Opposite regulation by PI3K/Akt and MAPK/ERK pathways of tissue factor expression, cell-associated procoagulant activity and invasiveness in MDA-MB-231 cells

Human breast cancer epithelial cell lines MDA-MB-231, human ovarian epithelial cell lines SKOV-3 and OVCAR-3 were obtained from the American Type Culture Collection (Rockville, MA, USA). Cells were cultured in Dulbecco's modified Eagle’s medium(DMEM) supplemented with 10% fetal bovine serum (FBS), 1% L-glutamine, and 1% sodium pyruvate (all from Invitrogen, USA) at 37°C in a humidified atmosphere containing 5% CO₂. To determine the roles of MAPK/ERK and PI3K/Akt in TF expression, PD98059 (Calbiochem, San Diego, USA), a selective inhibitor of MAPK/ERK kinase (MEK); LY294002 (Sigma-Aldrich, USA) and wortmannin (Sigma-Aldrich, USA), PI3K inhibitors; an Akt1/2 inhibitor A6730 (Sigma-Aldrich, USA); erlotinib (TARCEVA, Genentech, USA), an inhibitor of EGFR; an anti-EGFR antibody cetuximab (Merck Serono, Switzerland), Akt siRNA(s659, s660), ERK siRNA(s11140, s11141), EGFR siRNA(s564, s565) and scrambled oligonucleotide (Applied biosystem, CA, USA) were used to treat the cells for 24 h [19]. siRNA transfection was performed with INTERFERin (Polyplus-transfection SA, France) with the mixture of 2 siRNAs (2 × 15 nM of each siRNA) to knockdown one gene.

MDA-MB-231 cells at 30%–40% confluence were transfected with a constructed plasmid pGL4-TFluc, carrying firefly luciferase reporter gene under the control of the promoter of human TF within −2174 ~ +128[20]. Transfected cells were then selected by hygromycin (Invitrogen, USA) at the concentration of 400 μg/ml. Survived clones of the cells were screened for bioluminescence in the complete media supplemented with luciferase assay system (Promega, USA) in FLUOstar Optima Microplate Reader (Germany). The established cell line MDA-MB-231-TFluc was used for evaluating the TF gene expression. After the treatment with the agents at the indicated concentrations and time periods, the harvested cells were washed, counted with trypan blue exclusion assay to check the cell viability. The bioluminescence of the samples was then quantified for TF promoter activity. In our experiments, the cells gave maximal luminescence level at 24–48 h after the treatment (Figure 1a).

The treated or non-treated cells were harvested and total RNA was prepared by SV total RNA isolation system kit (Promega, USA). The purity of total RNA were checked by a ratio of A260/A280 (>1.9). Total RNA (50 ng) was used to synthesize cDNA in 20 μl reaction solution using a kit of GoScript Reverse Transcription System (Promega, USA). Then 2 μl of cDNA was used for qPCR assay in triplicates with taqman® gene expression assay method. The primers and probes for total human tissue factor (Hs00175225_m1) and for the control TATA box binding protein (TBP, Hs99999910_m1) were purchased from Applied biosystem. The primers and the probes for flTF (forward primer: TGATGTGGATAAAGGAGAAAACTACTGT, reverse primer: CTACCGGGCTGTCTGTACTCTTC, probe: FAM- TTCAAGCAGTGATTCCCTCCCGAACA–TAMRA); and asTF (forward primer: GGGATGTTTTTGGCAAGGACTTA, reverse primer: CCAGGATGATGACAAGGATGATG, probe: FAM-AATCTTCAAGTTCAGGAA AGAAATATTCTACATCATTGGA-TAMRA) were purchased from Eurogentec, Belgium [21]. The qPCR was performed by 10 min of initial denaturation and 44 cycles of 15 s at 95°C, 60s at 60°C in a CFX96® Real-time System (BioRad). Delta delta Ct method was used for analyzing qPCR results.

The cells were treated with 5–50 μM PD98059, 10 μM LY294002, 0.1 μM wortmannin, 10 μM A6730, 0.1 μM erlotinib, and 50 nM cetuximab or 30 nM of the mixture of siRNA for indicated time periods and washed 3 times. Cell lysates was obtained by incubating the cells in a lysis buffer [10 mM Tris pH 6.8, 1 mM EDTA, 10% NP40, 1 mM PMSF, 1% SDS plus protease inhibitor cocktail and phosphotase inhibitor cocktail 2 (Sigma) on ice for 30 min. Cell debris was removed by centrifugation at 16000 g for 10 min. Protein concentration was determined by a BCA^TM protein assay kit (Thermo Scientific, USA). Fifty microgram protein of each sample was loaded on 8% of SDS-PAGE gel for electrophoresis, and the protein was transferred onto polyvinylidene flroride (PVDF) membrane by the iBlot^TM dry blotting system (Invitrogen, USA). The membranes were blocked by 5% nonfat dry milk for 1 h and incubated with either monoclonal anti-TF antibody (# 4509, American Diagnostica, USA), or anti-phospho-Akt (Ser473) antibody or anti-Akt polyclonal antibody (# 9271 and 9272, cell signaling, USA) at 4°C for overnight, then the membranes were washed with Tris Buffered Saline-tween 20 (TBS-tween) buffer for 1 h and incubated with appropriate horseradish peroxidase (HRP)-conjugated secondary antibodies (Invitrogen, USA) diluted in blocking buffer for one hour at room temperature. After washing, western blotting luminol reagent (Santa Cruz Biotechnology, USA) was added onto the membranes and the chemiluminescence was recorded in a Fuji LAS-3000 system. Then the membranes were treated with antibody stripping buffer (Gene Bio-application Ltd. Israel), and incubated with anti-actin antibody (1:4000 dilution, Sigma, USA) and secondary antibodies for control. The results of western blot were quantified with Gel-Pro Analyzer software version 4.0.00.001 (Media Cybernetics, Bethesda, MD, USA).

MDA-MB-231 cells were treated for 24 h with 10 μM of PD98059, 10 μM of LY294002, 0.1 μM of wortmannin, or DMSO as control. Then the cells harvested with non-enzymatic detachment method were washed 3 times and suspended in barbital buffer at 10⁵/ml. Coagulant activity was tested at 37°C by adding 50 μl of cells to 100 μl of citrated normal plasma and 100 μl of 0.25 M CaCl₂. The clotting time for each sample was determined from the addition of CaCl₂ to the formation of first fibrin strand. The assay included a standard curve made with thromboplastin at the dilutions of 1:25 (100% activity), 1:50, 1:100, 1:200, 1:400, and 1:800. The cell membrane-associated TF activity determined with the clotting time was converted to thromboplastin procoagulant activity units (neoplastin, Stago, Asnières, France). The result is presented as percentage of the change in comparison with control cells. All the experiments were performed at least 3 times and each experiment was in triplicates.

MDA-MB-231 cells were treated with 10 μM of PD98059, 10 μM of LY294002, 0.1 μM of wortmannin or control DMSO for 24 h. The cells were washed 3 times and 0.5 ml of the cells (5 × 10⁴/ml) were seeded into each upper chamber of 24-well matrigel-coated invasion chamber and 0.75 ml DMEM supplemented with 5% fetal bovine serum was added into the lower chamber (BD Biosciences, USA). The invasion chambers were incubated for 22 h according to the manufacture’s protocol. Then the non-invading cells were removed from the upper surfaces of membranes by scrubbing with cotton tipped swabs and the cells on the lower surfaces of the membrane were fixed with 100% methanol and stained with 1% toluidine blue, the invading cells numbers were counted under an inverted microscope, and the invasion index were obtained by calculating the averages of the number of the cells per observation field of each sample in comparison with the control groups. The experiments was performed with 6 samples for one condition and repeated 3 times.

Data were analyzed by Student’s t-test, one-way ANOVA and Mann–Whitney U test as appropriate. The data of qPCR and invasion assay are presented as mean ± SEM. The rest of data is presented as mean ± SD. A probability value ≤0.05 was regarded as significant.

To facilitate evaluating TF gene expression, we constructed a sub-cell line MDA-MB-231-TFluc, selected by antibiotic hygromycin resistance, which carries TF promoter that drives luciferase gene. The sub-cell lines showed a constitutive luminescence around 5×10⁴ channel numbers compared to the background levels of 30–50 channel numbers of the negative control parental cells.

PI3K inhibitors LY294002 and wortmannin, showed significant inhibitory effect on the TF promoter activity in MDA-MB-231-TFluc cells. As demonstrated in the decreased bioluminescent levels, TF promoter-driven luciferase activity was inhibited by both inhibitors (IC₅₀ = 8.8 μM for LY294002 and IC₅₀ = 0.12 μM for wortmannin) (Figure 1b, 1c). The inhibition of TF promoter activity was statistically significant and in a dose dependent manner for these two agents. Furthermore, the inhibitory effect of both agents was observed within the dose ranges of inhibitory activity as reported in the literature, showing that the effects were specific.

In contrast, ERK inhibitor PD98059 dramatically enhanced TF promoter-driving luciferase activity in the cells. A peak of activity was observed after 24 h treatment (Figure 1a). This enhancement was statistically significant, dose dependent and observed within the published dose range of its inhibitory effect on ERK.

According to the obtained results, MDA-MB-231 cells were treated with 10 μM LY294002 and 0.1 μM wortmannin. The qPCR and western blotting analysis showed that both LY294002 and wortmannin induced a remarkable decrease in TF mRNA and protein levels (Figure 2a,c). In contrast, PD98059 treatment enhanced dose-dependently tissue factor mRNA and protein levels in the cells (Figure 2a,b,c). qPCR assay with ERK siRNA confirmed the effect of PD98059 (Figure 2a). These results were well correlated with the data of luminescence assay.

We examined the relationship between PI3K and ERK pathways in the regulation of TF promoter in MDA-MB-231-TFluc cells. The MDA-MB-231-TFluc cells were treated by PD98059 in the presence of LY294002 or of wortmannin and the luminescence levels were determined. The results showed that both PI3K inhibitors could significantly suppress the PD98059-induced reporter gene expression (Figure 3a). Then MDA-MB-231 cells were treated in a similar way and their TF mRNA levels were quantified by qPCR method. The results showed that LY294002 and wortmannin as well as Akt inhibitor A6730 significantly suppressed PD98059-enhanced TF mRNA trnascription (Figure 3b). As Akt phosphorylation is a down-stream event of the activated PI3K, pAkt was checked in MDA-MB-231 cells. We found that pAkt level was enhanced by PD98059 treatment and this enhanced pAkt level was significantly inhibited by LY294002, showing a close relationship between ERK inhibition and Akt phosphorylation (Figure 3c).

Gan Y et al. have suggested that EGFR activity was involved in ERK inhibition-induced activation of PI3K/Akt pathway [22]. We used EGFR inhibitor erlotinib together with PD98059 to the culture of the MDA-MB-231-TFluc cells. The results confirmed the inhibition of PD98059-enhanced cell luminescence by erlotinib (Figure 4a). The results of qPCR also showed a significant inhibition of TF transcription by both erlotinib and anti-EGFR antibody cetuximab (Figure 4b). Western blot further confirmed the results of luminescence and qPCR by showing that erlotinib, like the inhibitors for PI3K/Akt suppressed significantly the PD98059-induced high level of TF protein synthesis (Figure 4c, d). We also noticed that erlotinib did not significantly affect TF protein level of the cells in culture without PD98059 induction. These data strongly indicated the involvement of EGFR was involved in PD98059-induced TF expression.

To assess the relationship between the modulation of TF expression and cell-associated procoagulant activity, we performed one stage clotting assay with the microparticle-free MDA-MB-231 cells. We found that LY294002 and wortmannin inhibited the cell procoagulant activity, and that PD98059 induced an augmentation of the cell procoagulant activity (Figure 5a). These results indicated that the effect of LY294002, wortmannin and PD98059 on TF activity could be functionally relevant to cell’s pro-coagulant activity. They further suggested that the changes in TF expression on MDA-MB-231 might be related to the changes in cell invasion capacity through Matrigel matrix (Figure 5b).

As EGFR was shown to be involved in the regulation of cell-associated TF expression, we performed the experiments of western blot with two EGFR positive cell lines SKOV-3 and OVCAR-3. The results showed that PD98059 upregulated TF synthesis in these two cell lines. Furthermore, Akt siRNA and EGFR siRNA suppressed PD98059-enhanced TF expression in these two cell lines in a similar manner to that in MDA-MB-231 (Figure 5c). We also performed qPCR to evaluate mRNA levels of asTF in these cells. asTF mRNA was found to represent about 2–5% of total TF mRNA. The results showed that PD98059 treatment stimulated asTF mRNA levels in all of the three cell lines, however, the blockage of Akt by A6730 and the blockage of EGFR by erlotinib and siRNA affected PD98059-enhanced asTF mRNA levels only in MDA-MB-231, but not in SKOV-3 and OVCAR-3 cells.