Background
Cathepsins are a large family of cysteinyl-, aspartyl- and serine-proteases composed of at least twelve different molecules, which are distinguished by their structure, catalytic mechanism, and substrate specificity [
1,
2]. They are normally found inside the cell and appear commonly sequestered in well-defined organelles, mainly lysosomes, as inactive proenzymes [
3]. When cathepsins are released outside the cell and activated, they trigger the degradation of the constituents of the extracellular matrix and basement membrane, such as type IV collagen, fibronectin, and laminin [
4]. Their proteolytic activity has been suggested as a key factor in determining the metastatic potential of cancer cells [
5]. Indeed, either cysteinyl- or aspartyl-proteases, by degrading the extracellular matrix, can directly contribute to cell migration and invasiveness, at least by dissolving the physical barriers limiting cell movements and spreading [for a review see [
6]]. Among the members of this family of proteases, cathepsins B, D, K and L are hypothesized to play a major role [
7,
8].
Cutaneous melanoma arises from melanocytes and represents the most aggressive form of skin cancer. As for other cancers, melanoma progression is believed to depend upon a series of increasing survival-oriented molecular alterations correlated with the capability to generate a more malignant phenotype. The ultimate result of this process is the development of cancer cell clones selected for their ability to survive in extremely unfavorable microenvironmental conditions and capable of overwhelm the lack of nutrients and the deficiency of metabolic products. Indeed, despite chemo- and radio-therapeutic treatments, these cells can deceive host's immune response, survive hypoxia, oxidative stress, induction of apoptosis, and ultimately develop a remarkable propensity for metastatic spreading, the most life-threatening event in melanoma patients [
9]. The key role of cathepsins in metastatic melanoma progression has been investigated in several experimental and clinical studies, where overexpression of cathepsins was associated with a worse prognosis and high cancer dissemination [
10‐
13].
In the present work we investigated in both in vitro and in vivo systems the effects of cathepsin B, D and L inhibitors, i.e. chemical and biological (e.g. antibodies) in modulating metastatic melanoma cells invasiveness. We found that, unlike cathepsins D and L, the inhibition of cathepsin B significantly impaired cell invasiveness and metastatic potential.
Materials and methods
Melanoma cell cultures and in vitro treatments
The HLA-A2 1B6 (indicated as PM1 throughout the paper) and 8863 (indicated as MM1 throughout the paper) melanoma cell lines were obtained as previously reported [
14‐
16]. The LP (PM2) cell line derived from a primary cutaneous melanoma (Clark's level V; Breslow 12 mm), while the LM cell line (MM2) from a supraclavicular lymph node metastasis of the same patient [
17]. Other human melanoma cells used (PM3 and PM4 and MM3) were obtained from melanomas (primary or metastatic, respectively) of patients surgically resected at the Istituto Nazionale dei Tumori, Milan, Italy. Human M20 melanoma cell line (MM4) was obtained as reported [
18]. All cell lines were cultivated at 37°C in 5% CO
2 atmosphere in RPMI-1640 supplemented with 50 U/ml penicillin, 50 mg/ml streptomycin (BioWhittaker, Verviers, Belgium) and 10% FCS (Sebam, Berlin, Germany). For cell migration and invasion assays, cells were seeded in the presence of the cathepsin D inhibitor (Pepstatin A, 100 μM, Calbiochem), the cathepsin L inhibitor (cathepsin L inhibitor II, Z-FY-CHO, 10 μM, Calbiochem) as well as two cathepsin B inhibitors: CA-074 (cell unpermeant) and CA-074Me (cell permeant) (both given at a concentration of 10 μM, Calbiochem, Nottingham, UK). Since these two inhibitors gave similar results, i.e. not-significant differences were detected in all the experimental conditions considered here, only the results obtained with the CA-074 will be reported. Cells treated with the same concentration of the solvent (DMSO) were considered as control. Alternatively to these synthetic inhibitors, cells were also incubated with specific antibodies to cathepsin B, D (both Calbiochem) or L (Alexis) (60 μg/ml). Cells treated with the same concentration of IgG were considered as control.
Relative quantification of procatepsin B gene expression by real-time RT-PCR
One-step quantitative RT-PCR analysis for procathepsin B and cyclophilin A expression was performed as described [
19]. Quantitative RT-PCR for cyclophilin A was carried out on each sample as an internal control for template levels.
Primer sequences for procathepsin B:
FW: 5'- GATCATGTGGCAGCTCTGGGCCTCCCTCTG -3';
RV: 5'- GTCTTAGATCTTTTCCCAGTACTGATCGG -3'.
Primer sequences for cyclophilin A:
FW: 5'-TGGTCAACCCCACCGTGTTC-3';
RV: 5'-GCCATCCAACCACTCAGTC-3'.
Primer sequences were obtained from the NCBI database (GenBank accession number E10341.1 and BC000689, respectively).The relative expression of human procathepsin B mRNA was calculated as described [
20].
Analysis of lysosomal compartment
For evaluation of lysosomal acidity and volume, cells were stained with 1 μM LysoSensor probe or LysoTracker probe, respectively for 5 min (LysoSensor) or 15 min (LysoTracker) at 37°C and immediately analyzed by a cytometer. Comparisons among different melanoma cell lines (either primary or metastatic) were conducted by CellQuest Software using the median values of fluorescence intensity histograms as previously described [
21].
Survival in acidic microenvironment
Primary and metastatic melanoma cell lines were seeded in RPMI 1640 with 10% FCS at pH values of 7.4 or 5.5, as previously described. The pH value of 5.5 was obtained by adding 2 N HCl to the RPMI 1640 culture medium [
21]. After 5 day in culture, cells were stained with 0.4% Trypan blue and analyzed by flow cytometry.
Expression of cathepsins B, D and L and cystatin C
Total amount of cathepsin B and D and L were evaluated by Western blot as previously reported [
22]. Cell surface cathepsin B and D and L were detected by flow cytometry in unfixed living cells stained with specific primary antibodies (for cathepsin B and D, polyclonal antibody Calbiochem; for cathepsin L, monoclonal antibody, Alexis, Lausen, Switzerland) for 45 min on ice. After washings, cells were incubated for additional 30 min with a secondary Alexa-488-conjugated anti-rabbit or anti-mouse antibody (Molecular Probes, Eugene, OR, USA). Cells were analyzed on a cytometer or, alternatively, were fixed for 10 min in 4% paraformaldehyde and observed with a Nikon Microphot fluorescence microscope. Images were captured by a color chilled 3 charge-coupled device (CCD) camera (Hamamatsu, Japan) and analyzed by the OPTILAB (Graftek, France) software. For evaluation of cystatin C expression level, fixed cells were permeabilized and then stained with specific monoclonal antibody against cystatin C (10 μg/ml, Abcam Ltd.21 Cambridge, UK) as previously reported for other intracellular antigens [
22]. Samples were analyzed on a FACScan flow cytometer (Becton Dickinson, San Jose', CA, USA) by using FL-1 detector.
Assay for activity of cathepsins
Cathepsin B and D and L activity in the cell medium were evaluated by using sensitive fluorogenic substrates: Abz-Gly-Ile-Val-Arg~Ala-Lys(Dnp)-OH (Ex: 320; Em: 420), D Bz-Arg-Gly-Phe-Phe-Pro-4MeObNA, HCl (Ex: 345; Em: 425) and Ac-His-Arg-Tyr-Arg-ACC (Ex:380; Em: 460) specific for cathepsin B, D and L, respectively (all Calbiochem) as previously reported [
23]. Fluorescence of the samples (in triplicate for each experimental condition) was read by using a microplate fluorometer.
Cystatin C and VEGF-A evaluation in the culture medium
Evaluation of cystatin C and vascular endothelial growth factor A (VEGF-A) in cell culture medium was performed with specific ELISA kits from Alexis and Bender MedSystem (Lausen, Switzerland), respectively. According to the manufacturer instructions, medium samples were analyzed by a plate microreader with 450 ± 10 nm filter. Detected values were compared with a standard curve and reported as ng/ml (cystatin C) or pg/ml (VEGF-A).
Cell invasion assays
Tumor cell invasion was determined
in vitro by using transwell culture inserts (8.0-μm pore size) coated with Matrigel (Becton Dickinson) as previously reported [
24]. Each assay was carried out at least three times in triplicate for each experimental condition. To determine cathepsin B surface amount, cells on the filter top or migrating to the bottom surface of the filter were harvested and stained as reported above.
Cathepsin B gene silencing with siRNA
Melanoma cells were cultured in antibiotic-free medium and transfected with Dharma FECT 4 reagent (Dharmacon, Lafayette, CO), according to the manufacturer's instructions, using 100 nM siRNA human cathepsin B, D and L. The transfection efficiency was confirmed by using a Dharmacon's positive silencing control, siGLO laminin A/C siRNA. After 24 h, the culture medium was replaced with fresh medium and transfected again, as above, with 100 nM siRNA. The siRNAs targeting human cathepsins were the following. For cathepsin B: r(GGAUCACUGCGGAAUCGAA)dTdT and r(UUCGAUUCCGCAGUGAUCC)dTdG; for cathepsin D: r(AAGUGGUGGACCAGAACAUC)dTdG and for cathepsin L: 5'-GGCGATGCACAACAGATTATT-3'. After further 48 h, the effect of transfection on protein expression was verified by Western blot or flow cytometry analyses. Cells knocked down for cathepsins were then tested for their invasion capability.
In vivo experiments
CD-1 male nude (nu/nu) mice, 6-8 weeks old and weighing 22-24 g were purchased from Charles River Laboratories (Calco, Italy). All procedures involving animals and their care were in accordance with institutional guidelines under the control of the Italian Ministry of Public Health (guided by International Guideline Principles for Biomedical Research Involving Animals developed by the Council for International Organization of Medical Sciences). To study the effect of CA-074 on the growth of MM1 human melanoma, cells in exponential phase of
in vitro growth were injected into the hind leg muscles of mice at 5 × 10
6 cells/mouse. Mice were treated as from day 6 after tumor implant when a tumor mass of about 250 mg was evident, by injecting CA-074 i.v. at 10 mg/kg for eight consecutive days. This dose was chosen based on previous results [
25] and on our preliminary experiments showing the tolerability of the treatment on healthy mice. Control animals received vehicle alone. Tumor weight was calculated by caliper measurements as previously reported [
26]. Antitumor efficacy of treatments was assessed by the following end-points: a) percent tumor weight inhibition, calculated as [1-(mean tumor weight of treated mice/mean tumor weight of controls)] x 100; b) tumor growth delay, evaluated comparing the median times for treated and untreated tumors, respectively, to achieve equivalent size. To evaluate the antimetastatic efficacy of CA-074, MM4 cells were injected i.v. at 5 × 10
4 cells/mouse. The day after treatment the drug was administered i.v. by using the same schedule reported above. Control animals were injected with vehicle alone. Two weeks after the injection of cells, mice were killed, their lungs removed and fixed in Bouin's solution to distinguish tumor nodules from lung tissue, and the number of metastases was determined under a stereomicroscope. The efficacy of treatment was assessed by comparing the reduction in the number of metastases in treated versus untreated mice. Each experimental group consisted of six mice.
Data analysis and statistics
All samples were analyzed with a FACScan cytometer (Becton Dickinson) equipped with a 488 argon laser. At least 20,000 events were acquired. The expression level of the analyzed proteins was expressed as a median value of the fluorescence emission curve. Statistical significance among different experimental conditions of the same experiment was calculated by using the parametric Kolmogorov-Smirnov (K/S) test. Statistical analysis among different experiments was performed by Student's t-test by using Statview program for Macintosh. All data reported were verified at least in three independent experiments and expressed as mean ± standard deviation (SD). Only p values of less than 0.01 were considered as statistically significant.
Discussion
In the present work we investigated the role of cathepsin B, D and L in metastatic melanoma aggressiveness. Unlike cathepsins D and L, cathepsin B appears to contribute significantly to cell spreading and metastatic potential. We also show for the first time that the specific cathepsin B inhibitor CA-074, as well as antibodies directed against cathepsin B, was able per se, i.e. without any further additional drug, to exert a powerful anti-invasive activity by a mechanism that brings into play the impairment of metastatic cell dissemination. This was assessed both in vitro, i.e. in eight different cell lines from primary and metastatic lesions, as well as in vivo, i.e. in murine xenografts, where a decrease of tumor weight and an increased tumor growth delay as well as a significant reduction of artificial lung metastases were detected after CA-074 administration.
The possible link between cathepsins and cancer and the role of cathepsin B in metastatic potential was postulated since many years [
30,
31]. For instance, numerous clinical studies have hypothesized a correlation between extralysosomal cathepsin B expression and release with neoplastic disease progression and clinical outcome [
5]. However, in spite of the number of papers published in the field, the mechanisms and the pathways involved are still under investigation. Cathepsin B, either the mRNA or the protein, was often detected in higher amount in malignant tumors than in benign ones or in normal tissues [
27]. In addition, the intracellular trafficking of cathepsin B appeared frequently altered in malignant tumors [
32], resulting in i) an increased secretion of precursor and active forms of the enzyme [
33], ii) its redistribution from perinuclear lysosomes to peripheral vesicles localized in invadopodes [
34], and finally iii) its association with the plasma membrane [
35], where it was found associated to the caveolae, via active K-RAS, at least in colon cancer [
36]. Some investigators hypothesized a role for cathepsin B in the mechanisms of invasion and metastasis [
4]. In our experimental model, in spite of the higher amount of cathepsin B mRNA in metastatic melanoma cell lines in comparison to primary melanoma cell lines, we observed that protein cathepsin B content was higher in primary melanoma than in metastatic melanoma cell lines. Thus, we can hypothesize that this discrepancy could be due to a major secretion of cathepsin B by metastatic cells. According to this, our analyses performed at different time points in invading cells after selections by repeated passages through the Matrigel-covered filters, suggested that plasma membrane localization of cathepsin B and its extracellular activity, rather than its overall expression, had a major correlation with cell invasion capabilities.
The pivotal and specific role of cathepsin B in metastatic melanoma cells was also reinforced by the fact that: i) differently from cathepsin B, the activity and the expression of other two cathepsins analyzed here, cathepsin D and cathepsin L, were found essentially unchanged in metastatic cells with respect to primary melanoma cells. Furthermore, ii) specific inhibitors of cathepsin D and cathepsin L, i.e. pepstatin A and cathepsin L inhibitor II, respectively, as well as their specific siRNA, did not modify metastatic cell invasiveness
in vitro. Accordingly, cathepsin D was reported to be involved in cellular transformation, being down-regulated in melanoma cells with respect to melanocytes [
37], rather than in metastatic potential. As concerns cathepsin L, this belongs to the cysteine protease family and its expression was suggested to correlate with increased invasion ability of tumor cells, e.g. of M14 murine melanoma cells
in vitro[
38]. At variance, we did not find any significant association between the expression of this cathepsin and invasion capability. This seems in accord with the hypothesis that high cathepsin L concentrations are detectable in primary melanomas with a poor prognosis [
39].
As concerns cystatins, including cystatin C, they function as cysteine protease inhibitors. These are expressed in numerous cell types and regulate a number of biological processes, including tumor progression. Cystatins are epigenetically silenced through DNA methylation-dependent mechanisms in several forms of cancer and they have been hypothesized to regulate promotion or suppression of tumor growth, invasion, and metastasis [
40]. Our results indicated that high levels of cystatin C could only be detected in the milieu of melanoma cells from primary lesions. Hence, it cannot be excluded that the low level of this physiological cathepsin inhibitor found in the growth medium of metastatic melanoma could be the result of its "exhaustion", e.g. consequent to the attempt to counteract cathepsin activity.
As a general rule, cathepsins are optimally active at an acidic pH and extracellular pH is lower in many tumors rather than in the corresponding normal tissue microenvironment. Cells cultured at acidic pH have been reported to increase the secretion of proteinases and proangiogenic factors and to enhance invasive and angiogenic potential as well as the potential to develop experimental metastases [
29]. Our data indicated that, conversely to cells from primary melanoma, metastatic cells were able to survive at acidic pH (see Supplementary Figure 1), also supporting the evidence that more malignant tumors are able to grow and expand in an acidic environment, as that ones produced under hypoxic conditions [
41]. Thus, a reappraisal of treatment strategies involving deliberate tumor acidification to improve the efficacy of chemotherapy should be considered. The possibility that cathepsins, including cathepsin B, could play a key role in the formation of acidic tumor microenvironment should also be taken into account. A further point in this context concerns VEGF secretion. It was suggested that acidic pH promotes experimental metastasis by human melanoma cells via a mechanism involving acidity-induced up-regulation of proteolytic enzymes, including cathepsins, as well as up-regulating pro-angiogenic factors such as VEGF [
29]. Hence, considering their high production of VEGF, the aggressive behavior of MM4 cells, once injected in mice, it is not surprising and the effects obtained with CA-074 may also be partially referred to as its putative microenvironmental "buffering activity".
The last important point regards the fact that either chemical inhibitors, i.e. CA-074 and CA-074Me, or biological, i.e. antibodies directed against active cathepsin B, as well as cathepsin B gene silencing with siRNA, determine a significant impairment of cell aggressiveness in terms of spreading ability. The block of cathepsin B activity via antibody administration, unlike that of chemical compounds and siRNA, could impair metastatic melanoma cell dissemination certainly exerting their activity at extracellular level. Since the use of immunotherapeutic strategies recently acquired a clinical relevance, specific in vivo studies with antibodies against cathepsin B would be planned.
In conclusion, our paper suggests a role for cathepsin B in tumor growth and in metastatic potential of human melanoma. Inhibition of cathepsin B could possibly lead to changes of tumor microenvironment, to a decreased cell survival and spreading and, therefore, to the impairment of metastatic seeding and onset. Further research on melanoma, as well as on other tumor models, will however be crucial to clarify these points before generating therapeutic strategies based on the use of available or novel potential inhibitors of cathepsin B activity.
Competing interests
The authors declare that they have no competing interests.
Authors' contributions
PM participated in designing the study, designed all the experiments, participated in carrying out the cell biology studies, analyzed and interpreted the data, supervised other co-authors, participated in performing the statistical analysis, wrote the manuscript; BA, LC, AMM, and RV participated in carrying out biochemical and molecular studies, analyzed and interpreted data; CL and MS designed all the in vivo experiments, analyzed and interpreted the in vivo data, and participated in performing the statistical analysis; CC participated in designing the study, furnished clinical expertise and biological materials (fresh isolated melanoma cells), analyzed and interpreted data; WM and MGP participated in designing the study, analyzed and interpreted the data, supervised other co-authors performing biochemical and molecular studies, participated in performing the statistical analysis, participated in writing the manuscript.
All the author read and approved the final manuscript