Introduction
Chikungunya virus (CHIKV) is a member of the alphavirus genus, which contains 26 known arboviruses with a wide host range [
1]. During the past 50 years, numerous CHIKV epidemics have been documented in both Africa and Asia [
2]. Since, its discovery, CHIKV has spread widely and currently Chikungunya fever has been detected in nearly 40 countries with a potential to affect millions of people worldwide [
3]. In general, alphaviruses are divided into viruses that cause human diseases characterized by rash and arthritis, that are primarily found in the “old world” such as CHIKV, O nyong nyong, Sindbis (SINV), Ross River, Barmah Forest and Mayaro virus [
4] and viruses that cause encephalitis, which are primarily found in the “new world”. The first clear association of an alphavirus with arthritic disease was made in 1953 when CHIKV was isolated from the blood of individuals in Tanzania with severe arthritis [
5]. SINV was first isolated in 1952, which causes similar disease to CHIKV in humans known as sindbis fever and the symptoms include arthralgia, rash and malaise [
6]. These arthritogenic alphaviruses share certain antigenic determinants [
4] and also considerable genome similarity that makes them interesting for comparative responses to the host. In humans, CHIKV infection is characterized by a rapid onset of fever that is cleared in 5–7 days with long lasting immunity [
7]. The major pathology associated with CHIKV infection is very high viremia and polyarthritis [
8‐
11]. The mortality rate associated with CHIKV infection has been estimated to be 1:1000 with most deaths occurring in neonates, adults with underlying conditions and the elderly [
3]. The persistent detection of viral RNA or antigen in the host has suggested the long-term persistence of these viruses in humans [
12,
13]. The alphavirus genome is a single-stranded RNA genome of ~12 kb in size of positive polarity. It encodes two polyproteins of which the first encodes nonstructural proteins (nsPs) 1–4: nsP1 contains methyl transferase and guanyl transferase activities, nsP2 is a helicase/protease, nsP3 is an accessory protein involved in RNA synthesis and nsP4 is the RNA dependent RNA polymerase. The second polypeptide, translated from a subgenomic RNA codes for structural proteins, capsid (C) and the envelope glycoproteins, E1 and E2 that constitute the virion coat [
4,
14,
15]. Several studies have shown that alphavirus replication in mammalian cells usually results in severe cytopathicity, mainly caused by dramatic shutdown of host translation machinery [
16‐
20]. However, the mechanism by which CHIKV maintains such a high replication rate in the infected cells is poorly understood.
One host response mechanism that has the potential to limit virus replication is the endoplasmic reticulum (ER) stress response, also known as unfolded protein response (UPR) which, maintains cellular protein homeostasis and prevents the over-accumulation of unfolded proteins in the lumen of the ER during normal and diseased states [
21]. ER chaperone immunoglobulin heavy chain binding protein (BIP), also known as glucose regulated protein 78 (GRP78) plays a central role in this process via a three-pronged regulatory pathway involving PKR-like ER kinases (PERK), activating transcription factor 6 (ATF-6) and the ER transmembrane protein kinase/endoribonuclease (IRE-1). Under stress conditions, BIP is sequestered to misfolded or unfolded proteins in the ER whereupon it activates PERK, ATF-6 and IRE-1 [
22]. During UPR, PERK activates by self-dimerization and phosphorylation. Activated PERK phosphorylates eIF2α at serine-51 and leads to an inhibition of general protein synthesis. PERK activation also induces the activation of C/EBP homologous protein (CHOP) and growth arrest and DNA damage-inducible protein GADD34 [
23]. CHOP is responsible for apoptosis mediated cell death when functions of ER are severely impaired to protect the organism by eliminating the damaged cell [
24] whilst GADD34 and its binding partner protein phosphatase-1 catalytic subunit (PP1c) are involved in eIF2α de-phosphorylation that also modulates cell fate during protein translational stress. The activation of IRE-1 branch of UPR pathway leads to transcription induction of a subset of genes encoding protein degradation and pro-survival enzymes such as components of ER associated degradation (ERAD) including ER degradation-enhancing-α-mannosidase like protein (EDEM) [
25‐
27]. Autoproteolytic activation of ATF-6 stimulates transcription of genes encoding chaperones that assist in the refolding of misfolded proteins [
28]. On balance, the UPR pathway in conjunction with ERAD controls the survival vs apoptosis decision of cells stressed by increased protein translation from external stimulus [
29].
To circumvent the host cellular translational response, several viruses [respiratory syncytial virus, simian virus-5, Tula virus, African swine fever virus, herpes simplex virus, cytomegalovirus, dengue virus and hepatitis C virus [
30‐
34] have been shown to regulate UPR machinery. For example, in the case of hepatitis C virus, the virus encoded NS5A phosphoprotein, inhibits PKR activation by direct protein-protein interaction [
35]. Likewise, K3L gene product of vaccinia virus also binds to PERK and inhibits its activation [
36]. Others such as herpes simplex viruses encode proteins that mimic host factors to regulate the protein synthesis traffic [
37]. In light of these various mechanisms by which viruses modulate UPR pathway, we investigated the impact of CHIKV replication on the various components of the UPR machinery and compared it to another representative alphavirus, SINV, in order to reveal differential host responses to these unique but closely related pathogens. Real-time RT-PCR monitoring of transcriptional changes and Western blotting of infected cells were used to reveal the UPR components during both CHIKV and SINV infections. By carefully examining the UPR pathway components and by selectively inducing the ER stress using thapsigargin or tunicamycin treatment, we identified the suppression of eIF2α phosphorylation during CHIKV infection in the early phase of virus replication that does not occur with SINV infection. Subsequently, transfection of individual CHIKV-encoded proteins as GFP-fusion proteins revealed a mechanistic basis for the phenomenon dependent on nsP4.
Materials and methods
Cells and viruses
Mosquito cells
Aedes albopictus clone (C6/36) and baby hamster kidney cells (BHK-21) were cultured in RPMI-1640 medium (Gibco) supplemented with 10% fetal bovine serum (FBS) (Gibco). Human embryonic kidney cells (HEK293) and human lung fibroblast cells (MRC-5) were cultured in DMEM (Gibco) supplemented with 10% FBS. C6/36 cells were grown and maintained in 28°C temperature incubator. BHK-21, MRC-5 and HEK293 cells were grown and maintained at 37°C in a humidified incubator with 5% CO
2 atmosphere. CHIKV strain ‘ROSS’ and a laboratory strain of SINV MRM-39 strain (isolated in Australia [
38]) was a generous gift from Dr. Ooi Eng Eong (Duke-NUS GMS). Both the viruses were amplified in C6/36 cells supplemented with 5% FBS at 28°C and titrated by plaque assay as described previously [
39]. Low passage number (below passage 5) was used for performing all experiments. Tunicamycin (Sigma) or thapsigargin (sigma) was used to induce UPR stress in the cells.
In vitro virus quantification
Prior to their use, plaque assays were carried out to quantify the number of infectious viral particles for CHIKV and SINV viruses used in the study. Briefly, BHK-21 cells were cultured to approximately 80% confluency in 24-well plates (NUNC). The virus stock was 10-fold serially diluted from 10−1 to 10−12 in RPMI 1640 (Gibco). BHK-21 monolayers were infected with 200μl of each virus dilution. After incubation at 37°C and 5% CO2 atmosphere for 1h with rocking at 15 min intervals, the medium was decanted and 1ml of 1% (w/v) carboxymethyl cellulose in RPMI supplemented with 2% FBS was added to each well. After 72h of incubation at 37°C in 5% CO2, the cells were fixed with 4% paraformaldehyde and stained for 30 min with 200 μl of 1% crystal violet dissolved in 1X-PBS. After thorough rinsing with water, the plates were dried and the plaques were scored visually.
Primer sequences used in the study
Real-time PCR primer sequences: - CHIKV nsP1 (F-TAGAGCAGGAAATTGATCCC, R- CTTTAATCGCCTGGTGGTAT), SINV E1 (F-CACCCCGCACAAAAATGAC, R- AAAAGGGCAAACAGCCAACTC), EDEM (F-TCATCCGAGTTCCAGAAAGCAGTC, R- TTGACATAGAGTGGAGGGTCTCCT), XBP-1 (F-TCACCCCTCCAGAACATCTC, R- ACTGGGTCCAAGTTGTCCAG), CHOP (F-TCTGATTGACCGAATGGTG, R- TCTGGGAAAGGTGGGTAGTG), BIP (F-TAGTGCAAGCTGAAGGCTGA, R- GGGCTGGAGTACAGTGGTGT), GADD34 (F-AACCTCTACTTCTGCCTTGTCT, R- CGCCTCTCCTGAACGATACTC), eIF2αK2 (F-TTTGGACAAAGCTTCCAACC, R- ACTCCCTGCTTCTGACGGTA), 18s (F-TGTTCAAAGCAGGCCCGAG, R-CGGAACTACGACGGTATCTGATC), GAPDH (F- ACAGTCAGCCGCATCTTCTT, R- ACGACCAAATCCGTTGACTC), Actin (F-CAGGGGAACCGCTCATTGCCAATGG, R-TCACCACACACTGTGCCCATCTACGA), XBP-1 splicing (F- AAACAGAGTAGCAGCTCAGACTGC, R- TCCTTCTGGGTAGACCTCTGGGAG).
CHIKV recombination cloning primer sequences: - nsP1 (F- AGATCTCGAGCTCAAGCT TCGATGGATCCTGTGTACGTG, R- TTAACCGTCGACTGCAGATCCTGCACCCGCTCTGTC), nsP2 (F- TCCGGACTCAGATCTCGAGCTATAATAGAGACTCCGAGAGGA, R-GGATCCCGGGCCCGCGGTACCACATCCTGCTCGGGTGGC), nsP3 (F- TCCGGACTCAGATCTCGAGCTGCACCGTCGTACCGGGTA, R- GGATCCCGGGCCCGCGGTACCCCCACCTGCCCTGTCTAG), nsP4 (F- TCCGGACTCAGATCTCGAGCTTATATATTCTCGTCGGAC, R- GGATCCCGGGCCCGCGGTACCCTATTTAGGACCGCCGTA), Capsid (F- TCCGGACTCAGATCTCGAGCTTGCATGAAAATCGAAAATGAC, R- GGATCCCGGGCCCGCGGTACCCCACTCTTCGGCTCCCTC), E2 (F- AGATCTCGAGCTCAAGCTTCGCCATACTTAGCTCACTGT, R- TTATCTAGATCCGGTGGATCCGCAGCATATTAGGCTAAG), E1 (F- AGATCTCGAGCTCAAGCTTCGAGAACAGCTAAAGCGGCC, R- TTATCTAGATCCGGTGGATCCTTAGTGCCTGCTGAACGA).
RNA extraction and real-time RT-PCR analysis
HEK293 cells (1×105) were infected with virus (CHIKV/SINV) at a multiplicity of infection (MOI) of 1. At indicated time intervals, total RNA was isolated using the trizol (Invitrogen) extraction method and 1μg of total RNA was used for cDNA synthesis using ImProm II reverse transcription system (Promega), with oligo dT as primer. cDNA (50 ng) was used for real-time amplification of specific genes using respective primers (Materials and Methods) in Bio-Rad iQ-5 real time thermal cycler. The expression of viral and host gene products was normalized to Actin and GAPDH mRNA expression, followed by normalization to expression levels at uninfected conditions.
XBP-1 splicing assay
The XBP-1 splicing assay was performed essentially as described elsewhere [
40]. Briefly, total RNA from the mock or virus (CHIKV/SINV) infected cells was extracted as described above and 1 μg each of the total RNA was used for cDNA synthesis using ImProm II reverse transcription system (Promega), with oligo dT as primer, followed by PCR amplification of XBP-1 spliced genes using XBP-1 splicing specific primers (Materials and Methods). Amplified products were run on 2.5% Agarose gel and visualized under UV ImageQuant.
Western blotting
HEK293 cells (1×105) were infected with MOI of 1 with CHIKV/SINV and total cell lysate was collected in NET lysis buffer (20 mM Tris, 100 mM NaCl & 1 mM EDTA) containing 0.1% Triton X-100 with protease inhibitor cocktail (Roche) at indicated time points post infections. After 30 min on ice, lysates were centrifuged at 13000 rpm for 10 min and supernatants were used to quantitate the amount of total protein by BCA assay (Pierce). Equal amount (2-5 μg each) of protein was loaded on 12% SDS PAGE followed by Western blotting. Blots were blocked overnight with blocking solution [2% Fish gelatin (sigma) in 1X PBS] and were probed using primary antibodies against various proteins: GFP (Abcam), BIP (Abcam), ATF-6 (Abcam), HSP-90 (cell signaling), p58IPK (cell signaling), CHOP (cell signaling), phospho (Thr 980) PERK (cell signaling), eIF2α (cell signaling) and phospho (Ser 51) eIF2α (cell signaling). Anti-GAPDH antibody (cell signaling) and anti-Actin antibody (sigma) were used as the loading control antibodies. All the antibodies used were diluted in blocking solution. After incubating with secondary HRP-conjugated antibodies, blots were developed using ECL detection reagent (GE healthcare) and exposed on Amersham hyper films prior to development or visualized using Image-quant chemiluminiscent machine. Where required, image quantification was done using Image-J software.
Construction of CHIKV-pEGFP clones
Vector pEGFP-C1 (Clontech) was used to clone all the four non-structural (nsP1-4) and three major structural (C, E2 & E1) genes of CHIKV. Briefly, CHIKV RNA was extracted using a viral RNA extraction kit (Qiagen). All the genes were amplified using gene specific primers (Materials and Methods) and superscript III one step RT PCR with platinum Taq kit (Invitrogen) in a thermal cycler (Applied Biosystem). Amplified genes were run on 1% agarose gel and amplicons were gel eluted using QIA-quick gel extraction kit (Qiagen). Individual purified PCR products were then inserted in to the pEGFP-C1 vector using cloneEZ PCR cloning kit (Genscript) as per the manufacturer’s recommendations. For convenience of restriction digestion analysis for screening positive clones, nsP1 was inserted in between HindIII-PstI restriction sites and nsP2-4 and C were cloned using XhoI-KpnI restriction sites. Similarly, E1 and E2 were cloned using HindIII-BamHI restriction sites. All the positive clones were further confirmed by DNA sequencing.
Transfection of plasmids
For transfection of plasmid DNA into HEK293 or MRC-5 cells, cells were seeded to 70% confluency in a 24 well plate (Nunc) and incubated overnight in 37°C incubator supplemented with 5% CO2 atmosphere. One μg of each of the plasmids (GFP vector, GFP-nsP1/2/3/4 or GFP-C/E1/E2) was transfected using jet prime transfection reagent (Polypus BST scientific) as per the manufacturers described protocol. Transfected cells were incubated for 48h for protein expression and then washed once with 1X-PBS (Gibco). Finally, cells were collected in TNET-lysis buffer as described above and then subjected to Western blotting. The transfection efficiencies by fluorescence microscopic visualization for each of the plasmids except GFP-nsp2 were measured to be around ~70% using polyplus jet prime transfection reagent, strictly as per the manufacturer’s protocol. For GFP-nsP2 transfection was done using 2 μg of the plasmid and nearly 60% of transfection efficiency was achieved. No cytotoxicity was observed upon transfection of plasmids till 72h post transfection. However, with GFP-nsP2 some cytotoxicity (less than 20% cell death) was observed after 48h post transfection.
Immunofluorescence
HEK293 cells were seeded on coverslips at a density of 1×105 cells/well in a 12-well plate. Following incubation for overnight at 37°C with 5% CO2, the cells were infected with CHIKV or SINV at an MOI of 1. At indicated time points after infection cells were fixed with ice cold 80% acetone for 10 min followed by overnight incubation with blocking buffer (5% BSA in 1X PBS) at 4°C. The CHIKV RNA was detected using monoclonal dsRNA antibody (J2). The phosphorylated form of ER resident protein eIF2α was detected using antibody against phospho (Ser 51) eIF2α (cell signaling). Secondary antibodies used were anti-mouse alexa 488 and anti-rabbit alexa 594. All the antibodies used were diluted in blocking buffer. The coverslips were mounted on glass slides using prolong gold anti-fade mounting medium (Invitrogen) containing DAPI. Immunofluorescence images were captured using an inverted fluorescence microscope (Olympus IX71, USA) or upright confocal microscope (Zeiss) and image analysis was performed with Image-J software.
Statistics
Statistical comparison of results were performed using unpaired Student’s t test on the GraphPad Prism 5.0 software with p<0.005 considered statistically significant.
Discussion
Virus infection in mammalian cells consists of a series of events from entry to maturation and egress of virus. Remarkably, as intracellular parasites, viruses rely on the utilization of cellular machinery and resources to complete their life cycle. In this complex process, RNA viruses synthesize dsRNA intermediates and produce viral proteins within host cells. Consequently, viral replication elicits cellular responses, such as ER stress and the interferon response, as a first line of defense against the invading pathogen. To overcome this natural resistance, viruses have evolved various mechanisms to subvert host responses that limit or inhibit viral replication. Recently, several groups [
44,
57‐
59] have reported the impact of CHIKV or SINV replication on host cellular interferon and apoptotic machinery. In this study we specifically examined the cellular UPR signaling during CHIKV and SINV infections and show that the gene/protein expression responses in the pathway are differentially modulated although the two viruses are considered to be closely related to each other. We explored in more detail the mechanistic basis for CHIKV modulation of the UPR pathway.
The stimulation of transcription and translation of BIP (the master regulator of UPR) has been observed for several viruses [
33,
60]. Not surprisingly the massive replication of CHIKV resulted in the induction of ER resident chaperones, such as BIP and HSP-90, which presumably assists in the folding of unfolded proteins in order to relieve the UPR stress within the cell. SINV infection, on the other hand, did not show significant induction in the expression of BIP and HSP-90, suggesting the possible early buildup of ER stress, which may contribute to the apoptosis and early cell death that was observed [
61]. However SINV infection caused a more pronounced IRE-1 mediated splicing of XBP-1 gene that resulted in transcriptional induction of XBP-1 and EDEM, a pro-survival gene-product. Although the induction of XBP-1 and EDEM was less prominent during CHIKV infection in comparison to SINV infection, the present data is consistent with the recently reported role of IRE-1 signaling in delaying caspase-induced cell death [
62]. In the PERK branch of UPR pathway, the phosphorylation of PERK was observed in both CHIKV and SINV infected cells but intriguingly the kinetics of the concomitant phosphorylation of eIF2α showed marked difference between the two. At the early time points following CHIKV infection although increased PERK phosphorylation could be detected from 12 h post infection, the phosphorylation of eIF2α was not detected until 48h post infection whereas in SINV infected cells the eIF2α phosphorylation could be detected from 3 h post infection. This discrepancy was addressed by treating CHIKV infected cells with thapsigargin or tunicamycin, the well known strong inducers of PERK and eIF2α phosphorylation. This clearly demonstrated that eIF2α phosphorylation in the cell was suppressed at the early stages of CHIKV infection (3-24 h) even with thapsigargin or tunicamycin treatment so as to allow high and sustained viral protein production without building up the ER stress. At 48 h post CHIKV infection the eIF2α phosphorylation was quite prominent and comparable to the level observed at the same time point in SINV infected cells. However at this time point GADD34, a negative regulator of PERK, which mediates the de-phosphorylation of phospho-eIF2α and p58IPK, a chaperone, which suppresses the PERK mediated phosphorylation of eIF2α were also induced, suggesting that even when the cell tries to overcome its control by CHIKV infection, negative loop transcripts like GADD34 and p58IPK are activated in order to rescue viral protein synthesis. To further explore the importance of GADD34 in mediating CHIKV induced suppression of eIF2α-phosphorylation we used a specific GADD34 inhibitor ‘salubrinal’. Interestingly salubrinal treatment during CHIKV infection lead to an increased phosphorylation of eIF2α suggesting the involvement of GADD34 in suppression of eIF2α-phosphorylation. Salubrinal treatment during SINV infection however did not show any significant change in the phosphorylation of eIF2α over untreated SINV infected cells. Also, interestingly CHOP activity was not detected at both protein and transcription levels throughout the CHIKV infection time course. In stark contrast to CHIKV, SINV infection leads to phosphorylation of PERK and a dramatic increase in the phosphorylation of eIF2α starting from 3h post infection. The enhanced expression of CHOP detected as early as 3h suggests the signature cell death by apoptosis during SINV infection. Although, GADD34 was transcriptionally induced during SINV infection the heightened phosphorylation of eIF2α and further increase in CHOP activity triggers massive cell death, which could be observed starting from 12 h post infection (data not shown). Altogether, our data suggest that the PERK branch of UPR pathway is regulated during CHIKV infection as reflected by the suppression in the phosphorylation of eIF2α during the early stage of infection and the reduced CHOP activity.
A mechanistic basis for the suppression in the phosphorylation of eIF2α during the early stage of CHIKV infection was investigated using EGFP-tagged clones of seven CHIKV proteins and we discovered that the observed phenotype in the PERK pathway (i.e. suppression of the phosphorylation of eIF2α) is mediated by CHIKV nsP4 protein, which contains the RNA-dependent-RNA polymerase activity. An interesting conjunction to our finding is that nsP4 protein of alphavirus is the first non-structural protein to be cleaved from the nsP1-4 polyprotein. and this cleavage as well as its enzymatic activity play a critical role in the synthesis of minus strand viral RNA [
4]. Furthermore it is also well known that the alphavirus nsP4 is unstable, short-lived and degrades rapidly in the infected cell [
63]. This instability of nsP4 could possibly explain why infected cells recover some degree of eIF2α phosphorylation in the late phase of infection (48 h). Together, we suspect that early suppression of the translation inhibition involving nsP4 could permit the buildup of template RNA for further translation and, thereby, support robust replication.
The question of how CHIKV regulates the host translational machinery to achieve a high level of replication is important to examine in detail particularly in light of seemingly contradictory reports on this topic. White et al. [
59], reported independence of CHIKV induced translational shut-off from the phosphorylation of eIF2α, an intriguing finding since eIF2α phosphorylation has a well established role in the shut-off of the host translational machinery [
64]. However, in our detailed time course experiments with HEK293 cells, we did not observe eIF2α phosphorylation until 48 h post infection, which was also consistently not observed in another cell type MRC-5 cells until 48 h. We believe our detailed time course study provides advantage in understanding the complex early events of virus-host interactions in the UPR pathways. That it occurs, mechanistically, is interesting since the actions of transiently stable nsP4 function correlate to viral RNA replication and life cycle. Even at the late phase of infection induction of ER chaperones (BIP, HSP-90) along with pro-survival gene-product (EDEM) could work synergistically with negative regulators of eIF2α phosphorylation (p58IPK, GADD34) to possibly support sustained CHIKV replication. SINV infection, on the contrary, is characterized by uncontrolled UPR as reflected by its failure to induce synthesis of ER chaperones followed by increased phosphorylation of eIF2α and CHOP activity leading to early cell death. Since both CHIKV and SINV infections showed differential activation or modulation of the UPR, further detailed studies on the effects of infection on host cellular UPR machinery is required to better understand their characteristic prolific replication profiles.
In conclusion, we show that the two closely linked viruses CHIKV and SINV from the same family, responds differently to the host cellular UPR machinery. Indeed, CHIKV infection modulates the PERK branch of UPR machinery and that it occurs mechanistically through the involvement of the viral protein nsP4 in direct or indirect conjunction with host factors such as GADD34. The early suppression of UPR provides a mechanism for robust replication. Our observation opens up the possibility to explore in detail the interplay of CHIKV nsP4 protein in establishing the infection and exploit possible avenues to use this in identifying a suitable target for antiviral intervention.
Competing interests
The authors declares that they have no competing interests.
Authors’ contributions
AR carried out all the experiments and analysis reported in this manuscript. SV conceived the study. SV and MN participated in design and analysis of experiments together with AR and helped to draft the manuscript. All authors read and approved the final manuscript.