Skip to main content
Erschienen in: Gut Pathogens 1/2010

Open Access 01.12.2010 | Research

Campylobacter jejuni isolates in Finnish patients differ according to the origin of infection

verfasst von: Benjamin Feodoroff, Patrik Ellström, Heidi Hyytiäinen, Seppo Sarna, Marja-Liisa Hänninen, Hilpi Rautelin

Erschienen in: Gut Pathogens | Ausgabe 1/2010

Abstract

Background

Campylobacter jejuni is a significant cause of bacterial enteritis worldwide. Very little is known about the pathogenicity mechanisms and virulence factors of this important enteropathogen. C. jejuni isolates from 166 Finnish patients, collected from July to December in 2006, were studied for the presence of putative virulence factors and susceptibility to antimicrobials. Isolates were tested for production of γ-glutamyltransferase (GGT) as well as the presence of genes ceuE, cgtB, ciaB, cj0486, pldA, virB11, wlaN, and the gene cluster cdtABC. Bacterial characteristics were compared to information on foreign travel history as well as information on the course and the symptoms of disease obtained from questionnaires returned by patients.

Results

Except for one domestic isolate, antimicrobial resistance was only detected in isolates of foreign origin. Univariate analyses showed association between bloody stools and both GGT production (p = 0.025) and the presence of cgtB (p = 0.034). Multivariate analysis verified that GGT production was more prevalent in domestic isolates (p < 0.0001), while the genes cj0486 (p < 0.0001) and ceuE (p < 0.0001) were associated with C. jejuni isolates of foreign origin.

Conclusions

The results indicate that imported and domestic C. jejuni isolates differ significantly in several aspects from each other.
Hinweise

Competing interests

The authors declare that they have no competing interests.

Authors' contributions

BF participated in the design of the study, collected and analyzed data, performed statistical analyses and prepared the draft manuscript. PE participated in the selection of virulence factors, performed and supervised some PCR experiments. HH performed the PFGE and conducted some PCR experiments. SS provided expertise in statistical analyses. MLH participated in the design of the study and supervised the performance of some experiments. HR participated in the design of the project, coordinated and supervised the study and helped to draft the manuscript. All authors provided ideas and comments on the draft manuscript and approved the final manuscript.

Background

Campylobacter jejuni is a leading cause of bacterial enteritis in developed countries and the most commonly reported zoonosis in the European Union [1]. C. jejuni colonizes the gastrointestinal tract of many animals including poultry and wild birds, cattle, pigs, cat and dog. Eating undercooked poultry has been shown to be a risk factor for campylobacteriosis also in Finland [2], however, poultry is colonized with Campylobacter to a significantly lower extent than in many other countries [3]. Epidemiological studies using serotyping and genotyping methods have revealed a high diversity among C. jejuni from different sources in Finland and the risk factors for human Campylobacter infection may vary according to the geographical area and even with age [4, 5].
Although the genomes of several C. jejuni strains have been sequenced [68], very little is still known about the pathogenicity mechanisms and the virulence factors of this common enteropathogen [9]. The acute Campylobacter infection is often self-limited but in severe cases antimicrobial and hospital treatment may be needed. The reasons why certain patients develop a more serious acute infection or late sequelae of the disease are not understood.
Several studies have searched for the presence of putative virulence factors among Campylobacter isolates of human and animal origin but only few studies have been able to show an association between certain bacterial factors and the outcome of human Campylobacter infection. Genes studied have usually included those suggested to have a role in adhesion, colonization, invasion and toxin production. The plasmid-associated gene virB11 [10], as well as the genes ciaB (Campylobacter invasive antigen B) [11, 12], and cj0486 encoding a putative sugar transporter [13] have been suggested to be involved in invasiveness. In addition, pldA encoding outer membrane phospholipase A [14], and ceuE encoding enterochelin uptake binding protein [15] have been studied. The genes cgtB [16] and wlaN [17] are involved in the biosynthesis of lipooligosaccharide (LOS), which may show ganglioside-mimicking structures important for the triggering of Guillain-Barré syndrome, an acute peripheral polyneuropathy, after C. jejuni infection [18]. Cytolethal distending toxin (CDT, encoded by the gene cluster cdtABC) has been present in most of the tested isolates [19] but its role in the outcome of the disease still remains uncertain. Likewise, a recent report showed γ-glutamyl transpeptidase (GGT, encoded by the gene ggt) to have a role in the persistent colonization of the avian gut [20], but its importance in the course of human campylobacteriosis is not known.
We have recently demonstrated that C. jejuni isolates of domestic origin and those highly susceptible for ciprofloxacin were associated with a more severe form of enteritis characterized by bloody stools [21]. Our aim in the present study was to reveal other bacterial factors that may affect the outcome of the C. jejuni infection in a well-characterized clinical material including both infections acquired abroad or in Finland. For that purpose, we analyzed 166 clinical isolates of C. jejuni for the production of GGT and the presence of the genes virB11, ciaB, cgtB, wlaN, cj0486, ceuE, pldA and cdtABC.

Methods

Patients and Campylobacter isolates

A total of 166 patients with sporadic stool culture-verified C. jejuni infection (no other bacterial enteropathogens detected) were included in the present study. Their stool samples were collected from July 1 to December 31, 2006, and they had returned questionnaires including questions concerning travelling abroad within two weeks before the onset of symptoms, the clinical course of the illness and antimicrobial therapy. The patients belonged to a group of 192 persons (originally also including C. coli positive patients), some results of which have earlier been presented [21]. All the isolates were hippurate positive and were stored at -70°C before analyzed.

Susceptibility testing

The minimal inhibitory concentration (MIC) values of ciprofloxacin (Bayer, Leverkusen, Germany), doxycycline (Orion Pharma, Espoo, Finland) and erythromycin (Amdipharm Ltd, Dublin, Ireland) were determined by an agar dilution method according to the CLSI guidelines [22]. Mueller-Hinton agar (Oxoid, Basingstoke, UK) plates supplemented with defibrinated sheep blood (5%) and the control strain C. jejuni ATCC 33560 were used. The susceptibility of the isolates was interpreted according to CLSI [23]. The results of susceptibility of the isolates to ciprofloxacin have been published earlier [21].

PFGE typing

PFGE analysis was performed for 75 (all 40 domestic and all 35 travel-associated isolates collected in July, as the prevalence of cases per month was the highest during this month) isolates as described earlier [3, 24]. Isolate was considered to represent a new type when PFGE KpnI profile differed by at least one band.

γ-Glutamyl transpeptidase activity

In the first phase we studied the presence or absence of ggt gene as described in our previous study [25]. All isolates positive for the gene were further analyzed for the production of GGT. Qualitative detection of GGT activity was achieved as described previously for Helicobacter pylori [26]. Briefly, approximately 109 bacteria were suspended in a reagent containing 50 mM Tris (pH 8.25), 1.5 mM L-γ-glutamyl-carboxyl-3 nitro-4 anilide and 50 mM
glycylglycine. The mixture was incubated for 1 h at 37°C. Cleavage of the substrate by γ-glutamyl transpeptidase turned the mixture yellow in color.

PCR detection of other putative C. jejuni virulence factors

DNA was extracted from C. jejuni isolates using the following protocols. Bacteria (108 CFU) were harvested from blood agar plates (Columbia agar II containing 8% vol/vol whole horse blood), dissolved in 500 μl of ddH2O and incubated in a boiling water bath for 10 min. Cell debris was removed by centrifugation at 18 000 g for 2 min. For some isolates DNA was extracted using either a method utilizing guanidium thiocyanate [27], DNeasy Blood & Tissue kit (Qiagen) or Wizard Genomic DNA Purification Kit (Promega, UK) according to the manufacturer's instructions. Successful extraction of template C. jejuni DNA from each isolate was confirmed by PCR amplification of the house keeping gene glyA. The presence of the gene glyA and the putative virulence factors virB11, ciaB, cgtB, wlaN, pldA, ceuE, Cj0486 as well as the cdtABC operon were determined by PCR using the primers listed in Table 1. The reaction mixture was prepared in 1× AmpliTaq Gold 360 buffer with 1.25U of AmpliTaq Gold 360 polymerase (Applied Biosystems, USA), 200 μM dNTP (Fermentas, Germany), 0.2 μM of each primer (Eurogentec, Ougrée, Belgium) and 5 μl of template DNA in a total volume of 25 μl.
Table 1
Primer sequences, annealing temperatures and PCR product sizes for the putative virulence factors studied
Gene
Primers
Sequence (5'-3')
Annealing temp (°C)
Product (bp)
Reference
gly A
Gly-Fw
Gly-rev
GAGTTAGAGCGTCAATGTGAAGG
AAACCTCTGGCAGTAAGGGC
53-51
1052
[36]
virB11
VirB-232
VirB-701
TCTTGTGAGTTGCCTTACCCCTTTT
CCTGCGTGTCCTGTGTTATTTACCC
53
494
[35]
ceu E
CeuE405F
CeuE405R
GATAAAGTCGTTGGCGTTCC
GCGAGATTGGAGGACCAAAGG
60
405
*
cia B
ciaB355F
ciaB355R
CAGAAGGAGAAATTTGTGAGC
ATATCCCATTCTAATGCCACC
58
355
*
pld A
pldA-84fwd
pld-981rev
AAGCTTATGCGTTTTT
TATAAGGCTTTCTCCA
45
913
[35]
Cj0486
Cj0486fwd
Cj0486rev
GATAGAGCATTAAATTGGGATG
CCTATAAAGCCATACCAAGCC
58
1263
[13]
wla N
wlaN-DL 39
Cj1139cF
TTAAGAGCAAGATATGAAGGTG
TGCTGGGTATACAAAGGTTGTG
60
434
[17, 37]
cgt B
wlaN-DL 39
cgtBrev
TTAAGAGCAAGATATGAAGGTG
GCACATAGAGAACGCTACAA
56
563
[17]
cdtABC
LYA-F
MII-R
CTTTATGCATGTTCTTCTAAATTT
GTTAAAGGTGGGGTTATAATCATT
55
2111
[38]
*Personal communication: Rafal Gierczyński, National Institute of Public Health, Warsaw, Poland.
The PCR reactions started with a denaturation step at 95°C for 10 min. The cycling conditions were 25 cycles of 95°C for 30 s, annealing temperatures (Table 1) for 30 s and 72°C for 60 s (120 s for cdtABC). For virB11 and glyA a touch down protocol was run with 5 cycles at 53°C, 5 cycles at 52°C and 15 cycles at 51°C. The reactions ended with an additional extension step at 72°C for 7 min. DNA extracted from C. jejuni NCTC 11168 was used as a positive control for the genes cdtABC, wlaN and Cj0486 and DNA from C. jejuni 81176 served as a positive control for all other virulence genes. A PCR reaction without added template was used as a negative control.

Statistical analyses

Statistical analyses were performed with GraphPad Prism version 4.03 (GraphPad Software, San Diego, CA, USA) and PASW Statistics 18 (SPSS for Windows, Rel. 18.0.2. 2010. SPSS Inc, Chicago, IL, USA). The χ2 test and Fisher's exact test were used for comparison of categorical variables. Multivariate analyses were performed with stepwise binary logistic regression models. All tests were two-sided, and a p-value < 0.05 was considered to be significant.
The study was approved by the Ethics Committee of the Hospital District of Helsinki and Uusimaa.

Results

Of the 166 cases of C. jejuni infection in the study 126 were acquired abroad and 40 were acquired in Finland. Resistance to erythromycin (4 isolates) and resistance to doxycycline (59 isolates) were only detected in isolates of foreign origin. All except one of the isolates of domestic origin were susceptible for ciprofloxacin whereas 83/126 (66%) of isolates of foreign origin were resistant to ciprofloxacin, as published earlier [21]. Prevalence of the putative virulence markers among the isolates according to MICs to ciprofloxacin and doxycycline, respectively, is presented in Table 2. GGT-production was associated with susceptibility to ciprofloxacin and doxycycline in the univariate analysis. On the other hand, both ciprofloxacin- and doxycycline-resistant isolates were more likely than the susceptible ones to harbor the genes cj0486 and ceuE (Table 2).
Table 2
Contingency table results for antimicrobial susceptibility and putative virulence markers among 166 C. jejuni isolates
MIC values
Putative virulence factor
 
GGT-production
virB11>
ciaB
cgtB
wlaN
cj0486
ceuE
pldA
cdtABC
Ciprofloxacin MIC ≤ 1 (82/166) *
20/82 (p = 0.001) §
1/82
81/82
16/82
17/82
31/82
62/82
52/82
69/82
Ciprofloxacin MIC ≥ 4 (84/166) †
5/84
3/84
83/84
15/84
22/84
50/84 (p = 0.0051) ¶
80/84 (p = 0.0003) ¶
49/84
62/84
Doxycycline MIC ≤ 2 (102/166) *
22/102 (p = 0.0032) §
1/102
101/102
22/102
20/102
40/102
82/102
59/102
82/102
Doxycycline MIC ≥ 4 (64/166) ‡
3/64
3/64
63/64
9/64
19/64
41/64 (p = 0.0018) #
60/64 (p < 0.0001) #
42/64
49/64
No. positive isolates (%)
25/166 (15%)
4/166 (2.4%)
164/166 (99%)
31/166 (19%)
39/166 (23%)
81/166 (49%)
142/166 (86%)
101/166 (61%)
131/166 (79%)
*interpreted as susceptible, †interpreted as resistant, ‡interpreted as resistant or intermediate (5 isolates with MIC 4 mg/L), §associated with susceptible isolates, ¶associated with resistant isolates, #associated with resistant or intermediate isolates
Contingency tables were also used to assess whether the presence of putative virulence factors correlated with clinical data. In the univariate analysis (Table 3), GGT production and the presence of the gene cgtB were associated with bloody stools. In addition, isolates lacking the ceuE gene were associated with hospitalization, as 8/24 (33%) of the patients infected with ceuE-negative isolates were hospitalized, compared to 21/139 (15%) of those with ceuE-positive isolates (p = 0.031). GGT production was strongly associated with infections acquired in Finland as compared to infections from abroad. On the other hand, the genes cj0486 and ceuE were markedly more common among isolates of foreign origin. Of all the domestic isolates, 34/40 (85%) showed at least one of the following characteristics; GGT-production, lack of cj0486 or absence of ceuE whereas the number of foreign isolates was 60 (48%), respectively (p < 0.0001). A total of 69/126 (55%) of the imported isolates, but only 7/40 (18%) of the domestic isolates were positive for both cj0486 and ceuE (p < 0.0001).The significant findings in the univariate model were controlled with a multivariate analysis to assess whether some of the variables were independently associated with each other. GGT-production was independently associated with domestic infections, and the genes cj0486 and ceuE were independently associated with imported infections, respectively (Table 4). Although bloody diarrhea was significantly associated with both GGT-production and the presence of cgtB in the univariate analysis, this factor could not be further analyzed with a multivariate analysis as the proportion of missing data in the questionnaires regarding this specific finding was too high (28%).
Table 3
Characteristics of 166 patients and putative virulence factors present in the respective C. jejuni isolates
Clinical characteristics
Putative virulence factor
 
GGT-production
virB11
ciaB
cgtB
wlaN
cj0486
CeuE
pldA
cdtABC
Female sex (99/166)
17/99
3/99
98/99
19/99
23/99
52/99
85/99
62/99
78/99
Underlying disease (38/162)
9/38
3/38
37/38
10/38
9/38
18/38
32/38
23/38
31/38
Domestic infection (40/166)
16/40 (p < 0.0001) *
1/40
40
9/40
8/40
7/40
26/40
25/40
34/40
Infection from abroad 126/166)
9/126
3/126
124/126
22/126
31/126
74/126 (p < 0.0001) †
116/126 (p < 0.0001) †
76/126
97/126
Vomiting (41/156)
8/41
1/41
40/41
8/41
9/41
17/41
34/41
25/41
32/41
Fever (136/156)
20/136
4/136
134/136
27/136
30/136
66/136
115/136
82/136
104/136
Bloody stools (21/119)
6/21 (p = 0.025)
1/21
21
8/21 (p = 0.034)
3/21
9/21
17/21
16/21
18/21
Long-lasting (≥ 10 d) diarrhea (42/161)
6/42
1/42
42
12/42 (p = 0.051)
7/42
18/42
35/42
24/42
31/42
Hospitalization (29/163)
3/29
1/29
29
7/29
8/29
15/29
21/29 (p = 0.031) ‡
19/29
23/29
No. positive isolates (%)
25/166 (15%)
4/166 (2.4%)
164/166 (99%)
31/166 (19%)
39/166 (23%)
81/166 (49%)
142/166 (86%)
101/166 (61%)
131/166 (79%)
*associated with domestic infection, †associated with infection from abroad, ‡the absence of ceu E associated with hospitalization
Table 4
Multivariate analysis showing independent association between origin of infection and certain C. jejuni markers
Virulence marker
OR
95% Confidence interval
p-value
GGT*
8.67
3.43-21.91
< 0.0001
cj 0486†
6.71
2.75-16.39
< 0.0001
ceu E†
6.71
2.67-16.95
< 0.0001
*associated with domestic infection, †associated with imported infection
PFGE analysis with KpnI digested samples revealed that among the 40 domestic isolates, a total of 32 PFGE types were identified indicating a high diversity. Furthermore, all the 35 isolates of foreign origin analyzed had different PFGE profiles, which did not overlap with those of domestic isolates. Thus, the isolates were highly diverse and did not seem to have a common source.

Discussion

We recently showed that bloody stools were more common among patients infected with C. jejuni isolates of domestic origin and those highly susceptible for ciprofloxacin [21]. C. jejuni isolates of Finnish origin have even earlier been shown to differ significantly from those of foreign origin as being almost exclusively susceptible for ciprofloxacin [28, 29]. In the present study, we further analyzed possible differences between C. jejuni isolates acquired in Finland and those from abroad and screened for the presence of certain putative virulence markers. Significant differences were detected as GGT production was independently associated with infection of domestic origin and the isolates of foreign origin significantly more often harbored the genes cj0486 and ceuE, findings also verified with a multivariate analysis.
GGT is an enzyme present in both bacteria and eukaryotes. It has a role in glutathione and glutamine metabolism in C. jejuni [30]. The presence of ggt has been shown to vary among C. jejuni isolates [20, 31] and we recently demonstrated that ggt was common among human and chicken C. jejuni isolates but significantly less common among bovine isolates [25]. GGT activity in C. jejuni has been suggested to affect the persistent colonization of the avian gut [20] and in a mouse model for C. jejuni it was shown to enhance colonization [30]. In our study, GGT-production was present in 15% of the isolates and associated with bloody diarrhea in the univariate analysis, although the latter, due to a lack of data available, could not be further analyzed in a multivariate analysis. Interestingly, the domestic C. jejuni isolates were able to produce GGT significantly more often than the imported isolates, a finding also verified by the multivariate analysis. PFGE typing of all domestic isolates verified the sporadic nature of the domestically acquired infections confirming also that GGT production was not linked with a certain genotype.
The gene cj0486, encoding a putative sugar transporter and suggested to be related to invasiveness [13], as well as the gene ceuE, encoding a transport protein for uptake of the siderophore enterochelin [32] were detected in 49% and 86% of the isolates in the present study, respectively, in line with some other reports [19]. Although their presence was not associated with the outcome of the disease, interestingly they were significantly more often found among isolates of foreign than among those of domestic origin. Furthermore, the isolates lacking ceuE seemed to cause infections requiring hospital treatment, but this finding was not verified by the multivariate analysis. In addition to the typing of all domestic isolates, PFGE typing of travel-associated isolates from July indicated that almost all patients had unique genotypes and none of the studied characteristics was linked with a genotype. Travel-associated isolates originated from a total of 36 different countries.
Only few studies have been promising in trying to show correlation between putative virulence factors or the characteristics of C. jejuni and the outcome of the disease. Of the different C. jejuni markers studied in the present report, GGT production and the presence of cgtB were associated with bloody stools in the univariate analysis, but the other putative virulence factors did not correlate with any specific clinical findings. The ß-1,3 galactosyltransferase gene cgtB in the LOS gene clusters A and B involved in the biosynthesis of ganglioside-like LOS [16, 17] also showed a trend of being associated with longer-lasting diarrhea. C. jejuni LOS gene clusters A, B and C have even earlier been associated not only with a more severe outcome of the disease as characterized by bloody stools and longer duration of diarrhea but also with the development of post-infectious complications [33]. However, in the present study, the other ß-1,3 galactosyltransferase gene wlaN, expressed in the LOS gene cluster C [34] was not associated with any clinical characteristics. The gene ciaB has been suggested to be involved in invasiveness [11, 12] and thus, could be needed for the development of the disease. Indeed, all except two of the 166 isolates in our study were ciaB positive, which is in line with earlier reports [19, 35]. The presence of another putative virulence factor the gene pldA, encoding phospholipase A [14], was detected in the present study to a somewhat lower extent (61%) as compared to other reports (91-100%) [19, 35], and did not correlate with the clinical outcome of the disease. As CDT and virB11 were concerned, our results supported those of others showing CDT activity in the great majority [19] but the presence of virB11 in only a tiny proportion [13, 19] of clinical C. jejuni isolates. Thus, it seems very unlikely that these particular markers would play a role in the diversity of the outcome of the human disease.

Conclusions

In conclusion, we suggest for the first time that GGT production could be a marker associated with a more severe outcome of C. jejuni infection as characterized by bloody stools, however, additional work is needed to clarify the importance of this finding. Furthermore, to the best of our knowledge, this is the first report to describe the presence of putative virulence markers significantly and independently to differ between C. jejuni isolates of foreign and domestic origin. Whether this also reflects the different sources of C. jejuni infections locally in Finland remains to be studied.

Acknowledgements

The study was supported by a grant from the Academy of Finland (ELVIRA) and a fellowship grant from Emil and Ragna Börjesson memorial fund (Patrik Ellström). The skilled technical assistance of Marko Haverinen and Anna Nilsson is gratefully acknowledged.
This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://​creativecommons.​org/​licenses/​by/​2.​0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Competing interests

The authors declare that they have no competing interests.

Authors' contributions

BF participated in the design of the study, collected and analyzed data, performed statistical analyses and prepared the draft manuscript. PE participated in the selection of virulence factors, performed and supervised some PCR experiments. HH performed the PFGE and conducted some PCR experiments. SS provided expertise in statistical analyses. MLH participated in the design of the study and supervised the performance of some experiments. HR participated in the design of the project, coordinated and supervised the study and helped to draft the manuscript. All authors provided ideas and comments on the draft manuscript and approved the final manuscript.
Literatur
1.
Zurück zum Zitat The community summary report on trends and sources of zoonoses, zoonotic agents and foodborne outbreaks in the European Union in 2008. The EFSA Journal. 2010, 1496- The community summary report on trends and sources of zoonoses, zoonotic agents and foodborne outbreaks in the European Union in 2008. The EFSA Journal. 2010, 1496-
2.
Zurück zum Zitat Schönberg-Norio D, Takkinen J, Hänninen ML, Katila M, Kaukoranta S, Mattila L, Rautelin H: Swimming and Campylobacter infections. Emerg Infect Dis. 2004, 10: 1474-1477.PubMedCentralCrossRefPubMed Schönberg-Norio D, Takkinen J, Hänninen ML, Katila M, Kaukoranta S, Mattila L, Rautelin H: Swimming and Campylobacter infections. Emerg Infect Dis. 2004, 10: 1474-1477.PubMedCentralCrossRefPubMed
3.
Zurück zum Zitat Hänninen ML, Perko-Mäkelä P, Pitkälä A, Rautelin H: A three-year study of Campylobacter jejuni genotypes in humans with domestically acquired infections and in chicken samples from the Helsinki area. J Clin Microbiol. 2000, 38: 1998-2000.PubMedCentralPubMed Hänninen ML, Perko-Mäkelä P, Pitkälä A, Rautelin H: A three-year study of Campylobacter jejuni genotypes in humans with domestically acquired infections and in chicken samples from the Helsinki area. J Clin Microbiol. 2000, 38: 1998-2000.PubMedCentralPubMed
4.
Zurück zum Zitat Kärenlampi R, Rautelin H, Schönberg-Norio D, Paulin L, Hänninen ML: Longitudinal study of Finnish Campylobacter jejuni and C. coli isolates from humans, using multilocus sequence typing, including comparison with epidemiological data and isolates from poultry and cattle. Appl Environ Microbiol. 2007, 73: 148-155. 10.1128/AEM.01488-06.PubMedCentralCrossRefPubMed Kärenlampi R, Rautelin H, Schönberg-Norio D, Paulin L, Hänninen ML: Longitudinal study of Finnish Campylobacter jejuni and C. coli isolates from humans, using multilocus sequence typing, including comparison with epidemiological data and isolates from poultry and cattle. Appl Environ Microbiol. 2007, 73: 148-155. 10.1128/AEM.01488-06.PubMedCentralCrossRefPubMed
5.
Zurück zum Zitat Schönberg-Norio D, Sarna S, Hänninen ML, Katila M, Kaukoranta S, Rautelin H: Strain and host characteristics of Campylobacter jejuni infections in Finland. Clin Microbiol Infect. 2006, 12: 754-760.CrossRefPubMed Schönberg-Norio D, Sarna S, Hänninen ML, Katila M, Kaukoranta S, Rautelin H: Strain and host characteristics of Campylobacter jejuni infections in Finland. Clin Microbiol Infect. 2006, 12: 754-760.CrossRefPubMed
6.
Zurück zum Zitat Parkhill J, Wren BW, Mungall K, Ketley JM, Churcher C, Basham D, Chillingworth T, Davies RM, Feltwell T, Holroyd S, Jagels K, Karlyshev AV, Moule S, Pallen MJ, Penn CW, Quail MA, Rajandream MA, Rutherford KM, van Vliet AH, Whitehead S, Barrell BG: The genome sequence of the food-borne pathogen Campylobacter jejuni reveals hypervariable sequences. Nature. 2000, 403: 665-668. 10.1038/35001088.CrossRefPubMed Parkhill J, Wren BW, Mungall K, Ketley JM, Churcher C, Basham D, Chillingworth T, Davies RM, Feltwell T, Holroyd S, Jagels K, Karlyshev AV, Moule S, Pallen MJ, Penn CW, Quail MA, Rajandream MA, Rutherford KM, van Vliet AH, Whitehead S, Barrell BG: The genome sequence of the food-borne pathogen Campylobacter jejuni reveals hypervariable sequences. Nature. 2000, 403: 665-668. 10.1038/35001088.CrossRefPubMed
7.
Zurück zum Zitat Fouts DE, Mongodin EF, Mandrell RE, Miller WG, Rasko DA, Ravel J, Brinkac LM, DeBoy RT, Parker CT, Daugherty SC, Dodson RJ, Durkin AS, Madupu R, Sullivan SA, Shetty JU, Ayodeji MA, Shvartsbeyn A, Schatz MC, Badger JH, Fraser CM, Nelson KE: Major structural differences and novel potential virulence mechanisms from the genomes of multiple Campylobacter species. PloS Biol. 2005, 3: e15-10.1371/journal.pbio.0030015.PubMedCentralCrossRefPubMed Fouts DE, Mongodin EF, Mandrell RE, Miller WG, Rasko DA, Ravel J, Brinkac LM, DeBoy RT, Parker CT, Daugherty SC, Dodson RJ, Durkin AS, Madupu R, Sullivan SA, Shetty JU, Ayodeji MA, Shvartsbeyn A, Schatz MC, Badger JH, Fraser CM, Nelson KE: Major structural differences and novel potential virulence mechanisms from the genomes of multiple Campylobacter species. PloS Biol. 2005, 3: e15-10.1371/journal.pbio.0030015.PubMedCentralCrossRefPubMed
8.
Zurück zum Zitat Hofreuter D, Tsai J, Watson RO, Novik V, Altman B, Benitez M, Clark C, Perbost C, Jarvie T, Du L, Galán JE: Unique features of a highly pathogenic Campylobacter jejuni strain. Infect Immun. 2006, 74: 4694-4707. 10.1128/IAI.00210-06. Erratum in: Infect Immun 2007, 75(1):542PubMedCentralCrossRefPubMed Hofreuter D, Tsai J, Watson RO, Novik V, Altman B, Benitez M, Clark C, Perbost C, Jarvie T, Du L, Galán JE: Unique features of a highly pathogenic Campylobacter jejuni strain. Infect Immun. 2006, 74: 4694-4707. 10.1128/IAI.00210-06. Erratum in: Infect Immun 2007, 75(1):542PubMedCentralCrossRefPubMed
9.
Zurück zum Zitat Haddad N, Marce C, Magras C, Cappelier JM: An overview of methods used to clarify pathogenesis mechanisms of Campylobacter jejuni. [Review] [177 refs]. J Food Protect. 2010, 73: 786-802. Haddad N, Marce C, Magras C, Cappelier JM: An overview of methods used to clarify pathogenesis mechanisms of Campylobacter jejuni. [Review] [177 refs]. J Food Protect. 2010, 73: 786-802.
10.
Zurück zum Zitat Bacon DJ, Alm RA, Burr DH, Hu L, Kopecko DJ, Ewing CP, Trust TJ, Guerry P: Involvement of a plasmid in virulence of Campylobacter jejuni 81-176. Infect Immun. 2000, 68: 4384-90. 10.1128/IAI.68.8.4384-4390.2000.PubMedCentralCrossRefPubMed Bacon DJ, Alm RA, Burr DH, Hu L, Kopecko DJ, Ewing CP, Trust TJ, Guerry P: Involvement of a plasmid in virulence of Campylobacter jejuni 81-176. Infect Immun. 2000, 68: 4384-90. 10.1128/IAI.68.8.4384-4390.2000.PubMedCentralCrossRefPubMed
11.
Zurück zum Zitat Konkel ME, Kim BJ, Rivera-Amill V, Garvis SG: Identification of proteins required for the internalization of Campylobacter jejuni into cultured mammalian cells. Adv Exp Med Biol. 1999, 473: 215-24.CrossRefPubMed Konkel ME, Kim BJ, Rivera-Amill V, Garvis SG: Identification of proteins required for the internalization of Campylobacter jejuni into cultured mammalian cells. Adv Exp Med Biol. 1999, 473: 215-24.CrossRefPubMed
12.
Zurück zum Zitat Rivera-Amill V, Kim BJ, Seshu J, Konkel ME: Secretion of the virulence-associated Campylobacter invasion antigens from Campylobacter jejuni requires a stimulatory signal. J Infect Dis. 2001, 183: 1607-16. 10.1086/320704.CrossRefPubMed Rivera-Amill V, Kim BJ, Seshu J, Konkel ME: Secretion of the virulence-associated Campylobacter invasion antigens from Campylobacter jejuni requires a stimulatory signal. J Infect Dis. 2001, 183: 1607-16. 10.1086/320704.CrossRefPubMed
13.
Zurück zum Zitat Fearnley C, Manning G, Bagnall M, Javed MA, Wassenaar TM, Newell DG: Identification of hyperinvasive Campylobacter jejuni strains isolated from poultry and human clinical sources. J Med Microbiol. 2008, 57: 570-580. 10.1099/jmm.0.47803-0.CrossRefPubMed Fearnley C, Manning G, Bagnall M, Javed MA, Wassenaar TM, Newell DG: Identification of hyperinvasive Campylobacter jejuni strains isolated from poultry and human clinical sources. J Med Microbiol. 2008, 57: 570-580. 10.1099/jmm.0.47803-0.CrossRefPubMed
14.
Zurück zum Zitat Grant KA, Belandia IU, Dekker N, Richardson PT, Park SF: Molecular characterization of pldA, the structural gene for a phospholipase A from Campylobacter coli, and its contribution to cell-associated hemolysis. Infect Immun. 1997, 65: 1172-1180.PubMedCentralPubMed Grant KA, Belandia IU, Dekker N, Richardson PT, Park SF: Molecular characterization of pldA, the structural gene for a phospholipase A from Campylobacter coli, and its contribution to cell-associated hemolysis. Infect Immun. 1997, 65: 1172-1180.PubMedCentralPubMed
15.
Zurück zum Zitat Richardson PT, Park SF: Enterochelin acquisition in Campylobacter coli: characterization of components of a binding-protein-dependent transport system. Microbiology. 1995, 141: 3181-3191. 10.1099/13500872-141-12-3181.CrossRefPubMed Richardson PT, Park SF: Enterochelin acquisition in Campylobacter coli: characterization of components of a binding-protein-dependent transport system. Microbiology. 1995, 141: 3181-3191. 10.1099/13500872-141-12-3181.CrossRefPubMed
16.
Zurück zum Zitat Gilbert M, Brisson JR, Karwaski MF, Michniewicz J, Cunningham AM, Wu Y, Young NM, Wakarchuk WW: Biosynthesis of ganglioside mimics in Campylobacter jejuni OH4384. Identification of the glycosyltransferase genes, enzymatic synthesis of model compounds, and characterization of nanomole amounts by 600-mhz (1)h and (13)c NMR analysis. J Biol Chem. 2000, 275: 3896-3906. 10.1074/jbc.275.6.3896.CrossRefPubMed Gilbert M, Brisson JR, Karwaski MF, Michniewicz J, Cunningham AM, Wu Y, Young NM, Wakarchuk WW: Biosynthesis of ganglioside mimics in Campylobacter jejuni OH4384. Identification of the glycosyltransferase genes, enzymatic synthesis of model compounds, and characterization of nanomole amounts by 600-mhz (1)h and (13)c NMR analysis. J Biol Chem. 2000, 275: 3896-3906. 10.1074/jbc.275.6.3896.CrossRefPubMed
17.
Zurück zum Zitat Linton D, Gilbert M, Hitchen PG, Dell A, Morris HR, Wakarchuk WW, Gregson NA, Wren BW: Phase variation of a beta-1,3 galactosyltransferase involved in generation of the ganglioside GM1-like lipo-oligosaccharide of Campylobacter jejuni. Mol Microbiol. 2000, 37: 501-514. 10.1046/j.1365-2958.2000.02020.x.CrossRefPubMed Linton D, Gilbert M, Hitchen PG, Dell A, Morris HR, Wakarchuk WW, Gregson NA, Wren BW: Phase variation of a beta-1,3 galactosyltransferase involved in generation of the ganglioside GM1-like lipo-oligosaccharide of Campylobacter jejuni. Mol Microbiol. 2000, 37: 501-514. 10.1046/j.1365-2958.2000.02020.x.CrossRefPubMed
18.
Zurück zum Zitat van Doorn PA, Ruts L, Jacobs BC: Clinical features, pathogenesis, and treatment of Guillain-Barre syndrome [Review] [158 refs]. Lancet Neurol. 2008, 7: 939-950. 10.1016/S1474-4422(08)70215-1.CrossRefPubMed van Doorn PA, Ruts L, Jacobs BC: Clinical features, pathogenesis, and treatment of Guillain-Barre syndrome [Review] [158 refs]. Lancet Neurol. 2008, 7: 939-950. 10.1016/S1474-4422(08)70215-1.CrossRefPubMed
19.
Zurück zum Zitat Talukder KA, Aslam M, Islam Z, Azmi IJ, Dutta DK, Hossain S, Nur-E-Kamal A, Nair GB, Cravioto A, Sack DA, Endtz HP: Prevalence of virulence genes and cytolethal distending toxin production in Campylobacter jejuni isolates from diarrheal patients in Bangladesh. J Clin Microbiol. 2008, 46: 1485-1488. 10.1128/JCM.01912-07.PubMedCentralCrossRefPubMed Talukder KA, Aslam M, Islam Z, Azmi IJ, Dutta DK, Hossain S, Nur-E-Kamal A, Nair GB, Cravioto A, Sack DA, Endtz HP: Prevalence of virulence genes and cytolethal distending toxin production in Campylobacter jejuni isolates from diarrheal patients in Bangladesh. J Clin Microbiol. 2008, 46: 1485-1488. 10.1128/JCM.01912-07.PubMedCentralCrossRefPubMed
20.
Zurück zum Zitat Barnes IH, Bagnall MC, Browning DD, Thompson SA, Manning G, Newell DG: Gamma-glutamyl transpeptidase has a role in the persistent colonization of the avian gut by Campylobacter jejuni. Microb Pathog. 2007, 43: 198-207. 10.1016/j.micpath.2007.05.007.PubMedCentralCrossRefPubMed Barnes IH, Bagnall MC, Browning DD, Thompson SA, Manning G, Newell DG: Gamma-glutamyl transpeptidase has a role in the persistent colonization of the avian gut by Campylobacter jejuni. Microb Pathog. 2007, 43: 198-207. 10.1016/j.micpath.2007.05.007.PubMedCentralCrossRefPubMed
21.
Zurück zum Zitat Feodoroff FB, Lauhio AR, Sarna SJ, Hänninen ML, Rautelin HI: Severe diarrhoea caused by highly ciprofloxacin-susceptible Campylobacter isolates. Clin Microbiol Infect. 2009, 15: 188-192. 10.1111/j.1469-0691.2008.02657.x.CrossRefPubMed Feodoroff FB, Lauhio AR, Sarna SJ, Hänninen ML, Rautelin HI: Severe diarrhoea caused by highly ciprofloxacin-susceptible Campylobacter isolates. Clin Microbiol Infect. 2009, 15: 188-192. 10.1111/j.1469-0691.2008.02657.x.CrossRefPubMed
22.
Zurück zum Zitat Clinical and Laboratory Standards Institute/NCCLS. Performance for antimicrobial susceptibility testing: fifteenth informational supplement. CLSI/NCCLS document M100-S15. Wayne, PA: CLSI. 2005 Clinical and Laboratory Standards Institute/NCCLS. Performance for antimicrobial susceptibility testing: fifteenth informational supplement. CLSI/NCCLS document M100-S15. Wayne, PA: CLSI. 2005
23.
Zurück zum Zitat Clinical and Laboratory Standards Institute. Methods for antimicrobial dilution and disk susceptibility testing of infrequently isolated or fastidious bacteria; approved guideline. CLSI document M45-A. Wayne, PA: CLSI. 2006 Clinical and Laboratory Standards Institute. Methods for antimicrobial dilution and disk susceptibility testing of infrequently isolated or fastidious bacteria; approved guideline. CLSI document M45-A. Wayne, PA: CLSI. 2006
24.
Zurück zum Zitat Maslow JN, Slutsky AM, Arbeit RD: Application of pulsed-field gel electrophoresis to molecular epidemiology. Diagnostic molecular microbiology: principles and applications. Edited by: Persing DH, Smith TF, Tenover FC, White TJ. Washington: American Society for Microbiology, 1993, 563-72. Maslow JN, Slutsky AM, Arbeit RD: Application of pulsed-field gel electrophoresis to molecular epidemiology. Diagnostic molecular microbiology: principles and applications. Edited by: Persing DH, Smith TF, Tenover FC, White TJ. Washington: American Society for Microbiology, 1993, 563-72.
25.
Zurück zum Zitat Gonzalez M, Hakkinen M, Rautelin H, Hänninen ML: Bovine Campylobacter jejuni strains differ from human and chicken strains in an analysis of certain molecular genetic markers. Appl Environ Microbiol. 2009, 75: 1208-1210. 10.1128/AEM.01879-08.PubMedCentralCrossRefPubMed Gonzalez M, Hakkinen M, Rautelin H, Hänninen ML: Bovine Campylobacter jejuni strains differ from human and chicken strains in an analysis of certain molecular genetic markers. Appl Environ Microbiol. 2009, 75: 1208-1210. 10.1128/AEM.01879-08.PubMedCentralCrossRefPubMed
26.
Zurück zum Zitat Shibayama K, Kamachi K, Nagata N, Yagi T, Nada T, Doi Y, Shibata N, Yokoyama K, Yamane K, Kato H, Iinuma Y, Arakawa Y: A novel apoptosis-inducing protein from Helicobacter pylori. Mol Microbiol. 2003, 47: 443-451. 10.1046/j.1365-2958.2003.03305.x.CrossRefPubMed Shibayama K, Kamachi K, Nagata N, Yagi T, Nada T, Doi Y, Shibata N, Yokoyama K, Yamane K, Kato H, Iinuma Y, Arakawa Y: A novel apoptosis-inducing protein from Helicobacter pylori. Mol Microbiol. 2003, 47: 443-451. 10.1046/j.1365-2958.2003.03305.x.CrossRefPubMed
27.
Zurück zum Zitat Pitcher DG, Saunders NA, Owen RJ: Rapid extraction of bacterial genomic DNA with guanidium thiocyanate. Lett Appl Microbiol. 1989, 8: 151-156. 10.1111/j.1472-765X.1989.tb00262.x.CrossRef Pitcher DG, Saunders NA, Owen RJ: Rapid extraction of bacterial genomic DNA with guanidium thiocyanate. Lett Appl Microbiol. 1989, 8: 151-156. 10.1111/j.1472-765X.1989.tb00262.x.CrossRef
28.
Zurück zum Zitat Rautelin H, Vierikko A, Hänninen ML, Vaara M: Antimicrobial susceptibilities of Campylobacter strains isolated from Finnish subjects infected domestically or from those infected abroad. Antimicrob Agents Chemother. 2003, 47: 102-105. 10.1128/AAC.47.1.102-105.2003.PubMedCentralCrossRefPubMed Rautelin H, Vierikko A, Hänninen ML, Vaara M: Antimicrobial susceptibilities of Campylobacter strains isolated from Finnish subjects infected domestically or from those infected abroad. Antimicrob Agents Chemother. 2003, 47: 102-105. 10.1128/AAC.47.1.102-105.2003.PubMedCentralCrossRefPubMed
29.
Zurück zum Zitat Schönberg-Norio D, Hänninen ML, Katila ML, Kaukoranta SS, Koskela M, Eerola E, Uksila J, Pajarre S, Rautelin H: Activities of telithromycin, erythromycin, fluoroquinolones, and doxycycline against Campylobacter strains isolated from Finnish subjects. Antimicrob Agents Chemother. 2006, 50: 1086-1088. 10.1128/AAC.50.3.1086-1088.2006.PubMedCentralCrossRefPubMed Schönberg-Norio D, Hänninen ML, Katila ML, Kaukoranta SS, Koskela M, Eerola E, Uksila J, Pajarre S, Rautelin H: Activities of telithromycin, erythromycin, fluoroquinolones, and doxycycline against Campylobacter strains isolated from Finnish subjects. Antimicrob Agents Chemother. 2006, 50: 1086-1088. 10.1128/AAC.50.3.1086-1088.2006.PubMedCentralCrossRefPubMed
30.
Zurück zum Zitat Hofreuter D, Novik V, Galán JE: Metabolic diversity in Campylobacter jejuni enhances specific tissue colonization. Cell Host Microbe. 2008, 4: 425-433. 10.1016/j.chom.2008.10.002.CrossRefPubMed Hofreuter D, Novik V, Galán JE: Metabolic diversity in Campylobacter jejuni enhances specific tissue colonization. Cell Host Microbe. 2008, 4: 425-433. 10.1016/j.chom.2008.10.002.CrossRefPubMed
31.
Zurück zum Zitat Ahmed IH, Manning G, Wassenaar TM, Cawthraw S, Newell DG: Identification of genetic differences between two Campylobacter jejuni strains with different colonization potentials. Microbiology. 2002, 148: 1203-1212.CrossRefPubMed Ahmed IH, Manning G, Wassenaar TM, Cawthraw S, Newell DG: Identification of genetic differences between two Campylobacter jejuni strains with different colonization potentials. Microbiology. 2002, 148: 1203-1212.CrossRefPubMed
32.
Zurück zum Zitat Park SF, Richardson PT: Molecular characterization of a Campylobacter jejuni lipoprotein with homology to periplasmic siderophore-binding proteins. J Bacteriol. 1995, 177: 2259-2264.PubMedCentralPubMed Park SF, Richardson PT: Molecular characterization of a Campylobacter jejuni lipoprotein with homology to periplasmic siderophore-binding proteins. J Bacteriol. 1995, 177: 2259-2264.PubMedCentralPubMed
33.
Zurück zum Zitat Mortensen NP, Kuijf ML, Ang CW, Schiellerup P, Krogfelt KA, Jacobs BC, van Belkum A, Endtz HP, Bergman MP: Sialylation of Campylobacter jejuni lipo-oligosaccharides is associated with severe gastro-enteritis and reactive arthritis. Microbes Infect. 2009, 11: 988-994. 10.1016/j.micinf.2009.07.004.CrossRefPubMed Mortensen NP, Kuijf ML, Ang CW, Schiellerup P, Krogfelt KA, Jacobs BC, van Belkum A, Endtz HP, Bergman MP: Sialylation of Campylobacter jejuni lipo-oligosaccharides is associated with severe gastro-enteritis and reactive arthritis. Microbes Infect. 2009, 11: 988-994. 10.1016/j.micinf.2009.07.004.CrossRefPubMed
34.
Zurück zum Zitat Godschalk PC, Heikema AP, Gilbert M, Komagamine T, Ang CW, Glerum J, Brochu D, Li J, Yuki N, Jacobs BC, van Belkum A, Endtz HP: The crucial role of Campylobacter jejuni genes in anti-ganglioside antibody induction in Guillain-Barre syndrome. J Clin Invest. 2004, 114: 1659-1665.PubMedCentralCrossRefPubMed Godschalk PC, Heikema AP, Gilbert M, Komagamine T, Ang CW, Glerum J, Brochu D, Li J, Yuki N, Jacobs BC, van Belkum A, Endtz HP: The crucial role of Campylobacter jejuni genes in anti-ganglioside antibody induction in Guillain-Barre syndrome. J Clin Invest. 2004, 114: 1659-1665.PubMedCentralCrossRefPubMed
35.
Zurück zum Zitat Datta S, Niwa H, Itoh K: Prevalence of 11 pathogenic genes of Campylobacter jejuni by PCR in strains isolated from humans, poultry meat and broiler and bovine faeces. J Med Microbiol. 2003, 52: 345-348. 10.1099/jmm.0.05056-0.CrossRefPubMed Datta S, Niwa H, Itoh K: Prevalence of 11 pathogenic genes of Campylobacter jejuni by PCR in strains isolated from humans, poultry meat and broiler and bovine faeces. J Med Microbiol. 2003, 52: 345-348. 10.1099/jmm.0.05056-0.CrossRefPubMed
36.
Zurück zum Zitat Dingle KE, Colles FM, Wareing DR, Ure R, Fox AJ, Bolton FE, Bootsma HJ, Willems RJ, Urwin R, Maiden MC: Multilocus sequence typing system for Campylobacter jejuni. J Clin Microbiol. 2001, 39: 14-23. 10.1128/JCM.39.1.14-23.2001.PubMedCentralCrossRefPubMed Dingle KE, Colles FM, Wareing DR, Ure R, Fox AJ, Bolton FE, Bootsma HJ, Willems RJ, Urwin R, Maiden MC: Multilocus sequence typing system for Campylobacter jejuni. J Clin Microbiol. 2001, 39: 14-23. 10.1128/JCM.39.1.14-23.2001.PubMedCentralCrossRefPubMed
37.
Zurück zum Zitat Wassenaar TM, Wagenaar JA, Rigter A, Fearnley C, Newell DG, Duim B: Homonucleotide stretches in chromosomal DNA of Campylobacter jejuni display high frequency polymorphism as detected by direct PCR analysis. FEMS Microbiol Lett. 2002, 212: 77-85. 10.1111/j.1574-6968.2002.tb11248.x.CrossRefPubMed Wassenaar TM, Wagenaar JA, Rigter A, Fearnley C, Newell DG, Duim B: Homonucleotide stretches in chromosomal DNA of Campylobacter jejuni display high frequency polymorphism as detected by direct PCR analysis. FEMS Microbiol Lett. 2002, 212: 77-85. 10.1111/j.1574-6968.2002.tb11248.x.CrossRefPubMed
38.
Zurück zum Zitat Bang DD, Nielsen EM, Scheutz F, Pedersen K, Handberg K, Madsen M: PCR detection of seven virulence and toxin genes of Campylobacter jejuni and Campylobacter coli isolates from Danish pigs and cattle and cytolethal distending toxin production of the isolates. J Appl Microbiol. 2003, 94: 1003-1014. 10.1046/j.1365-2672.2003.01926.x.CrossRefPubMed Bang DD, Nielsen EM, Scheutz F, Pedersen K, Handberg K, Madsen M: PCR detection of seven virulence and toxin genes of Campylobacter jejuni and Campylobacter coli isolates from Danish pigs and cattle and cytolethal distending toxin production of the isolates. J Appl Microbiol. 2003, 94: 1003-1014. 10.1046/j.1365-2672.2003.01926.x.CrossRefPubMed
Metadaten
Titel
Campylobacter jejuni isolates in Finnish patients differ according to the origin of infection
verfasst von
Benjamin Feodoroff
Patrik Ellström
Heidi Hyytiäinen
Seppo Sarna
Marja-Liisa Hänninen
Hilpi Rautelin
Publikationsdatum
01.12.2010
Verlag
BioMed Central
Erschienen in
Gut Pathogens / Ausgabe 1/2010
Elektronische ISSN: 1757-4749
DOI
https://doi.org/10.1186/1757-4749-2-22

Weitere Artikel der Ausgabe 1/2010

Gut Pathogens 1/2010 Zur Ausgabe

Leitlinien kompakt für die Innere Medizin

Mit medbee Pocketcards sicher entscheiden.

Seit 2022 gehört die medbee GmbH zum Springer Medizin Verlag

Reizdarmsyndrom: Diäten wirksamer als Medikamente

29.04.2024 Reizdarmsyndrom Nachrichten

Bei Reizdarmsyndrom scheinen Diäten, wie etwa die FODMAP-arme oder die kohlenhydratreduzierte Ernährung, effektiver als eine medikamentöse Therapie zu sein. Das hat eine Studie aus Schweden ergeben, die die drei Therapieoptionen im direkten Vergleich analysierte.

Notfall-TEP der Hüfte ist auch bei 90-Jährigen machbar

26.04.2024 Hüft-TEP Nachrichten

Ob bei einer Notfalloperation nach Schenkelhalsfraktur eine Hemiarthroplastik oder eine totale Endoprothese (TEP) eingebaut wird, sollte nicht allein vom Alter der Patientinnen und Patienten abhängen. Auch über 90-Jährige können von der TEP profitieren.

Niedriger diastolischer Blutdruck erhöht Risiko für schwere kardiovaskuläre Komplikationen

25.04.2024 Hypotonie Nachrichten

Wenn unter einer medikamentösen Hochdrucktherapie der diastolische Blutdruck in den Keller geht, steigt das Risiko für schwere kardiovaskuläre Ereignisse: Darauf deutet eine Sekundäranalyse der SPRINT-Studie hin.

Bei schweren Reaktionen auf Insektenstiche empfiehlt sich eine spezifische Immuntherapie

Insektenstiche sind bei Erwachsenen die häufigsten Auslöser einer Anaphylaxie. Einen wirksamen Schutz vor schweren anaphylaktischen Reaktionen bietet die allergenspezifische Immuntherapie. Jedoch kommt sie noch viel zu selten zum Einsatz.

Update Innere Medizin

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.