Background
Members of the
Flavivirus genus are the most important arthropod-borne viruses causing disease in humans. This genus includes viruses (West Nile (WNV), Japanese encephalitis (JEV), yellow fever (YFV), and dengue (DENV) viruses) that are endemic in several parts of the world [
1]. Flavivirus infection causes severe disease in humans including hemorrhagic fever, shock syndrome, liver failure, flaccid paralysis, and encephalitis. The ~10.7 kilobase single-stranded positive sense flavivirus RNA genome is translated as a single polyprotein, which is cleaved into three structural proteins (C, prM/M, E) and seven nonstructural (NS) proteins (NS1, NS2A, NS2B, NS3, NS4A, NS4B, NS5) by virus- and host-encoded proteases. Flavivirus RNA replication occurs along the cytosolic face of the endoplasmic reticulum (ER) and requires the enzymatic actions of several NS proteins including the viral helicase and protease (NS3) and RNA-dependent RNA polymerase (NS5).
Flavivirus NS1 is a multi-functional 48 kDa non-structural glycoprotein [
2] that is synthesized as a monomer, dimerizes after post-translational modification in the lumen of the ER, and accumulates in extracellular fluid as a hexamer with a lipid core [
3‐
7]. Flaviviruses in the JEV serocomplex also express NS1′, an additional form of NS1 with a 52 amino acid C-terminal extension, which is the result of ribosomal frame shift due to a conserved pseudoknot in the 5' end of the NS2A gene [
8,
9]. Although its precise function remains unknown, the specific deletion of NS1′ results in attenuation of neurovirulence of both WNV and JEV [
9,
10]. NS1 is expressed on the surface of cells through at least two mechanisms: (a) soluble NS1 binds back to the plasma membrane of uninfected and infected cells [
11] through interactions with sulfated glycosaminoglycans [
12]; and (b) NS1 also is expressed directly on the plasma membrane of infected cells although it lacks a canonical transmembrane domain or targeting motif for cellular membranes. The mechanism of direct cell surface expression remains uncertain although some fraction may be linked through an atypical glycosyl-phosphatidylinositol anchor [
13,
14] or lipid rafts [
15]. NS1 has immune evasive functions in the extracellular space, on the surface of cells, and within cells, as it binds to complement proteins and regulators and antagonizes their functions [
16‐
18] and possibly, disrupts TLR3 signaling pathways [
19].
Despite its transit through the secretory pathway, NS1 is an essential gene and modulates early viral RNA replication [
20‐
22]. Deletion of NS1 from the viral genome abrogates replication, although an NS1-deleted virus (∆NS1) can be complemented
in trans by ectopic expression of NS1. Prior studies have suggested that the essential intracellular function of NS1 is due to its ability to regulate negative strand synthesis of viral RNA [
22]. Genetic and biochemical studies have suggested that NS1 interacts with NS4A and NS4B, transmembrane viral proteins that span the ER, which could integrate key signals from NS1 for RNA replication occurring in the cytoplasm [
23,
24].
Here, we explored the function of intracellular NS1 in regulating flavivirus replication. We confirmed prior studies [
22,
23,
25] showing that flaviviruses containing an in-frame deletion in NS1 fail to replicate efficiently in cells. In contrast to earlier studies, deletion viruses were rescued by transgenic expression of homologous (WNV) or heterologous (YFV, DENV, JEV, or Saint Louis encephalitis virus (SLEV)) NS1, the latter occurring in the absence of adaptive mutations. Intracellular NS1 played a key role in regulating RNA synthesis and replication complex formation. Viral RNA lacking intact NS1 genes were efficiently translated but failed to form canonical replication complexes at early times after infection, which resulted in an inability to accumulate negative strand viral RNA intermediates.
Discussion
Flavivirus NS1 is a non-structural glycoprotein that is expressed on the plasma membrane of infected cells and secreted into the extracellular space. Secreted NS1 antagonizes complement function in solution and on the plasma membrane surface, and thus serves an immune evasion function [
16‐
18,
37]. Within the cell, even though it is localized to the lumen of the ER and viral replication occurs on the cytosolic face of the ER, NS1 is an essential gene that regulates early viral RNA replication [
22,
38]. How this occurs has been poorly understood, although prior studies suggested NS1 is required for a step proximal to viral RNA synthesis [
22], possibly through interactions with the viral transmembrane proteins NS4A [
23] or NS4B [
24], both of which have direct proximity to the replication complex on the cytosolic face of the ER membrane. In the current study, using two WNV strains that lack a functional NS1 gene and a trans-complementation system, we show that while WNV NS1 was not required for input strand translation of the infectious viral RNA, it was necessary for negative and positive strand RNA synthesis and formation of the replication complex.
While the ability of ectopically-expressed NS1 to trans-complement flaviviruses (WNV or YFV) containing gene deletions in NS1 has been demonstrated previously [
22,
25], our studies show uniquely for WNV that heterologous NS1 from DENV, JEV, SLEV, and YFV all can serve this function. Each heterologous flavivirus NS1 expressed from VEEV replicons trans-complemented ∆-NS1-WNV without further passage. Nonetheless, we observed differences in efficiency, as trans-complementation with DENV, YFV, and SLEV NS1 resulted in smaller plaques sizes and/or lower numbers of infectious foci compared to cells ectopically expressing NS1 from homologous (WNV) or the most closely related (JEV) flaviviruses. In comparison, a prior study showed that ∆-NS1 YFV could not be trans-complemented by DENV-2 NS1 without adaptation, possibly due to an inability to interact with NS4A and the remainder of the YFV replication complex [
23]. Thus, the requirements for regulating replication by NS1 appear conserved enough to allow for trans-complementation of ∆-NS1-WNV by NS1 from other mosquito-transmitted flaviviruses.
Our detailed kinetic experiments demonstrating that an absence of WNV NS1 affects viral RNA synthesis as judged by strand-specific qRT-PCR confirm and extend earlier results with ∆-NS1 YFV that were obtained by Northern blotting [
22]. We show that trans-complemented ∆-NS1 WNV bound to and entered cells, and the input strand of genomic RNA was translated at early time points. Moreover, by using a CMV launched wild type and mutant (∆-NS1 or NS5 polymerase dead) WNV-KUNV, we showed that NS1 is required for formation of the replication complex and recruitment of other non-structural proteins (e.g., NS3) to the vesicle packets [
39] associated with ER membranes; the strength of this experimental approach is that it allows for continued transcription and translation of viral non-structural genes in the absence of a requirement for active replication. However, it remains unclear whether the absence of replication complex after transfection of ∆-NS1 WNV-KUNV was due to the lack of production of dsRNA or the failure to recruit key viral and possibly, host proteins to the specialized ER membranes, which serve as the site of flavivirus replication.
Methods
Cells and viruses
BHK21 cells were grown in complete Dulbecco’s modified Eagle’s medium (DMEM) (supplemented with 10% fetal bovine serum (FBS), penicillin, streptomycin, 10 mM HEPES pH 7.3, and non-essential amino acids) in a 5% humidified CO
2 incubator at 37°C. BHK21 cells propagating VEEV replicons were maintained in complete DMEM supplemented with 5 μg/ml of puromycin. Infection experiments were performed with the New York 1999 strain (385–99) of WNV, which was derived from an infectious cDNA clone [
40], or WNV-KUNV, as detailed below.
Generation of cells propagating VEEV replicons expressing flavivirus NS1
Full length NS1 including the N-terminal signal sequences from WNV (strain New York 1999, amino acids 768 to 1143), DENV-2 (strain D2S10, amino acids 776 to 1127), YFV (strain 17D, amino acids 760 to 1136), SLEV (strain GHA6, amino acids 766 to 1141), and JEV (strain 14-14-2, amino acids 771 to 1146) were amplified from viral RNA or infectious clone cDNA by RT-PCR and PCR using specific primers (Table
1), and cloned into pSTBlue TA (EMD Millipore). To clone the NS1′ form of WNV, one additional nucleotide (T) was introduced at the site of the −1 frame shift by QuickChange mutagenesis using the following primers: forward: 5′-GATATGATTGACCCTTTTTCAGTTGGGCCTTCTG-3′, reverse: 5′-CAGAAGGCCCAACTGAAAAAGGGTCAATCATATC-3′, this resulted in the generation of an NS1′ with an additional 52 amino acids at the C-terminus. After sequence verification, all NS1 genes were subcloned into a modified pSC-B W/VEEV shuttle vector and then into a VEEV replicon (pTC83new/Pac [
41]; gift of I. Frolov) using an XbaI site. VEEV replicon plasmids encoding NS1 were linearized with MluI and used as templates for
in vitro transcription using an SP6 DNA-dependent RNA polymerase mMESSAGE mRNA transcription kit (Ambion) according to the manufacturer’s instruction. RNA transcripts were introduced into cells using a GenePulser Xcell electroporator (Bio-Rad) at 850 V, 25 μF, and infinite Ω, and cells expressing VEEV replicons were selected with puromycin (5 μg/ml) over one week. Flavivirus NS1 expression was confirmed by flow cytometry as described below.
Table 1
Primers for cloning NS1 from different flaviviruses
WNV NS1 forward | GTGGATGGGCGGCCGCACCATGGATAGGTCCATAGCTCTCACGTTT |
WNV NS1 reverse | CATTGACTGCGGCCGCTAAGCATTCACTTGTGACTGCAC |
DENV NS1 forward | GCGGCCGCACCATGGTCTCACTGTCTGTGACACTAG |
DENV NS1 reverse | TCAAGCTGTGACCAAGGAGTTGAC |
YFV NS1 forward | GCGGCCGCACCATGGACATGACAATGTCCATGAGCA |
YFV NS1 reverse | TCAAGCTGTAACCCAGGAGCGCACCAG |
JEV NS1 forward | GCGGCCGCACCATGGACCGATCAATTGCTTTGGCC |
JEV NS1 reverse | TCAAGCATGAACCTGTGATCTGACG |
SLEV NS1 forward | GCGGCCGCACCATGGACAGGAGCATCTCGCTGACTC |
SLEV NS1 reverse | TCAAGCTGTCACGCGAGATTTCACAAG |
Construction and production of ∆-NS1 WNV-NY
Using the pSTBlue vector containing WNV NS1 as a template, a second BstEII restriction enzyme site was introduced at nucleotide 87 of the WNV NS1 gene (from CATAGAC to GGTCACC) by site directed mutagenesis using the following primers: forward: 5′- GACACTGGGTGTGC
GGT C
ACC ATCAGCCGGCTCTAG-3′, reverse: 5′-CTAGAGCCGGCTGAT
GGT G
ACC GCACACCCAGTGTC-3′. Subsequently, after BstEII enzyme digestion and self-ligation, the 840 nucleotides of the NS1 gene (87 to 928) were removed although the reading frame of the NS1 deletion fragment (∆-NS1) remained intact. This ∆-NS1 fragment was subcloned into the two-plasmid system infectious cDNA clone of WNV-NY [
40] to generate p∆-NS1-WNV. Using T7 DNA-dependent RNA polymerase, p∆-NS1-WNV was transcribed
in vitro and transfected into BHK21 or BHK21 VEEV-WNV-NS1 cells. Flow cytometric studies with ∆-NS1 failed to show production of any residual truncated protein using anti-NS1 MAbs that recognize different regions of the intact protein.
Trans-complementation plaque and focus-forming assays
The ability of different flavivirus NS1 to trans-complement ∆NS1-WNV was determined by serially diluting ∆-NS1-WNV (produced in cells ectopically expressing WNV NS1) and then infecting BHK21 cells propagating VEEV replicons expressing WNV, JEV, SLEV, DENV-2, or YFV NS1 for one hour at 37°C. Subsequently, DMEM containing final 4% FBS and 1% low melting agarose was overlaid and incubated an additional 3 days for plaque forming assay or DMEM containing final 4% FBS and 1% methylcellulose was overlaid and incubated for one day for the focus-forming assay. Plaques were stained with 1% crystal violet after fixation with 10% formaldehyde and then counted as described previously [
42]. For the focus-forming assay, cells were fixed with 1% paraformaldehyde for 20 minutes. After removal of the methylcellulose, cells were washed three times with PBS, permeabilized with PBS supplemented with 1% saponin (w/v) and 1% BSA (w/v), and incubated with mouse E16 anti-WNV MAb [
43] for three hours at room temperature or overnight at 4°C. Following three washes with PBS, cells were incubated for one hour with horseradish peroxidase-conjugated goat anti-mouse IgG (Sigma, 1/5,000 dilution), and after additional washes, foci were visualized with TrueBlue peroxidase substrate (KPL) and counted using a BioSpot Analyzer (C.T.L).
Western blotting
Supernatants from BHK21 VEEV-NS1-IS, BHK21 VEEV-WNV-NS1, or BHK21 VEEV NS1′ cells were separated by 12% PAGE, transferred to nitrocellulose membrane using an iBlot dry blotting system (Invitrogen). Membranes were blocked for one hour at room temperature in 50 mM Tris, 150 mM NaCl, 0.05% Tween 20 (TBST) supplemented with 5% non-fat dry milk. Subsequently, WNV NS1 proteins were detected using 16-NS1 MAb [
44] (1 μg/ml) after incubating membranes in TBST supplemented with 2.5% milk overnight at 4°C or 3 hours at room temperature. After extensive washes with TBST, membranes were incubated with HRP-conjugated goat anti-mouse IgG (1/5,000 dilution, Sigma) for one hour at room temperature. Proteins were detected using a chemiluminescent substrate (Supersignal West Femto, Thermo Scientific) and exposure to film (CL-X Posure TM Film, Thermo scientific).
Flow cytometry analysis
To assess total levels of cellular NS1, flow cytometry was utilized. BHK21 cell lines propagating VEEV replicons that expressed WNV NS1, WNV NS1-IS (non-coding), DENV NS1, JEV NS1, SLEV NS1, or YFV NS1 were detached with HBSS containing 5 mM EDTA. Cells were washed twice with PBS on ice, fixed with 2% formaldehyde in PBS for seven minutes, and washed again with HBSS. Cells were permeablized with 0.1% (w/v) saponin and 0.1% BSA in HBSS (permeabilization buffer) and then incubated with primary MAbs (WNV E16 as an isotype control, 9NS1 as a cross-reactive anti-NS1 MAb [
44], 2G6 (DENV NS1-specific) [
45], 4NS1 (WNV NS1-specific) [
44], 10NS1 (reacts with WNV and JEV NS1) [
44], and 4E3 (YFV NS1-specific) [
46] for one hour on ice. After three washes with permeabilization buffer, cells were incubated with Alexa Fluor-647 conjugated goat anti-mouse IgG (Molecular Probe) for 30 minutes and then washed three additional times. Expression levels of NS1 were determined by flow cytometry on a BD FACSArray (Becton Dickinson) and data was processed with FlowJo software (Tree Star, Inc).
Asymmetric positive and negative strand qRT-PCR
Strand-specific real-time RT-PCR was performed as described using E gene primers [
31,
32]. Each transcript reaction was treated with DNAse (Ambion) thrice consecutively followed by RNA extraction with Trizol (Invitrogen) according to the manufacturer’s instruction. PCR was performed with and without reverse transcription to confirm that RNA was free of template DNA. Wild type BHK21 cells or BHK21 VEEV-WNV-NS1 cells (6 × 10
5) were infected with WNV or ∆-NS1-WNV at an MOI of 5. Total cellular RNA was harvested at specified time points using the RNEasy mini kit (Qiagen) following the manufacturer’s instructions, and viral RNA was quantified using fluorogenic quantitative RT-PCR (qRT-PCR). Strand specificity of the qRT-PCR was confirmed using individual asymmetric primer sets and positive or negative strand RNA that was generated from
in vitro transcription reactions after extensive DNAse treatment (data not shown).
Virus attachment assays
BHK21 cell monolayers were detached with HBSS and 5 mM EDTA, washed once with complete DMEM, and washed three times with chilled PBS. Cells (106) were aliquotted into eppendorf tubes and 106 FFU of WNV or ∆-NS1-WNV was added in total volume of 100 μl. After binding for one hour, unbound virus was removed by centrifugation (200 × g) and three washes with chilled PBS. Bound virus was quantified after cell lysis and RNA purification (RNEasy Kit, Qiagen) and quantification of genomic RNA using qRT-PCR and a primer and probe set specific for positive strand specific WNV RNA as described above. Values were normalized to 18S rRNA levels to account for possible differences in cell number.
Microscopic analysis of viral entry
BHK21 cells (6 × 105) were infected with an MOI of 5 of WNV or ∆-NS1-WNV for one hour at 37°C. Unbound virus was removed after three rinses with PBS and complete DMEM was added for specified time points. Subsequently, cells were rinsed with PBS, fixed with 3% paraformaldehyde in PBS for 10 minutes, and permeabilized with PBS supplemented with 0.5% Triton-X 100. After additional washes with PBS and glycine (10 mM), cells were incubated with WNV E16 MAb or a negative control MAb (2G6, anti-DENV-2 NS1) for 20 minutes at room temperature in DMEM containing 10% BSA. After three washes with PBS and 10 mM glycine pH 7.4, cells were incubated for 15 minutes with AlexaFluor 555-conugated goat anti-mouse antibody (1/400 dilution), and nuclei were counterstained with To-PRO 3 (Molecular Probes). After several washes with PBS, cells were mounted on glass slides, and images were acquired with a laser scanning confocal microscope (Zeiss LSM 510 META) and analyzed with LSM image browser software (Zeiss).
Radiolabeling and immunoprecipitation
To compare the initial translation rates, 6 × 105 BHK21 cells or BHK21 VEEV-WNV-NS1 cells were infected at an MOI of 5 of WNV or Δ-DNS1-WNV. At specific time points after infection, cells were starved with methionine free DMEM for 15 minutes, and then labeled for 20 minutes with 50 mCi/ml of 35S methionine and cysteine (EasyTag™ EXPRES35S Protein Labeling Mix, PerkinElmer Life Science). Labeled cells were solubilized in 800 μl of Lysis buffer (50 mM Tris-HCl, pH 8.0, 150 mM NaCl, 1% NP-40, 0.25% sodium deoxycholate, and 1 mM EDTA supplemented with a protease inhibitor cocktail (Sigma)) for 10 minutes on ice. Nuclei were removed by centrifugation (13,800 × g) for five minutes at 4°C. Subsequently, lysates were incubated with WNV E16 MAb (10 mg per sample) for three hours at 4°C. WNV E protein-MAb complexes were immunoprecipitated with protein A-Sepharose beads (Invitrogen) after an additional one-hour incubation at 4°C. Beads were washed three times with 10 mM Tris pH 7.4, 150 mM NaCl, 1% sodium deoxycholate, and 1% NP-40 and proteins were eluted by boiling samples at 95°C for five minutes in 4X SDS sample buffer supplemented with 5% (v/v) β-mercaptoethanol. Eluates were separated by 12% SDS-PAGE, gels were vacuum-dried on filter paper for one hour at 80°C, and proteins were visualized after exposure to Kodak Biomax light film.
Expression and analysis of CMV-launched ∆-NS1-WNV-KUNV
Unique
MluI restriction sites were generated within the NS1 sequence in the full-length WNV expression vector pKUN1 [
35] at residues 4 and 298 (described in [
38]) using site-directed mutagenesis. Briefly, pKUN1 was amplified with
Pfu Ultra Hot-start polymerase (Stratagene) and primers incorporating
MluI sequences (listed in Table
2) as follows: 92°C for 2 min then 18 cycles of 92°C for 30 s, 55°C for 1 min and 68°C for 21 min. Following restriction digestion and Sanger sequencing to verify mutations, plasmids were cleaved with
MluI to remove the majority of NS1-coding sequence, then re-ligated and transformed into JM109 chemically-competent
E.coli cells. Δ-NS1 plasmids were amplified and extracted using a Hi-Speed Plasmid Midiprep kit (Qiagen). A mutation (NS5 GDD to GAA) that abolishes RNA polymerase activity has been described previously [
38], and was made by site directed mutagenesis.
Table 2
Primers for cloning CMV-launched pKUN-∆-NS1
NS1-Mlu1-A-forward | GCTGATACTGGATGTACGCGTGATATAAGTCGGCAAG |
NS1-Mlu1-A-reverse | CTTGCCGACTTATATCACGCGTACATCCAGTATCAGC |
NS1-Mlu1-B-forward | CATCGTGGACCTGCCACGCGTACCACTACAGAGAG |
NS1-Mlu1-B-reverse | CTCTCTGTAGTGGTACGCGTGGCAGGTCCACGATG |
Vero or BHK21-VEEV-NS1 cells were transfected with 1 μg each of pKUN1, pKUN1-NS5-GAA or pKUN1-Δ-NS1 cDNA using Lipofectamine 2000 (Life Technologies) as described by the manufacturer. Two days hours after transfection, cells were fixed in either 1:1 acetone:methanol or 4% v/v paraformeldehyde and permeabilized with 0.1% w/v Triton X-100. Cells were then incubated with MAbs to dsRNA (English & Scientific Consulting Bt. (Hungary)), NS1 and NS5 (kindly provided by R. Hall, University of Queensland) or rabbit polyclonal antisera raised against NS3 [
39] or NS4A [
47]. Confocal images were collected on a Zeiss confocal microscope.
Data analysis
All data were analyzed statistically using Prism software (GraphPad4, San Diego, CA). Differences in viral infection or RNA levels were analyzed using a two tailed, unpaired t-test.
Acknowlegements
We thank I. Frolov, S. Shresta, L. Kramer, A. Khromykh, R. Hall, P. Avirutnan and J. Schlesinger, and P. Y. Shi for the VEEV expression constructs, DENV-2 D2S10 and pKUN1 plasmids, and anti-NS1, anti-NS3, and anti-NS5 antibodies. We thank B. Lindenbach for experimental advice and critical comments on the manuscript.
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
SY and RLA performed all of the experiments. SY and MSD prepared the initial draft of the manuscript, and RLA and JMM edited the manuscript into final form. MSD and JMM supported the work with research grants from the National Institutes of Health (U54-AI057160) and the National Health and Medical Research Council of Australia (No. 100461). All authors read and approved the final manuscript.