MicroRNA-27a promotes proliferation and suppresses apoptosis by targeting PLK2in laryngeal carcinoma

Tissue specimens (tumor tissue and paired adjacent tissue) from 67 LSCC patients were used in the study. All of the patients provided written informed consent, and approval for the study was received from the Ethics Committee of China Medical University. Verification of the specimens was performed by a pathologist and the samples were immediately frozen at -80°C after been removed from the patients. The human Hep2 (laryngeal cancer) and HEK293 (embryonic kidney) cell lines were obtained from the Cell Biology Institute of Shanghai, Chinese Academy of Science and were maintained in RPMI 1640 (GIBCO, Los Angeles, CA) with 10% fetal bovine serum (Hyclone, Logan, USA), 100 units/ml penicillin and 100 μg/ml streptomycin in a humidified atmosphere at 37°C in 5% CO₂.

Cell-based experiments were carried out by transfection of 20nM miRNA duplex (GenePharma, Shanghai, China), non-relative control RNA duplex (NC duplex, GenePharma) and small interfering RNA (siRNA, GenePharma) into the Hep2 cells using Lipofectamine™ 2000 in accordance with the manufacturer’s procedure. The sequences of the corresponding small non-coding RNAs are as follows: miR-27a mimics: 5′-UUCACAGUGGCUAAGUUCCGC-3′; miR-27a inhibitor: 5′-GCGGAACUUAGCCACUGUGAA-3′, mimics NC: 5′-UUCUCCGAACGUGUCACGUTT-3′, inhibitor NC: 5′-CAGUACUUUUGUGUAGUACAA-3′, NC: 5′-GGCUACGUCCAGGAGCGCA CC-3′and siPLK2: 5′-CACAGAAGGAGAACGAUAUTT -3′.

Cells were transfected by the FAM-labeled miR-27. After cultured for 6 h, the cells were visualized by fluorescence microscope (BX51TF, OLYMPUS, Japan) to evaluate the transfection efficency.

Total RNA was extracted from the specimens and the cells using Trizol (Takara, Dalian, China) according to the manufacturer’s instructions. MicroRNA was separated using a miRcute miRNA isolation kit (Tiangen, Bejing, China). The concentrations of small and total RNA were measured by reading the absorbance at OD260/280 nm.

To test the expression of miR-27a and PLK2 mRNA in the LSCC tissues and the cell lines, qRT-PCR was carried out using the ABI 7500 Real Time PCR system (Applied Biosystems, Foster City, CA, USA). For the mature miR-27a detection, reverse transcription and quantitative PCR were performed using the One Step PrimeScript miRNA cDNA Synthesis Kit (Takara, Dalian, China) and SYBR® Premix Ex Taq™ II (Takara, Dalian, China). U6 small nuclear RNA (snRNA) expression was assayed for normalization. A miR-27a specific primer and a universal reverse primer RTQ-UNIr were used for the amplification. Primer sequences for miR-27a and RTQ-UNIr are 5′-TTCACAGTGGCTAAGTTCCGC-3′ and 5′-CGAATTCTAGAGCTCGAGGCAGGCGA CATGGCTGGCTAGTTAAGCTTGGTACCGAGCTCGGATCCACTAGTCC (T)-3′, respectively. Primer sequences for U6 are as follows: F-5′-CTCGCTTCGGCAGCACA-3′, R-5′-AACGCTTCACGAATTTGCGT-3′. The PCR conditions for miR-27a and U6 snRNA are 95°C for 30 sec, followed by 40 cycles of 95°C for 5 sec and 60°C for 34 sec. To detect PLK2 mRNA, SYBR® Premix Ex Taq™ II (Takara, Dalian, China) was used. Primers for PLK2 are as follows: F-5′-TCAGCAACCCAGCAAACACAGG-3′ and R-5′-TTTCCAGACATCCCCGAAGAACC-3′. Primers for GAPDH are as follows: F-5′-TTGCTAGAGACCGAGTGTCC-3′ and R-5′-CTTTGTGGCTTTCTTCATGG-3′. The PCR conditions for the PLK2 and GAPDH are 95°C for 30 min, 40 cycles of 95°C for 5 sec and 60°C for 34 sec. ΔCt was calculated by subtracting the Ct of U6 or GAPDH mRNA from the Ct of the RNAs of the interest. ΔΔCt was then calculated by subtracting the ΔCt of the negative control from the ΔCt of the samples. The fold change in microRNA or mRNA was calculated according to the equation 3^-ΔΔCt.

For cell proliferation analysis, 2-3 × 10³ of the Hep2 cells after transfection were plated into 96-well plates. Cells were then cultured for 1, 2, 3, 4 and 5 days, respectively. The absorbance at 570 nm was measured after incubation of the cells with 100 μl sterile MTT dye (0.5 mg/ml, Sigma) for 4 h at 37°C and 150 μl DMSO for 15 min. Then the cell growth curve was constructed by using OD570 nm as ordinate axis.

In the colony formation assay, 3-5 × 10³ of the Hep2 cells at twelve hours after transfection were seeded in a 60-mm Petri dish in triplicate and maintained in RPMI 1640 (GIBCO, Los Angeles, CA) with 10% fetal bovine serum. After 14 days, the colonies were fixed with methanol for 30 min, stained with hematoxylin for 20 min, and scored using a microscope. Colony formation for each condition was calculated in relation to the values obtained for mock and the scramble-treated control cells.

Cells were grown in 6-well plates to about 60% confluence and transiently transfected with the desired miRNA and siRNA-PLK2 reagents. The cells were digested and collected after 48 h or 72 h post-transfection, and washed with PBS twice. For apoptosis detection, the cells were treated by Annexin V-EGFP Apoptosis Detection Kit according to the manufacturer’s instructions (KeyGEN, Nanjing, China). For cell cycle analysis, the cells were resuspended in PBS and then fixed in ethanol at -20°C for at least 12 hours. The cells were washed with PBS and resuspended again in staining solution (50 μg/mL of propidium iodide, 1 mg/mL of RNase A in PBS). After the treatment, the cells (1 × 10⁵) were then analyzed with a flow cytometer (FACS calibur, Becton-Dickinson, USA).

The prediction of PLK2 mRNA as a target of miR-27a was made with miRanda (http://​cbio.​mskcc.​org/​cgi-bin/​mirnaviewer/​mirnaviewer.​pl?​type=​miRanda), Pictar (http://​pictar.​mdc-berlin.​de/​) and TargetScan (http://​www.​targetscan.​org/​) programs. pGL3-PLK2-3′UTR and pGL3-PLK2-3′UTR-mut plasmids were obtained from GENECHEM (Shanghai, China). The HEK293 cells seeded in 96-well plate in triplicate were cotransfected with pGL3-PLK2-3′UTR or pGL3-PLK2-3′UTR-mut and miRNA-27a mimic or non-relative control RNA duplex (NC duplex, GenePharma) by using Lipofectamine™ 2000 in accordance with the manufacturer′s procedure. pRL-TK (Promega Corporation) was transfected as a normalization control. The cells were collected at 24 h after transfection and luciferase activity was measured using a dual-luciferase reporter assay kit (Promega Corporation) and recorded by Chemiluminescence meter (Promega Corporation).

Protein was extracted from the cells at 48 h after transfection and LSCC tissues using a protein extraction reagent (Beyotime, Shanghai, China) and protein concentration was measured using the BCA Protein Assay kit (Beyotime). 50 μg of the extracts were separated on 10% SDS-PAGE and transferred to PVDF membrane. The membrane was then blocked with 5% non-fat milk and incubated with anti-PLK2 antibody (1:500 dilution; Abcam, USA) followed by horseradish peroxidase-conjugated antibody (1:2000 dilution; ZhongShan, China). Detection was performed by enhanced chemi-luminescence (ECL) using a Western blotting immunological reagent (Santa Cruz Biotechnology) according to the manufacturer’s instructions. β-actin was used as a reference protein and determined following the same procedure as above.

Unless otherwise stated, each experiment was performed for a minimum of three times. Data were subjected to statistical analysis by SPSS 16.0 software and shown as mean ± standard error of the mean (SEM). A paired-samples T-test was used to analyze differences in miR-27a expression between LSCC tissues and paired adjacent tissues. Pearson’s product–moment correlation coefficient was used to assess the correlation between PLK2 protein and miR-27a levels in LSCC. The results of cell-based experiments were analyzed by an independent samples T-test and one-way ANOVA. P < 0.05 was considered statistically significant.

We explored the expression of miR-27a in LSCC by qRT-PCR in 67 paired of fresh LSCC tissues and the paired adjacent tissues. Amplification plot and dissociation curve of miR-27a showed that the qRT-PCR conditions were reliable (see Additional file 1: Figure S1A and B). As shown in Figure 1A, 65.7% (44/67) cases of cancer tissues showed high concentrations of miR-27a with respect to the paired controls. General expression level of miR-27a was significantly up-regulated in LSCC tissues compared to the paired counterparts (T-test, p < 0.05) (Figure 1B and C). Meanwhile, the expression level of miR-27a in the Hep2 cells was significantly increased compared to that in the HEK293 cells (Figure 1D). Together, these results suggest that miR-27a plays an important role in LSCC.

The Immunofluorescence result displayed that lots of cells were stained by fluorescent material (Figure 2A). As shown in Figure 2B, miR-27a mimic was significantly expressed in the Hep2 cells and its inhibitor significantly reduced miR-27a expression levels, suggesting that miR-27a mimics and miR-27a inhibitor have been successfully introduced into the cells and the following detection is credible. To assess the effect of miR-27a on cell growth, the MTT and colony formation assay were performed in the Hep2 cells after the corresponding transfection experiments. MTT assay results indicated that the cells transfected with miR-27a mimic showed significantly higher proliferation ability than those in the control groups, however the cells transfected with miR-27a inhibitor showed opposite effect on proliferation ability compared to those in the control groups, especially on day 4 and 5 after transfection (Figure 2C). The colony formation assay results displayed that the Hep2 cells transfected with miR-27a mimic showed much more and larger colonies compared to the control groups, but the cells transfected with miR-27a inhibitor revealed much fewer and smaller colonies compared to the controls (Figure 2D).

Flow cytometry assay results indicated that the significant increase in the early apoptosis was observed in the Hep2 cells transfected with the miR-27a inhibitor, whereas no significant alteration in early apoptosis was detected in the Hep2 cells transfected with miR-27a mimics (Figure 2E), the reason for which might be the abundant expression of internal miR-27a in the Hep2 cells (Figure 1D). As for the effect of miR-27a on the late apoptosis, the results displayed that miR-27a also significantly suppressed the late apoptosis of the Hep2 cells and its inhibitor rescued the effect significantly (Figure 2F). Meanwhile, no significant difference in the cell cycle of the Hep2 cells was observed either transfected with miR-27a mimic or its inhibitor (see Additional file 2: Figure S2), which indicates that miR-27a does not affect the cell cycle checkpoints of the Hep2 cells.

Based on the bioinformatics analysis using three different programs (miRanda, Pictar and targetscan), a highly-conserved miR-27a targeting sequence was predicted in the 3′-untranslated region of the PLK2 mRNA (Figure 3A; see Additional file 3: Figure S3), which suggests that PLK2 mRNA is a potential target of miR-27a. To confirm whether miR-27a directly targets the region of PLK2, dual luciferase reporter assays were carried out using the pGL3 construct in which PLK2 3′UTR fragment containing wild-type or mutant miR-27a binding sequence was cloned downstream of the firefly luciferase reporter gene (Figure 3A). As illustrated in Figure 3B, a significantly down-regulation on luciferase activity was found in the presence of miR-27a in the HEK293 cells cotranfected with pGL3-3′UTR of PLK2, but not with pGL3-3′UTR-mut. Western blot and real-time RT-PCR results indicated that miR-27a and its inhibitor significantly decreased and increased the PLK2 expression at protein level (Figure 3C and D), but not at mRNA level (see Additional file 4: Figure S4), respectively. Both PLK2 mRNA and protein levels were significantly lower in the Hep2 cells than those in the HEK293 cells (Figure 4A and B). In order to evaluate the relationship between miR-27a and PLK2 expression levels, we detected PLK2 protein level in 46 cases with miR-27a up-regulation by Western blot. As a result, 39 cases (70%) showed significant down-regulation of PLK2 in cancer tissues compared to the controls (Figure 4C and D). The statistical analysis result revealed that miR-27a level was negatively correlated with PLK2 protein level in laryngeal cancer tissues (r = -0.551 P < 0.05; Figure 4E). These results suggest that miR-27a negatively regulates PLK2 expression through the translational repression pathway.

To evaluate whether inhibition of PLK2 plays the similar role in the regulation of the proliferation and apoptosis as miR-27a does in the Hep2 cells, PLK2 were silenced by its siRNA and the effect on the proliferation and apoptosis was detected. As shown in Figure 5A and B, the PLK2 gene was significantly inhibited by its siRNA both at mRNA and protein levels in the Hep2 cells, respectively. The MTT and colony formation assay results showed that knockdown of PLK2 significantly promoted cell viability and colony formation compared to the control groups (Figure 5C and D). Flow cytometry assay results indicated that knockdown of PLK2 could significantly suppress the late apoptosis compared to the control groups (Figure 5F), but not the early apoptosis (see Additional file 5: Figure S5).