Introduction
Angiogenesis is essential for a solid tumour to grow beyond 1–3 mm in diameter [
1]. It also is a significant predictive factor for prognosis in patients with solid tumours [
2,
3]. Amongst the numerous angiogenic factors, VEGF is the most powerful and most extensively studied. VEGF belongs to a protein family, within which Placental growth factor (PlGF) is a member (other members include VEGF-B, -C and D). PlGF is a secreted, disulfide-linked dimeric glycoprotein originally cloned from a cDNA library of term placenta [
4]. PlGF shares 53% of similarity in its overall amino acid (aa) residues with VEGF. The biological functions of VEGF and PlGF are similar, including stimulation of the growth of vascular endothelial cells [
5]. As a result of alternative splicing of the primary PlGF transcript, PlGF has at least three isoforms, PlGF-1 (PlGF149), PlGF-2 (PlGF170) and PlGF-3 (PlGF221) [
4]. In cells co-expressing VEGF and PlGF mRNA, a heterodimeric VEGF/PlGF protein has been detected [
6,
7]. VEGF/PlGF heterodimer has been shown to promote capillary growth
in vivo [
7].
PlGF is known to specifically bind with Flt-1. VEGFR2/KDR/Flk-1 and VEGFR1/Flt-1 are the two main receptors of VEGF during the embryonic vascular development [
8,
9]. Flk-1 primarily mediates VEGF signal transduction and biological responses [
10]. In addition to acting as the receptor for VEGF and PlGF, Flt-1 is a special receptor for VEGF-B. It has been shown that VEGF and PlGF can induce transcription factors FosB and c-Fos mRNA expression, indicating the possibility that these factors may play a role in the biological responses mediated by PlGF and Flt-1 [
9]. The protein and message for PlGF can be detected in endothelial and epithelial cells and have been found in a few tumours [
7,
10].
To our knowledge, there has been no report on the significance of PlGF expression with clinical outcome of patients with lung cancer, including non-small cell lung cancer (NSCLC). In order to ascertain the clinical significance of PlGF expression in human non-small cell lung cancer, we analysed the expression pattern of PlGF using both immunohistochemical method and real time quantitative PCR and attempted to establish if a relationship existed between PlGF and MVD, and subsequently between PlGF and the predicted prognosis.
Patients and methods
Patients and samples
A total of 91 patients with non-small cell lung cancer, who attended Beijing Cancer Hospital from July 2000 to August 2003, were included. None of the patients received any neoadjuvant therapy prior to operation. Histological types of the lung cancer included squamous carcinoma, adenocarcinoma, large cell carcinoma, squamous adenocarcinoma and alveolar carcinoma, pathologically (table
1). No other previous or concomitant primary cancer was present. Clinico-pathological characteristics were defined according to the TNM criteria of the UICC (11) (table
1). Slides were reviewed and evaluated by two independent researchers. Clinico-pathologic factors, such as age, sex, histological types of tumours, tumour cell grade, TNM stage, vessel embolism, lymph node metastasis, were reviewed and stored in the patients' database. Patients were followed up from the day of operation to August 2004 as the end of follow-up. The follow-up intervals were calculated as survival intervals after surgery.
Table 1
The correlation between PlGF expression and the clinical pathological factors.
| |
Low-staining (n =)
|
High-staining (n =)
| |
Sex
| | | | |
Male | 63 (69.2%) | 39 | 24 | 1.000 |
Female | 28 (30.8%) | 17 | 11 | |
Age
| | | | |
≤60 | 43 (47.3%) | 29 | 14 | 0.290 |
>60 | 48 (52.7%) | 27 | 21 | |
Histological type
| | | | |
Squamous carcinoma | 42 (46.2%) | 29 | 13 | 0.167 |
Adenocarcinoma | 33 (36.3%) | 20 | 13 | |
Adenosquamous ca. | 6 (6.6%) | 3 | 3 | |
Large cell carcinoma | 2 (2.2%) | 2 | 0 | |
Carcinoid | 2 (2.2%) | 0 | 2 | |
Alveolar carcinoma | 6 (6.6%) | 2 | 4 | |
Grade of differentiation
| | | | |
Poor | 11 (12.1%) | 9 | 2 | 0.288 |
Moderate | 48 (51.7%) | 27 | 21 | |
Well | 32 (35.2%) | 20 | 12 | |
Tumour stage
| | | | |
T1 | 9 (9.9%) | 7 | 2 | 0.643 |
T2 | 60 (65.9%) | 37 | 23 | |
T3 | 19 (20.9%) | 10 | 9 | |
T4 | 3 (3.3%) | 2 | 1 | |
Nodal status
| | | | |
N (-) | 49 (53.8%) | 31 | 18 | 0.829 |
N (+) | 42 (46.2%) | 25 | 17 | |
Vessel cancer embolus
| | | | |
V (-) | 67 (73.6%) | 42 | 25 | 0.808 |
V (+) | 24 (28.4%) | 14 | 10 | |
TNM stage
| | | | |
I | 40 (43.9%) | 28 | 12 | 0.173 |
II | 20 (21.9%) | 11 | 9 | |
IIIa | 28 (30.7%) | 17 | 11 | |
IIIb | 1 (1.1%) | 0 | 1 | |
IV | 2 (2.2%) | 0 | 2 | |
A separate collection of tissue samples from 21 primary non-small cell lung cancers were used for mRNA based analysis. These tumours were resected surgically from patients at the Clinical Oncology School of Peking University from 2002 to 2003 and were saved in the Tissue Bank of Peking University Oncology School. The patients consisted of 13 men and 8 women, with a mean age of 56.2 ± 6.4 years. The histological type of lung cancer was classified based according to the World Health Organization classification [
12]. Tumour staging was performed according to the TNM staging criteria of the UICC [
11]. The tumour specimens included 10 squamous cell carcinomas, 8 adenocarcinomas, and 3 undifferentiated carcinomas. Tumour staging was I in 3 cases, II in 7 cases, IIIA or IIIB in 10 cases, and IV in 1 case. Immediately after surgery, tumour samples and surrounding normal lung tissues (more than 5 cm away from the tumour margin) were placed in liquid nitrogen and stored frozen at -80°C for RNA extraction and the RT-PCR.
Materials
The goat polyclonal antibody of PlGF and a mouse monoclonal antibody of β-actin was purchased from Santa Cruz Biotechnology (Santa Cruz, California, USA). The mouse monoclonal antibody of CD31 was purchased from Beijing Zhongshan Biotechnology Co. Ltd (Beijing, China). The biotin conjugated anti-goat IgG, anti-mouse IgG antibodies were purchased from Sigma (Poole, Dorset, England, UK). The Horse Radish Peroxidase (HRP) conjugated anti-goat IgG, anti-mouse IgG antibodies were obtained from Sigma (Poole, Dorset, England, UK). The Target Retrieval Solution was purchased from DAKO Corp. (Beijing, China). RNA extraction and reverse transcription kits and PCR mix were purchased from Bio-Rad Corp. (Beijing, China). Primers were synthesized by BioAsia Corporation (Shanghai, China). PCR reaction was carried out using the iCycler iQ™ system (Bio-Rad). The working stock solution of SYBR Green is 1:100 (Bio-Rad).
PlGF staining and microvessel counting
The paraffin-embedded tissue sections of 91 patients were cut at 4 microns and mounted on polylysin-coated glass slides for immunohistochemistry. Briefly, deparaffinized sections were heated (60°C 1 hour). Antigen retrieval was performed by heating the samples without boiling in Target Retrieval Solution (DAKO Corp.), pH 6.70 (200 ml) in a microwave oven for 10 min. After endogenous peroxidase was blocked with 3% hydrogen peroxide in the section, each section was incubated with non-immunised horse serum (Sigma) for 15 minutes, in order to block the non-specific antigen site.
The immunohistochemical staining procedure was performed according to the protocol of the DAKO Corp. The primary anti-PlGF antibodies were used at a dilution 1:100 from the stock. The primary CD31 antibody was used at working dilution of 1:100. The specificity of anti-PlGF antibody was documented elsewhere [
13]. Following incubation at 4°C overnight, the sections were extensively washed and then incubated with link antibodies (Sigma). Following more washing, bound antibodies were linked to avidin-biotin-peroxidase according to manufacturer's instruction (Dako Corp.). The staining was completed by developing colour using the DAB (diaminobenzidine tetrahydrochloride) solution for 5 min. The slides were counterstained with Mayers Haematoxylin Blue in 0.3% ammonia. For negative controls, sections were stained in the same manner, except that the primary antibody was absent from the solution.
PlGF staining in lung cancer cells was independently assessed by two observers using a modification of the system of grading the relative intensity of immunoreactivity for the respective antibodies [
14]. PlGF immunohistochemical staining of a tissue sample was graded as either low level expression or high level. High-level staining represented uniformly intense immunoreactivity; low level staining represented patchy and weak or negative immunoreactivity.
MVD was evaluated as previously described [
15]. After screening the areas with intense neovasularized spots at low power field (×100), microvessels in the area with the highest number of discrete microvessels were counted in a ×400 field. Three separate intense neovascularized areas were assessed for each spot, and the mean was calculated as MVD of each tumour evaluated. The MVD level were graded as low level with MVD number lesser than 26, while the high level with MVD number over than 26. This was based on the pilot analysis of the microvessel density according to pathological grade, in that 26 yielded a clear division between the groups.
Generation of cDNA from NSCLC tissue and normal tissue and RT-PCR
RNA was extracted from tumour and the normal surrounding tissues in RNA extraction buffer according to the manufacturer's protocol. The concentration of RNA was measured with a spectrophotometer. Reverse transcription was performed from 1 μg of total RNA using oligo dt primer according to the manufacture's instructions. Conventional PCR primers were designed using Primer 3
http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi, to allow amplification of regions that have no overlap with other known genes and span at least one intron. Primers were synthesized by BioAsia Corporation (Shanghai, China): Primer sequences for PlGF were 5'ACGTGGAGCTGACGTTCTCT'3 and 5'CAGCAGGAGTCACTGAAGAG'3 and for GAPDH 5'AGGTCGGAGTCAACGGATTTG'3 and 5'GTGATGGCATGGACTGTGGT'3. Conventional PCR was performed using cDNA from tissues together with the PCR master mix using respective primers. The reaction conditions were: 95°C 5 min, 94°C for 1 min, 55°C for 45 s, 72°C for 30 s and a final extension phase at 72°C for 7 min for 40 cycles. The PCR products were separated on a 2% agarose gel and stained with 5 μl ethidium bromide prior to examination under UV light and photographs taken.
Generation of standard for real time PCR analysis
The PCR product from the above reaction was gel-excised and purified using gel purification kit (Tianwei Corp, Beijing). It was subsequently quantified on a gel with lambda molecular weight standards and in a spectrophotometer. The number of copies of target template was calculated. The DNA sample was serially diluted to yield a concentration range between 102 to 108 copies, which was subsequently used as the internal standard. This was finally prepared in elution buffer, aliquoted and stored at -80°C until use.
Real Time quantitative RT-PCR
The iCycler iQ™ system incorporates a gradient thermocycler and a 96-channel optical unit. SYBR Green as a DNA-dye can affinity dsDNA was used to detect the PCR product of PlGF and GAPDH. The melting point, optimal conditions and the specificity of the reaction were first determined using a standard procedure [
17]. The working stock solution of SYBR Green is 1:100 (Bio-Rad). Quantitative PCR was carried out in 96-well plate with 10 pmol forward and reverse primers, and the working solution SYBR green, using a customer PCR master mix, with the following conditions: 95°C for 5 minutes, followed by 40 cycles at 95°C for 1 minute, 55°C for 45 seconds, 72°C for 30 second. Every assay included test cDNA samples, 10-fold serial dilutions of the standard qualification, and controls (no template), as we previously reported [
16]. The copy number of each transcript was calculated as the relative copy number normalised by GAPDH copy number.
Statistical analysis
Patients were divided into two groups: those with high-level PlGF staining and those with low-level staining. Chi-square analysis was used to test the association of PlGF expression level with standard pathological variables. Clinical pathological parameters and PlGF expression status were correlated with survival time in both univariate and multivariate analyses. Variables included in univariate analysis were gender, TNM stage, grade of differentiation, vessel cancer embolus, lymph nodal status and use of postoperative adjuvant therapy, MVD and PlGF. Variables included in multivariate analysis were MVD, PlGF expression status, gender, TNM stage, grade of differentiation, vessel cancer embolus, lymphatic nodal status and use of postoperative adjuvant therapy. The log-rank test was used to test equality across categorical factors in univariate analysis, and the level of significance was set at p ≤ 0.05 based on two sided test. The multivariate analysis was performed using Cox proportional hazards model, and the level of significance was set at p ≤ 0.05 based on a two sided test.
Paired-samples analysis was used (Student's t-test) to determine whether the difference of PlGF mRNA expression level observed between matched cancer tissue and the normal tissue. Independent-samples analysis was used (Student's t-test) to determine whether the differences observed between PlGF expression level in NSCLC tissue and the clinico-pathological characteristics. Statistical tests were performed using the software SPSS 10.0 (SPSS Inc., Chicago).
Discussion
PlGF is a member of the VEGF family and is known to be a powerful angiogenic factor, like its family members VEGF. Although PlGF has been studies in a number of clinical tumour types, little is known with regard to this factor in lung cancer, particularly non-small cell lung cancer (NSCLC). The current study investigated the expression of PlGF, at the protein level and the messenger RNA level and whether it had a bearing on clinical outcome in patients with NSCLC.
Firstly, the current study has demonstrated that PlGF can be found, at the protein level and mRNA level, in lung cancer cells. Furthermore, PlGF protein immunostaining is primarily seen in the cytoplasmic region of the cells, which is in accordance with literature reports. Stromal cells and endothelial cells displayed little staining. Secondly, PlGF is significantly linked to MVD. High levels of PlGF are significantly linked to high MVD.
The angiogenic role of PlGF is interesting to observe. PlGF expression is restricted to the placenta tissue in normal physiological condition [
18] and has been indicated to play an important role in the angiogenic process. There is evidence to suggest that up-regulation of PlGF and VEGFR-1 expression can stimulate the response of vascular endothelial cells to VEGF and enhance angiogenesis in pathological disorders [
19]. Although the precise mechanism by which PlGF regulates angiogenesis is unclear, some leads have been suggested. Up-regulation of PlGF can displace VEGF from Flt-1 and will make more VEGF to bind and activate Flk-1 [
20]. PlGF activates Flt-1 and will lead to intermolecular transphosphorylation of Flk-1. This can enhance phosphorylation levels of Flk-1 on tyrosine residues. Furthermore, VEGF/PlGF heterodimer can activate and transmit angiogenic signals through the Flk-1/Flt-1 heterodimer receptor complex.
In the current study, a high level of PlGF was seen 38.46% of all the cases. The significant correlation between PlGF and MVD further indicates that PlGF expression level is associated with MVD, and potentially with angiogenesis in human lung cancer. We, and others, have previously reported that MVD was an influence factor to predict the prognosis of patients with non-small cell lung cancer Furthermore, both univariate and multivariate analyses revealed that PlGF is an independent prognostic factor. Taken together, it is concluded that PlGF is an important factor that can influence the angiogenesis process in NSCLC, and that the levels of PlGF reflect MVD, which might be a predictive factor for NSCLC patients' prognosis.
The current study has used quantitative real time PCR, to determine the levels of PlGF gene transcript. It has been shown that PlGF mRNA expression was detected in all NSCLC tissues and the matched normal tissues. The levels of PlGF transcript in these tissues varied from weak to strong. In 17 pairs of lung cancer and normal tissue samples, PlGF mRNA expression level in cancers was significant higher than the normal tissue. There has been no report about the PlGF mRNA expression level in NSCLC, although limited reports have studied mRNA expression of VEGF, a family member of PlGF, in NSCLC. Dolrini
et al reported VEGF mRNA expression in cancer and normal tissue samples from 22 patients with the method of quantitative competitive real time PCR [
21]. They detected VEGF mRNA in 18 samples of healthy tissue and all samples of tumour tissue and found that VEGF expression was higher in the tumour tissue than in the matched healthy tissue in 17 cases [
21]. The current study has also supported by a recent report to show that lung cancer cell lines expressed PlGF, although it was indicated that SCLC tissues had a higher levels of PlGF staining than NSCLC [
22]. Collectively, we suggest that PlGF is a factor that has strong prognostic value in NSCLC as shown in the present study and possibly in SCLC as shown in a smaller scale study [
22]. A larger scale study will undoubtedly further clarify the connection.
The other interesting finding from the current study is that PlGF mRNA expression level has no significant difference with sex, histological type, tumour size, and lymph node status. However, advanced NSCLC tumours (stage III-IV) have higher levels of PlGF expression than the early stage NSCLC (I-II). This is somewhat in contrast with the immunohistochemical assessment, in that little statistical difference was observed between different stages (table
1). This is interesting and perhaps reflects the following: (1) the sensitivity of different assays. Quantitative analysis of gene transcript is a highly sensitive technique which can detect minute amount of genetic material. The technique also allows detection of very high levels of expression. Immunohistochemical analysis and the assessment based on colorimetric staining are less sensitive and sometime subjective in nature. (2) The correlation between protein and mRNA. Although a good relationship between mRNA and protein translation in the cells have been well documented, this may not be exactly translated at the tissue level. Thus, each technique has its advantage, i.e. Q-PCR for sensitivity and quantitative nature and IHC for its ability to identify protein and the location of proteins.
In summary, the current study has shown that the angiogenic factor, PlGF is ubiquitously in lung tissues and is predominantly a cytoplasmic protein in lung epithelial and lung cancer cells. PlGF expression is significantly higher in cancer tissue than in normal tissue, and is positively correlated with tumour stage and tumour size. This indicates that PlGF may have some role in tumour progression and that blocking/targeting PlGF expression may have promising therapeutic future in NSCLC.
Competing interests
The author(s) declare that they have no competing interests.
Authors' contributions
LJZ: sample collection and preparation, study design, and patients follow-up;
JFC: sample processing and conducting experimental analysis;
YK: Experimental design and preparation of the manuscript;
REM: study design and manuscript preparation;
WGJ: study design, data analysis, and manuscript preparation.