Background
Cd74 (CD74 in man) is a non-polymorphic type II membrane-spanning glycoprotein, which was originally identified as being associated with antigen presentation by dimeric major histocompatibility complex class II (MHCII) molecules. The roles played by Cd74 in antigen presentation span from chaperoning MHCII dimers in their proper folding, preventing premature antigenic peptide loading in the ER, and promoting ER egress of MHCII dimers, to targeting these complexes to endocytic compartments [
1‐
3]. However, Cd74 is also required for follicular B-cell maturation as well as maintenance of the follicular and marginal zone B-cell pools [
4,
5], and this action is independent of the MHCII-chaperonic activity of Cd74 [
6]. The vast majority of MHCII-Cd74 complexes are diverted to the endocytic system, but surface expression of a small proportion of cellular Cd74 can indeed be detected on B-cells independently of concomitant class II expression [
7‐
9]. These Cd74 cell surface molecules reveal high affinity binding to the pro-inflammatory cytokine macrophage migration inhibitory factor (MIF), and together with the signaling component of the MIF-Cd74 receptor complex (CD44) transmit MIF-mediated signaling [
10,
11]. Activation of cell surface Cd74 by MIF induces a signaling cascade leading to Cd74 intra-membrane cleavage, release of the N-terminal cytoplasmic part of Cd74, NF-κB activation, and ultimately, increased expression of the anti-apoptotic factor Bcl-2 [
12‐
15]. This signaling cascade defines Cd74 as a survival receptor enhancing the survival of mature B-cells. Furthermore, Cd74 was also shown to act as a regulator of dendritic and B-cell motility [
16].
In normal tissues, Cd74 is expressed on B cells, monocytes, macrophages, dendritic cells and epithelial cells of endodermal and mesodermal origin [
17]. The transcriptional control elements for the murine
Cd74 locus are composed of a promoter with common regulatory elements such as TATA-box, Sp1 site, CCAAT-box, and an NF-κB responsive element as well as an upstream enhancer with elements corresponding to promoter elements in MHCII [
18]. Additionally, two distinct intronic enhancers are found in intron 1 [
19,
20]. In mouse differential splicing gives rise to two different isoforms, p31 and p41, with the p41 isoform harboring an additional exon (exon6b) as compared to p31 [
21] whereas in man differential splicing combined with alternative translational start sites gives rise to four distinct CD74 isoforms [
22,
23]. The mRNA transcripts for human p41 and p43, the longer isoform translated from an upstream ATG, comprise 10% of the total CD74 transcript pool [
22]. Cd74 is involved in many different scenarios, however analysis of Cd74 function in transgenic mice expressing exclusively one of the two isoforms indicates that in most respects the two isoforms can be regarded as functionally redundant [
24‐
26].
Given its diverse functions in B-cell homeostasis it is not surprising that human CD74 is strongly expressed in a variety of B-cell lymphomas as well as many cell lines derived thereof [
27‐
29]. B-cell chronic lymphocytic leukemia (B-CLL) is characterized by a progressive accumulation of B-lymphocytes in peripheral blood, lymphoid organs, and bone marrow, due to decreased apoptosis of this cell population. Evaluation of CD74 function in B-cells purified from the peripheral blood of B-CLL patients revealed that cell surface stimulation of CD74 initiated a signaling cascade leading to promotion of cell survival [
30]. Many studies have furthermore demonstrated CD74 expression in various non-hematological cancers including gastric, colon, lung, and renal epithelial cancers [
31‐
34], and moreover has the elevated expression level in several cancers served as a marker for tumor progression and/or poor clinical outcome [
35]. The selective expression pattern of CD74 in neoplastic processes combined with the dynamics of internalization of cell surface CD74 molecules have brought CD74 forward as an attractive target for monoclonal antibody-based therapy [
35]. In that connection, preclinical studies revealed that a humanized form of a murine Cd74 antibody is able to effectively inhibit tumor growth and yielded marked survival improvements in severe combined immunodeficiency mouse xenograft models of non-Hodgkin lymphomas and multiple myeloma, respectively [
36]. Currently, phase I and phase I/II trials are underway in patients with B-cell non-Hodgkin lymphomas and B-CLL, and one including patients with multiple myeloma has been completed [
37].
Proviral tagging is a widely applied and efficient tool in the discovery of oncogenes relying on the mechanism of retroviral insertional mutagenesis [
38,
39]. In an attempt to broaden the understanding of the causative genetic alterations in hematopoietic tumors, we have used the inbred NMRI mouse strain infected with the non-acutely transforming ecotropic murine leukemia viruses (MLVs) Akv and SL3-3, giving rise to models of B- and T-cell tumorigenesis, respectively [
40,
41]. We here report of the identification of
Cd74 as a novel common insertion site in retrovirally induced murine B-lymphomas, thereby providing a strong genetic indication for causal involvement of this locus in B-lymphomagenesis. Prompted by the distribution and orientation of insertion sites within the
Cd74 locus a hitherto uncharacterized intronic
Cd74 promoter was identified in tissues from un-infected mice leading to expression of an N-terminally truncated Cd74 isoform. The distinct intronic promoter is positively regulated by the 3'
Cd74 intronic enhancer and the expression of the novel Cd74 isoform is IFNγ responsive in analogy with the canonical Cd74 isoform.
Conclusions
By screening app. 2400 MLV-induced tumors for proviral integration sites we find the Cd74 locus to be a novel common insertion site in murine B-lymphomas. Interpretation of the proviral insertion pattern in light of dissecting genomic structures prompted the identification of a novel Cd74 isoform expressed from an intronic promoter in a manner different from its canonical counterpart. Expression of the novel transcript is IFNγ-inducible and reporter assays suggest the activity of the promoter to be under influence of the downstream intronic enhancer.
The essential functions of Cd74 in antigen presentation and B-cell homeostasis together with its recent application as target in immuno-therapy trials, makes a thorough characterization of the protein isoforms of foremost importance. Furthermore, the status of Cd74 as a vital component in the pathogenic process per se necessitates a more profound understanding of the pathogenic contribution of Cd74 in the multi-step process of tumorigenesis - in which view expression of an alternative Cd74 isoform only adds to the complexity previously anticipated.
Methods
Origin of lymphomas
In previous studies mice of the inbred NMRI strain were infected with the non-acutely transforming ecotropic murine leukemia viruses Akv and SL3-3 and different mutants hereof, primarily harboring mutations within the transcriptional control elements. The set-up resulted in app. 2400 tumors and proviral insertion sites were determined as previously described [
47,
66]. Tumor samples selected for this study were available from our earlier and unpublished work [
41,
44,
46,
48,
67,
68].
Southern blotting analyses
Clonal rearrangements in Ig and TCR loci were detected by hybridization of digested genomic DNA extracted from frozen tissues with appropriate probes. Clonal rearrangements in Ig loci were detected by probes derived from the joining regions of the IgH and Igκ [
41], respectively, whereas rearrangements within TCR genes were evaluated by two separate probes recognizing either joining region 1 or 2 (J1 and J2, respectively) of the TCRβ chain [
69]. The ecotropic virus-specific probe was an envelope
Sma I fragment from Akv [
41].
RT-PCR
First-strand cDNA synthesis (Fermentas) was made with 3 μg total RNA and an oligo-dT primer followed by PCR amplification. For detection of the novel transcript the following primers were applied:
A: 5' CACCATACAAGTAAGGGCTTTCACAGAT3', B:
5' GGTAACCAGATATGGATTCTTAGA-GCAAT3', C:
5' GAGGGCTGTGTATTCAACAAATCCAT3', D:
5' CGTTATTTAACAACCGCTCA-TTCCAAGC3', E:
5' TGTCACTACACAGAGGAGACACCAAA3', Exon5reverse:
5' TCTGAAGCATCTTAAGAACTCCATGGATG3'. Detection of canonical transcript was performed with Exon1forward + Exon4reverse, while detection of the alternative transcript was performed with Intron1forward + Exon4reverse unless otherwise stated. Exon1forward: 5' CTGTGGGAAAAACTAGAGGCTAGAGC3', Exon4reverse: 5' ACATGGTCCTGGGTCATGTTGCCGTA3', Intron1forward: 5' TGTCACTACACAGAGGAGACACCAAA 3'. Primers for Gapdh were 5' ACCACAGTCCATGCCATCAC 3' and 5' TCCACCACCCTGTTGCTGTA 3'.
qPCR
For qPCR cDNA was used as template in a SYBR green qRT-PCR reaction using the Platinum SYBR Green qRT-PCR Supermix UDG (Invitrogen) following the manufacturer's recommendations. Reactions were run in triplicates with cDNA corresponding to 30 ng total RNA. For absolute quantification standard curves were derived from amplification on plasmid DNA (expression vectors for the canonical and novel isoform, respectively). The primers applied were one in exon 4 of Cd74 (5' ACATGGTCCTGGGTCATGTTGCCGTA3') in combination with a primer specific for the canonical transcript (5' GGGGCTCGAGATGGATGACCAACGCGACC3'), or with a primer specific for the novel transcript (5' ATGCTCTTACTCCGTCCCAACAG3'), respectively. Copy numbers of the two transcripts in the separate spleen samples and tumor 01-762 were estimated from copy-number standard-curves derived from amplification on plasmid DNA.
Relative quantification was done with the Pfaffl method [
70] normalizing to the expression level of TATA-box binding protein (TBP) amplified with the primers 5' AGAGAGCCACGGACAACTG 3' and 5' ACTCTAGCATATTTTCTTGCTGCT 3'. Primers in
Cd74 were 5' GTGCAGCCGTGGAGCTCTGTACAC3' (specific for canonical transcript), 5' GGGGCTCGAGATGCTCTTACTCCGTCCCAACAG3' (specific for novel transcript) in conjunction with 5' ACGCATCAGCAAGGGAGTAGCCATCC3' (
Cd74 exon 3 reverse primer).
Identification of 5' transcript ends
Identification of the 5' transcript ends was done using the GeneRacer™ RLM-RACE kit from Invitrogen following instructions provided by the manufacturer. Briefly, 5 μg total RNA from spleen was applied, onto which a GeneRacer™ RNA oligo was ligated to the 5' end. The ligated mRNA was reverse transcribed with a gene-specific primer in exon 5 (5' TCTGGGAAGGTCCCCTTCAGCTGCGGGTACTCCA3') or it was random-primed (primer supplied in the RML-5' RACE kit), respectively. The RNA for gene-specific cDNA-priming was purified from spleen of an inbred NMRI mouse, whereas RNA for the randomly primed cDNA-synthesis was purified from the spleen of a mouse in a backcross breeding program from B6D2F2 to inbred NMRI mice. To amplify 5' ends, amplifications were performed with a forward linker primer and a reverse gene-specific intronic primer (SR2; 5' GCCTCCTCTGGGCTTTGGTGTCTCCTCTGTGTAGTGACAGGGTAA3') in order to identify transcripts initiated in intron 1, and the gene-specific exon 5 reverse primer applied in the cDNA synthesis in order to detect the canonical transcript initiated in exon 1, followed by semi-nested PCR with a nested linker primer. Two μl bulk PCR product was subsequently cloned into the TOPO TA cloning® system (Invitrogen) and sequenced with the provided vector primers M13F and M13R, respectively.
In vitro transcription/translation
The single-tube in vitro transcription/translation assay was performed with the TnT®Quick Coupled Transcription/Translation Kit from Promega according to manufacturer's recommendations.
In order to obtain the ORFs in a context with a T7 priming site, the canonical p31 Cd74 ORF and the ORF of the novel isoform (p31-like) were amplified by RT-PCR from oligo-dT-primed cDNA from NMRI inbred spleen RNA and cloned into the TOPO TA cloning® system (Invitrogen). The ORFs were cloned including their 8 upstream nucleotides thereby comprising the naturally occurring Kozak sequence.
In silico analysis
The sequence spanning intron 1 of
Cd74 (mm9 assembly of the murine genome at the UCSC genome browser [
71]) was extracted. Orthologous sequence chains from rat, human, marmoset, horse, and cow, were obtained and aligned with the murine sequence by global multiple alignment with the Chaos and Dialign software [
49,
72]. The largest degree of similarity within this region, except regions harboring the intronic enhancers, was from 542 nucleotides upstream exon 2 of murine
Cd74 and extending until position 202 upstream of exon 2. Thus, a sequence of 317 nucleotides, spanning from 542 nucleotides upstream of exon 2 and until the start of annealing of primer SR2 from the RLM-RACE analysis (which anneals to position 225 → 181 upstream exon 2), was extracted for further analysis. Orthologous sequences from rat (rn4 assembly), human (hg18 assembly), marmoset (calJac1 assembly), and horse (equCap1 assembly), were aligned with the murine sequence by Chaos and Dialign software [
49,
72]. Transcription factor binding site sequences were identified by usage of the free academic MatInspector license from Genomatix [
50,
73]. Only transcription factor binding motifs with core similarities higher than 0,85 were considered and furthermore, only transcription factor families expressed in cells of the immune system were included.
Tissue culture
NIH 3T3 cells were grown in DMEM supplemented with 10% NCS, MC3T3 cells were grown in Mem-a supplemented with 10% FCS, and the MPC11 suspension cell line was cultured in RPMI-1640 supplemented with 10% FCS. In experiments with IFNγ-treatment, cells were grown for 24 or 48 hours in the presence or absence of 25 ng/ml IFNγ, respectively, prior to RNA harvest.
Luciferase assay
The Dual-Luciferase Reporter Assay System (Promega) was performed according to manufacturer's recommendations. The constructs applied were based on pGL3enhancer (Promega) with or without the promoter inserted in Xho I/Hind III. The F1 promoter fragment was amplified from BALB/c genomic DNA with the primers 5' TTATATCTCGAGCCACATGTAAAAACTCTAGGCCCCAC 3' and 5' TTATATAAGCTTGAAGAAGGGTTTTCATCCACTGTGC 3'. The SV40 enhancer was exchanged for other enhancers in Hpa I/BamH I followed by reintroduction of the luciferase polyA site in the Hpa I site. Enhancers were amplified with 5' TATAAGTTAACGCTTCCAAGACTGACCAGGCCTTA 3' and 5' TATAATGGATCCGTTTTACTTCCTCCTTTGTACTTCCTCC 3' (upstream enhancer), 5' TATAATGTTAACTCTCCAGCCCTTGGCTTAGGAAATAC 3' and 5' TATAATGGATCCGATAAGTTTGCATCCTGCCTACTCCAG 3'(downstream enhancer), 5' TATAATGTTAACAATGAAAGACCCCTTCATAAGGCTT 3' and 5' TATAATGGATCCCGCCGAGTGTGGGGTTCTTACCCTTTTT 3' (U3 in sense), and 5' TATAATGTTAACCGCCGAGTGTGGGGTTCTTACCCTTTTT 3' and 5' TATAATGGATCCAATGAAAGACCCCTTCATAAGGCTT 3' (U3 in antisense). Cd74 enhancers were amplified from genomic BALB/c DNA and the U3 enhancer regions from an Akv-encoding plasmid.
Competing interests
The authors declare that they have no competing interests.
Authors' contributions
MP carried out all experimental work except large scale screening for proviral insertion sites, designed and analyzed the experiments, and wrote the manuscript. BW and MW designed and performed the large scale screening for proviral insertion sites. MW and FSP conceived of the study, and FSP contributed to the editing of the manuscript. MP, MW and FSP read and approved the final manuscript.
Bruce Wang died on August 21, 2009.