Envelope 2 protein phosphorylation sites S75 & 277 of hepatitis C virus genotype 1a and interferon resistance: A sequence alignment approach

Serum samples were collected at the Division of Molecular Virology, National Centre of Excellence in Molecular Biology, University of the Punjab, Lahore. HCV 1a genotype serum samples were used in the current study. 100 μl serum was used to extract viral RNA by using RNA Isolation Kit (Sacace, Italy). Primer 3 software was used to designed primer for the amplification of E2 gene. At 5' end a start codon was introduced artificially in the primers for expression of gene in mammalian cell culture. The required amplified product was of approximately 1089 bps which was confirmed on ethidium bromide stained 1.2% agarose gel evaluated under UV transilluminator and photographed. The necessary band was cut out from the gel and the DNA was extracted with DNA isolation kit (Fermentas Inc. Germany). Isolated DNA was suspended in depc treated water and used for further studies.

Mammalian expression vector pcDNA 3.1 (Invitrogen Tech USA) was used to clone the amplified product encoding E2 gene between Hindi III and EcoR I sites. The plasmid was transformed in chemically-competent cells. The entire ligation reaction was added to a 100 μl aliquot of TOP10F cells. Then 500 μl of SOC medium was added to the cells and incubated at 37°C for 1 hour. Competent cells having plasmid were then selected by spreading the culture onto a Luria-Bertani (LB) agar plate containing 100 μg/ml ampicillin and 12.4 ug/ml tetracyclin. Colonies selection was made by incubating the plate overnight at 37°C. To identify bacteria harboring cloned E2 gene, individual colonies were used to directly inoculate PCR reactions. The PCR reactions were prepared with 5 pmol each of vector-specific primers i.e. T7 (TAATACGACTCACTATAGGG) and BGH (TAGAAGGCACAGTCGAGG). Each reaction was prepared to a final volume of 20 μl. Following amplification, the amplified product was checked on a 1.2%, ethidium bromide stained agarose gel, a successful cloning reaction being visualized as a product at approximately 1.3 kb. Colonies identified as possessing a desired clone were then used to inoculate 3 ml LB culture containing 100 μg/ml ampicillin, shaking at 225 rpm overnight at 37°C. Plasmid was purified using a Plasmid Miniprep Kit, (Fermentas Life Sciences technologies, USA) according to manufacturer's protocol. Quantification of the plasmid prep. was performed by using spectrophotometer. Successful cloning was confirmed through PCR, restriction digestion of plasmid (pcDNA 3.1/myc vector) with EcoR1 & Hindi III and sequencing reaction. At least three clones were sequenced in both directions according to the sequencing protocol.

Applied biosystems prism dye termination method was used to sequence the DNA (PCR products and plasmids) with specific sense and anti sense primers. The sequences reported in this paper have been deposited in genbank database (Accession no. GU736411). In a 10 μl, of total reaction volume, about 300 ng of plasmid, 10 pmol of primer, 1 μl of big dye and 1 μl of dilution buffer were used for each sequencing reaction. Sequencing was achieved in a thermal cycler with parameters; 94°C for 20 s, 58°C for 20 s, 60°C for 4 min, repeated 25 times. The pellet was air dried and DNA was analyzed using an ABI prism sequencer.

To study the possible outcome of predication with help of NetPhos 2.0 software as described by Blom et al. (1999) [29]. This software checks the possible post translation modification in the local 1a local strain primary sequence in the amino acid. As a result of analysis the target motif for different kinases is visualized [29, 30]. Scansite is kept at low stringency in order to determine the maximum number of sites that may participate in phosphorylation, upon which further predication is done.

An ab-initio model was designed by using I-TASSER as no template model was available in protein Data Bank [31]. Data was uploaded and models were generated. A 3D structure of predicted phosphorylation sites was generated by using two servers, Chimera [31] and SWISS PDB viewer [32] were used to obtain 3D structure. It was checked that potential phosphorylation sites are surface exposed or hidden inside. Five sites were observed at the exposed surface of model (aa: S75, S95, S118, S277, Y211).

Protein sequences of envelope gene for genotype 1a from different countries of the world (Japan, France, USA, and UK) were obtained from NCBI. All sequences (GQ898898, EU482831, EU234064, EU362889, DQ061315, AY958052, AY958057, AY956468, AB520610, and AF529293) were then aligned with local envelope gene by using CLUSTALW [33]. A neighbor joining tree was generated using PHYLIP (Figure 1) [34].