(both/GR) = 11/16 = 69% |