Skip to main content
Erschienen in: BMC Infectious Diseases 1/2019

Open Access 01.12.2019 | Research article

Allele-specific real-time PCR testing for minor macrolide-resistant Mycoplasma Pneumoniae

verfasst von: Dongxing Guo, Wenjuan Hu, Baoping Xu, Jingyi Li, Dan Li, Shaogang Li, Zhaoyong Wu, Ran Wei, Xiujun Tian, Kunling Shen, Deli Xin

Erschienen in: BMC Infectious Diseases | Ausgabe 1/2019

Abstract

Background

The point mutations in 23S rRNA gene of Mycoplasma pneumoniae (M. pneumoniae) can lead to high-level resistance to macrolides. This study aimed to evaluate allele-specific real-time PCR (ASPCR) to detect the resistance-related mutations located at positions A2063G and A2064G of 23S rRNA gene.

Methods

We detected 178 pharyngeal swab specimens and calculated the proportions of resistant and sensitive quasispecies using ASPCR assays. ASPCR assays can detect down to 10 copies of 23S rRNA gene and achieved sensitivities of < 0.1% for A2063G and A2064G. We also compared the findings of ASPCR with the results of nested PCR with sequencing.

Results

Of 178 samples, 164 were found to have M. pneumoniae including 90.85% (149/164) samples with macrolide-resistant M. pneumoniae (MRMP) quasispecies by ASPCR, while 153 were found to be M. pneumoniae-positive including 71.90% (110/153) samples with MRMP quasispecies by nested PCR with sequencing. Of the 164 M. pneumoniae-positive samples, 61.59% (101/164) had the mixed population of wild-type and mutant M. pneumoniae, and 56.44% (57/101) of the latter contained the mutations at low frequency (≤50%).

Conclusion

ASPCR indicated that sensitive and resistant quasispecies coexisted in most of the M. pneumoniae positive samples. The ASPCR was a highly sensitive, accurate and rapid method for detecting the macrolide resistance-associated mutations and it could provide earlier and more drug-resistant information for M. pneumoniae research and the clinical therapy.
Hinweise
Kunling Shen and Deli Xin are equally contributed to this paper and thus shared the co-corresponding authorship.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Abkürzungen
ASPCR
allele-specific real-time PCR
CVs
coefficient of variations
M. pneumoniae
Mycoplasma pneumoniae
MIC
minimum inhibitory concentration
MRMP
macrolide-resistant M. pneumoniae
NTC
no template control
RFLP
restriction fragment length polymorphism
SD
standard deviations

Background

Mycoplasma pneumoniae (M. pneumoniae) can cause atypical pneumoniae and many respiratory illnesses, particularly in childhood and specify young adults, its infection rate range from 10% to.
80% [13]. Macrolides and related antibiotics have been generally considered to be the first-choice antibiotic for the treatment of M. pneumoniae infection [4]. However, since the first isolates macrolide-resistant M. pneumoniae (MRMP) in 2001 [5], MRMP has been spreading globally for about seventeen years, with prevalences ranging from below 10% in Europe [1, 610], approximately 30% in Israel [11], and up to 90% in Asia [1214].
The commonly used phenotypic methods for determining susceptibility to macrolides is to measure the minimum inhibitory concentration (MIC), and this process is rather time-consuming.
In previous studies, point mutations in several positions have been reported to be related to development of macrolide resistance in M. pneumoniae [15]. Among them, the 2063 and 2064 point mutations in the peptidyl-transferase loop of domain V of 23S rRNA, which interferes with the binding of macrolides to rRNA [1, 5, 16, 17], are the major mutations responsible for different grade macrolide-resistance of M. pneumoniae [5, 17]. For example, one study reported that 90.90% had an A2063G transition and 9.10% had an A2064G transition in domain V of the 23S rRNA gene among 55 macrolide-resistant strains [18]. Other mutations, such as those at positions 2617, 2067 and 2611 in domain V of the single-copy 23S rRNA gene, and mutations in the ribosomal proteins L4 and L22, are very rare [19, 20]. Several molecular detection methods for identification of these mutations include sequencing of PCR products, real-time PCR, pyrosequencing, restriction fragment length polymorphism (RFLP) analysis, high-resolution melting curve analysis and allele-specific PCR [2126]. However, most methods have limitations as following: sequencing of PCR products and RFLP analysis are time-consuming and expensive, and have no value in clinical practice due to only used in research; real-time PCR may be much easier, quicker, and simpler to perform than other methods, but may not be able to distinguish between the 2063 and the 2064 mutation without additional simplex real-time PCR, and cannot detect unknown mutations [8, 19]. Therefore, a rapid, sensitive, and specific laboratory test is vital for rapid detection of M. pneumoniae infections.
Allele-specific real-time PCR (ASPCR) applies the real-time PCR to allele-specific PCR and integrates the advantages of these two systems. ASPCR has increased the sensitivity of the allele-specific PCR several-fold and quantified the PCR products [27, 28]. Therefore, ASPCR is a highly sensitive and time-saving method for detection of point mutations and is significantly labor-intensive and reproducible. In this study, we developed ASPCR assays for detecting 23S rRNA gene of M. pneumoniae and determine the macrolide resistance-associated mutations at 2063 (A2063G) and 2064 (A2064G) sites. In addition, we detected 178 pharyngeal swab specimens using ASPCR to reveal the prevalence of macrolide-resistant and sensitive M. pneumoniae quasispecies in clinical specimens.

Methods

Specimens and reference strains

A total of 178 pharyngeal swab specimens were tested using ASPCR. All specimens were collected from pediatric patients (aged, 2–12 years) with a clinical diagnosis of M. pneumoniae infection from August 2013 to March 2015. The reference strain M129 (ATCC 29342) used in this study was preserved in our laboratory. The specificity of the ASPCR was tested using DNA of the following reference strains: Neisseria mucosa, Klebsiella pneumoniae, Escherichia coli, Staphylococcus aureus, Streptococcus pneumoniae, Pseudomonas aeruginosa, Mycoplasma hominis, Mycoplasma fermentans, Mycoplasma pyriformis and Ureaplasma urealyticum. All reference strains were preserved in our laboratory.

Primer design

All the primers were designed based on the sequence of M. pneumoniae reference strain M129 (GenBank accession no. U00089). The mutant-specific primers (Msp) and non-specific primers (Np) were designed to determine the macrolide resistance-associated mutations at 2063 (A2063G) and 2064 (A2064G) site. The mutant-specific primers incorporate the target mutation in their 3′-end and plus three intentional mismatch bases (hypoxanthylic acid) near the end to enhance the specificity of mutant-specific amplification (Table 1). The non-specific primer was identical to the corresponding mutant-specific primer, except that the sequence ends right before the mutation position and without the substitutions of hypoxanthylic acid. The same reverse primer was used in the mutant-specific and the non-specific reactions performed in separate wells.
Table 1
Oligonucleotide sequences and locations on the M129 genome
Name
Sequence (5′-3′)
Position in M129
23S rRNA-F
CTTTCTAATGGAGTTTTTTACTT
119,806—119,828
23S rRNA-R
GCTTGGTGCTTTCCTATTCT
123,068—123,087
23SA2063G-F
GGACGGGAAGACCCCGTGAAGCTTTACT
122,094—122,121
23SA2064G-F
GGACGGAGAGACCCCGTGAAGCTTTACT
122,094—122,121
23S2063/2064-R
CGTTGCGCCTAACGGGTGTCTTCAC
122,069—122,093
NU-F (Np)
TTAGGCGCAACGGGACGG
122,082—122,099
2063MU-F (Msp)
TTAGGCGCAACGGGAIIIG
122,082—122,100
2064MU-F (Msp)
TTAGGCGCAACGGGAIIIAG
122,082—122,101
23S2063/4D-R
CTGGATAACAGTTACCAATTAGAACAGC
122,233—122,260
The target mutations in the primers of sit-directed mutations (23SA2063G-F and 23SA2064G-F) are shown in boldface. The target mutations at the end of the mutant-specific primers (Msp) are shown in boldface and underlined. The internal mismatches in the mutant-specific primers (Msp) are shown in boldface italics

Construction of standards and ASPCR amplification

The standards of the ASPCR assays for A2063G and A2064G were then constructed. Plasmids containing a wild-type fragment of M. pneumoniae 23S rRNA full-length sequence were obtained by cloning the PCR products amplified by the primers 23SrRNA-F and 23SrRNA-R into pMD18-T (pMD™18-T Vector Cloning Kit, TaKaRa, Japan) vectors. The mutations of A2063G and A2064G were introduced into wild-type plasmids by sit-directed mutagenesis (TaKaRa MutanBEST Kit, TaKaRa, Japan) using primers 23SA2063G-F, 23SA2064G-F, and 23S2063/2064-R. The plasmids containing mutations were confirmed by sequencing and quantified by spectrophotometer. Serial 10-folds dilutions of plasmids ranging from 10 to 106 copies/μL were made as standards for ASPCR.
The mutant-specific and nonspecific standard curves of A2063G and A2064G were obtained by amplifying the mutant standards with the corresponding primer sets. The ASPCR mix contained 12.5 μL power SYBR Green PCR Master 2 × Mix, 2 μL mutant-specific/non-specific upstream primer, 2 μL corresponding downstream-primer, 2 μL DNA templates, 6.5 μL ddH2O. The reaction conditions were 50 °C for 2 min, followed by a denaturation step at 95 °C for 10 min, 40 cycles of real-time PCR amplification (95 °C for 15 s, 60 °C for 1 min) with a final dissociation stage (95 °C for 15 s, 60 °C for 30 s, 95 °C for 15 s). Each reaction was conducted in triplicate.

Evaluation of ASPCR

The threshold cycle (Ct) values of 107 copies/μL of mutant and wild-type plasmids with the specific primer were tested and calculated the ΔCt. The mixture templates were generated by adding 105 copies of wild-type DNA to serial dilutions (106–101 copies) of mutant DNA. We compared the Ct values of the mutant template and mixture of mutant and wild-type plasmids to evaluate the discrimination ability of ASPCR.
The mixture templates in which the proportion of mutant plasmids ranged from 0.01 to 100% were generated by adding 105 copies of wild-type DNA into the serial dilutions (106–101 copies) of mutant DNA. The cut-off value was defined as the mean Ct value plus three standard deviations (SD) of 12 independent determinations of 105 copies wild-type template with mutant-specific primer. Mutants were inferred to be present in the mixing templates when the Ct value was less than the cutoff value. The measured proportions and nominal proportions of the mixtures with mutant template ranging from 0.01 to 100% were compared to evaluate the accuracy of ASPCR. The sensitivity of ASPCR was determined by the cutoff value and accuracy. The coefficient of variations (CVs) of intra-assay and inter-assay were calculated to evaluate the reproducibility of ASPCR.

Detection of clinical specimens

Genomic DNA was extracted from M129 strain-enriched culture solution and pharyngeal swab specimens using the QIAamp® DNA Mini Kit (QIAGEN, Shanghai, Germany), according to the manufacturer’s protocol. The DNA fragment in domain V of M. pneumoniae 23S rRNA region were detected using nested PCR method as previously reported [29, 30] and ASPCR as above. Each sample was amplified by mutant-specific and non-specific primers of each mutation separately and the amplifications ran in duplicate. The corresponding standards of the mutations were tested in each plate, and the standard cure was drawn every time for quantification. The Ct values of the amplifications of clinical samples using specific and non-specific primer were interpolated into the corresponding standard curves to get the numbers of mutant DNA and the total DNA. Then the proportions of A2063G and A2064G MRMP quasispecies populations were calculated.

Statistical analysis

All statistical analysis was performed using IBM SPSS Statistics 19. Continuous variables were compared with the Student’s t test or Analysis of Variance, and categorical variables were compared with the Chi-square test. To evaluate the coincidence ratio between the ASPCR and nested PCR assay, the kappa coefficient was calculated using Chi-square test. A P-value of < 0.05 were considered to statistical significance.

Results

Standard curve and amplification efficiency

The assays could detect the 23S rRNA gene down to 10 copies/reaction and the Ct values were log-linearly correlated with the copy numbers of the standards over the range of 101–108 copies (Fig. 1) for each set of mutant-specific and non-specific primers. The mutant-specific and non-specific amplification efficiencies of each set of primers were comparable. The correlation coefficients (r2) of all primer sets on their respective corresponding standards were higher than 0.99. These standard curves could be used to determine the copy number of each sample. Lastly, it was worth mentioning that no fragments were amplified in the negative controls (no template control (NTC)) in each PCR reaction.

Specificity of ASPCR

To evaluate the specificities of the mutant-specific primers, we compared the Ct values of identical amounts of mutant and wild-type DNA with the corresponding mutant-specific primer set. The ΔCt value represented the differences in Ct values when 107 copies mutant and wild-type plasmids were amplified with corresponding mutant-specific primers of each mutation. For the mutant-specific primer sets of A2063G and A2064G, the ΔCt values were 16.99 and 10.56, respectively, all ΔCt values were > 10. These results indicated that the amplification efficiency dramatically decreased for wild-type template using mutant-specific primer and all the specific primer sets could successfully discriminate the mutant template from wild-type template. In the second experiment to evaluate the discriminatory ability of each assay, the Ct values of mutant DNA and the mixture of mutant and wild-type plasmids were linearly correlated (Fig. 2). These results illustrated that the discriminatory ability of the two ASPCR assays remained unaltered until the mutant DNA was less than 0.01%.
In addition, the specificity of ASPCR for M. pneumoniae was tested by analyzing the reference species listed in samples and reference strain. As Fig. 3 shown, in the melting curve, the Tm value of standard strain M. pneumoniae M129 (ATCC 29342) that amplified by ASPCR was 79.4, and the Tm of the other reference strains were as following: Neisseria mucus (Tm = 87.92), Klebsiella pneumoniae (Tm = 86.83), Escherichia coli (Tm = 84.29), Staphylococcus aureus (Tm = 84.84), Streptococcus pneumoniae (Tm = 85.56), Pseudomonas aeruginosa (Tm = 88.82), Mycoplasma fermentans (Tm = 84.84), Ureaplasma urealyticum (Tm = 85.38), Mycoplasma pyriformis (Tm = 84.65), Mycoplasma hominis (Tm = 85). All the above indicated that by amplifying the Ct value of the curve and the Tm value of the melting curve, the DNA of M. pneumoniae could be successfully distinguished from other strains’ DNA.

Sensitivity and accuracy of ASPCR

The cut-off Ct value were 33.57 and 32.76 for detecting of A2063G and A2064G, respectively. The Ct values of the mixtures with mutant template ranging from 0.01 to 100% were less than the cut-off values of detecting A2063G and A2064G assays (Fig. 4). These indicated that resistance-associated mutations could still be detected until their proportion was about 0.01%. The Ct values of mixtures amplified with corresponding specific and non-specific primer were interpolated into the corresponding standard curves to get the numbers of mutant template and the total template. Then the proportions of mutant template in the mixtures were calculated, and the measured and nominal proportions were comparable (Fig. 4). The measured proportions of detecting A2063G and A2064G assays were accurate down to 0.1%. The sensitivities of ASPCR testing A2063G and A2064G were both determined as 0.1%, considering the cut-off value and accuracy of these assays.

Reproducibility of ASPCR

The intra-assay CVs of detecting A2063G and A2064G assays were below 0.11, and the inter-assay CVs were below 0.18 (Table 2). These results indicated that the ASPCR assays for detecting A2063G and A2064G had good reproducibility.
Table 2
Intra-assay and inter-assay coefficients of variation (CVs)
Mutant proportion (%)
CV Intra-assay
CV Inter-assay
A2063G
A2064G
A2063G
A2064G
100
0.050
0.065
0.180
0.045
10
0.054
0.093
0.168
0.045
1
0.052
0.104
0.147
0.025

Prevalence of M. pneumoniae and macrolide-resistant genotype

For 178 clinical samples, 164 samples were found to be M. pneumoniae positive by ASPCR. Among the 164 samples, 90.85% (149/164) samples were found to have the resistance mutations including 61.07% (91/149) with A2063G, 3.36% (5/149) with A2064G and 35.57% (53/149) with both mutations, while only 9.15% (15/164) of samples contained the wild-type (Table 3). Moreover, among the 149 samples, the mixing genotypes of A2063G and A2064G, A2063G and wild-type, A2064G and wild-type, and A2063G, A2064G and wild-type were detected in 10, 53, 5 and 43 samples, separately (Table 3). The clinical sample detection results of ASPCR indicated that the sensitive and resistant quasispecies were co-existed in most (67.79%, 101/149) of the M. pneumoniae positive samples.
Table 3
Comparison of the performance characteristics of two methods for detection of macrolide resistance mutations at 23S rRNA
Genotypes
Method
ASPCR
Nested PCR + sequencing
Total
178
178
M. pneumoniae positive (no, %)
164
153
Resistance mutations
149
110
A2063G
38
109
A2063G + WT
53
0
A2064G + WT
5
0
A2063G + A2064G + WT
43
0
A2063G + A2064G
10
0
A2064G
0
1
WT
15
43
Negative
14
25
WT (wild-type): no macrolide resistance mutation detected
The results of detecting the 178 clinical samples using ASPCR were compared with the results of detection by nested PCR with sequencing. The M. pneumoniae positive ratios of ASPCR and nested PCR with sequencing were 92.13% (164/178) and 85.96% (153/178), respectively. A relatively low coincidence ratio (kappa coefficient = 0.515) of detecting M. pneumoniae infection was shown between the ASPCR assays and nested PCR with sequencing analysis. The drug-resistance ratios of these samples tested by ASPCR and nested PCR with sequencing were 90.85% (149/164) vs 71.90% (110/153) (χ2 = 19.031, P < 0.001). The positive ratios of drug-resistant associated mutations tested by ASPCR and nested PCR with sequencing were as follows: A2063G, 87.80% (144/164) vs. 71.24% (109/153) (χ2 = 13.476, P < 0.001), A2064G, 35.37% (58/164) vs. 0.65% (1/153) (χ2 = 59.320, P < 0.001) (Table 3). The prevalence rates of A2063G and A2064G tested by ASPCR were significantly higher than the results of nested PCR with sequencing.
The distributions of cases with different proportions of A2063G and A2064G detected by ASPCR were analyzed and compared with general sequencing after nested PCR. The frequencies of the A2063G were < 30% in 28 specimens, 30 to 50% in 24 specimens, 50 to 100% in 92 specimens. The frequencies of the A2064G were < 30% in 56 specimens, 30 to 50% in 2 specimens, while the 50 to 100% frequency of A2064G was not detected in the clinical specimens (Table 4). The cases carrying A2063G and A2064G tested by nested PCR with sequencing were clustered significantly on higher (≧30 and < 50% and≧50%) mutation proportions determined by ASPCR. These results indicated that the sensitivity of ASPCR was significantly higher than that of the nested PCR with sequencing.
Table 4
Distribution of cases on different proportions of A2063G and A2064G tested by ASPCR and compared with nested PCR following with sequencing
Method
 
Proportion of mutation (ASPCR) (%)
Total
 
<S
≧S and < 30
≧30 and < 50
≧50 and < 100
100
Negative
Nested PCR + sequencing
A2063G
5
14
13
41
33
3
109
WT
10
12
9
12
1
0
44
Negative
5
2
2
1
4
11
25
Total
20
28
24
54
38
14
178
Nested PCR + sequencing
A2064G
0
0
1
0
0
0
1
WT
93
55
1
0
0
3
152
Negative
13
1
0
0
0
11
25
Total
106
56
2
0
0
14
178
S: the sensitivity of the ASPCR assay
Because of the information limitation of the clinical specimens, the general characteristics for only 154 patients with infection by wild-type and mutant M. pneumoniae determined by ASPCR were compared (Table 5). There was no significant difference in median age, gender and disease process among these groups analyzed in different analysis (P > 0.05 for all comparisons). An alternative analysis was conducted by allocating infected persons based on the percentage of the mutant M. pneumoniae determined by ASPCR (Table 5), and there was no significant differences between the three groups of WT, low frequency mutant group and high frequency mutant group for all parameters (P > 0.05 for all comparisons).
Table 5
Comparison of characteristics of patients infected by WT and different frequency mutant M. pneumoniae determined by ASPCR assays
Characteristic
WT
Mutant M. pneumoniae (Low frequency/High frequency)
P Two groups/Three groups
n
15
139 (52/87)
 
Mean age (year)
5.58 ± 3.35
6.43 ± 3.14 (6.38 ± 2.91/6.46 ± 3.29)
0.408/0.646 (F = 0.438)
Female (no, %)
7 (46.7%)
64 (46.0%) (26 (40.6%)/38 (59.4%))
0.963/0.769 (χ2 = 0.526)
Disease process (days)
6.86 ± 7.58
8.26 ± 6.49 (9.42 ± 8.79/7.71 ± 5.05)
0.698/0.336 (F = 1.099)
WT: no macrolide resistance mutation detected (group A); mutant M. pneumoniae: A2063G or A2064G mutation detected (group B); low frequency: macrolide resistance mutation present at low percentage (≧S and < 50%) (group C); high frequency: macrolide resistance mutation present at high percentage (≧50%) (group D); two groups: WT (group A) and mutant M. pneumoniae (group B); three groups: WT (group A), low frequency (group C) and high frequency (group D)

Discussion

Comparing with the routine drug resistance detecting assays, ASPCR is a highly sensitive, accurate, time-saving and high throughput method for detecting resistant M. pneumoniae and analyzing the mutation frequency. The sensitivity and accuracy of ASPCR were directly proportional to the discrimination ability of the specific primers, which was strongly influenced by the particular 3′ end base sequence. The bases near the 3’end of the specific primer were replaced by hypoxanthine in order to enhance the specificity of the ASPCR assays [27]. The number and location of hypoxanthine were critical for the discrimination ability of the specific primer. In this study, each ASPCR assay could detect more than 10 copies/reaction of 23S rRNA gene and the presence of mutant species with the sensitivity down to 0.1%. Although the mismatch occurred at the 3’end of the specific primer, the measured proportions of detecting A2063G and A2064G assays were accurate down to 0.1%, and the intra-assay and inter-assay CVs of the ASPCR were below 0.18.
The main limitation of the ASPCR is that only one mutation can be detected in every reaction, while many mutations can be tested at once using nested PCR with sequencing. Prior study had demonstrated that the polymorphisms that occur in the specific primer binding sites can significantly impair the accuracy of ASPCR assays [27]. The polymorphism must be taken into account when testing clinical samples and the prior sequencing is suggested to overcome this limitation, while ASPCR was applied in detecting the drug-resistance associated mutations of HIV [31]. The polymorphism had little effect on the detection of A2063G and A2064G mutations of M. pneumoniae, because of the lower variability of M. pneumoniae compared with HIV and the high conserved sequence near these mutations. Considering this, it is more suitable to apply ASPCR detecting mutations of M. pneumoniae than that of other hypervariable virus.
Previous, Chan et al. [32] compared the detecting result of low-frequency MRMP quasispecies that obtained by pyrosequencing with those obtained by Sanger sequencing and SimpleProbe PCR coupled to melting curve analysis on respiratory specimens. The results indicated that pyrosequencing identified A2063G MRMP quasispecies populations in 78.8% (67/88) of the specimens, and only 38.8% (26/67) of these specimens with the A2063G quasispecies detected by pyrosequencing were found to be A2063G quasispecies by Sanger sequencing or SimpleProbe PCR. In this study, the results showed 96.64% of the resistant specimens had A2063G mutation, 35.57% (53/149) with both A2063G and A2064G mutations that was not tested by other method in previous study, such as Chan et al. [32], Lin et al. [19] and Ji et al. [21], which might indicate ASPCR is a highly sensitive, accurate, time-saving and high throughput method for detecting resistant M. pneumoniae. Of the 164 M. pneumoniae positive samples, 61.59% had the mixing of wild-type and drug resistant M. pneumoniae, and 56.44% of the latter contained the drug resistance mutations at low frequency (≤50%). These results of ASPCR indicated that sensitive and resistant quasispecies coexisted in most of the M. pneumoniae-positive samples, and the resistant mutations could be at a relative low frequency. These finds were important directive significance for the clinical management. Furthermore, compared to the nested PCR with sequencing, ASPCR testing has short the turnaround time, is highly sensitive for testing M. pneumoniae and is able to discriminate the samples with resistant M. pneumoniae at a very low frequency. All these make the ASPCR an attractive method for the highly sensitive and rapid diagnosis of M. pneumoniae. The study of minor resistant variants in M. pneumoniae infection is relevant to understanding the mechanisms of the generation and development of drug resistance. It is also very important for clinical management to test and monitor the drug-resistance associated mutations.
There are several limitations to our study. Firstly, the sample size was small. Secondly, clinical sample information was incomplete collection, which may lead to inaccurate statistical analysis. Thirdly, the specificity of the ASPCR assay was only used to test on the strains that associated with respiratory infections, not on respiratory tract specimens. Therefore, in future, a large sample size with complete clinical data is needed to further study to confirm the study, and the related factors between M. pneumoniae resistance and infection are needed to analyze.

Conclusions

In generally, due to its highly sensitivity and accuracy, the ASPCR assays can be used as a particularly useful tool for resistance surveillance and studying the mechanism of the generation and development of drug resistance. In future study, the ASPCR assays can be used to characterize the dynamics of mutants in vivo by measuring the proportion of A2063G and A2064G variants in serial pharyngeal swabs specimensying and study the kinetics of selection and decay of point resistance mutations. For future application, ASPCR can also be easily developed for detecting other mutations associated with drug resistance of M. pneumoniae using proper standards and primers.

Acknowledgements

Not applicable.
This study was approved by the Medical Ethics Committee of Beijing Friendship Hospital, Capital Medical University (No. 2015-P2–022-01). Written informed consent was obtained from parents of each underaged participant.
Not applicable.

Competing interests

The authors declare that they have no competing interests.
Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://​creativecommons.​org/​licenses/​by/​4.​0/​), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://​creativecommons.​org/​publicdomain/​zero/​1.​0/​) applies to the data made available in this article, unless otherwise stated.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Literatur
1.
Zurück zum Zitat Pereyre S, Goret J, Bebear C. Mycoplasma pneumoniae: current knowledge on macrolide resistance and treatment. Front Microbiol. 2016;7:974.CrossRef Pereyre S, Goret J, Bebear C. Mycoplasma pneumoniae: current knowledge on macrolide resistance and treatment. Front Microbiol. 2016;7:974.CrossRef
2.
Zurück zum Zitat Tanaka T, Oishi T, Miyata I, Wakabayashi S, Kono M, Ono S, Kato A, Fukuda Y, Saito A, Kondo E, et al. Macrolide-resistant Mycoplasma pneumoniae infection, Japan, 2008-2015. Emerg Infect Dis. 2017;23(10):1703–6.CrossRef Tanaka T, Oishi T, Miyata I, Wakabayashi S, Kono M, Ono S, Kato A, Fukuda Y, Saito A, Kondo E, et al. Macrolide-resistant Mycoplasma pneumoniae infection, Japan, 2008-2015. Emerg Infect Dis. 2017;23(10):1703–6.CrossRef
3.
Zurück zum Zitat Ha SG, Oh KJ: Therapeutic Efficacy and Safety of Prolonged Macrolide, Corticosteroid, Doxycycline, and Levofloxacin against Macrolide-Unresponsive Mycoplasma pneumoniae Pneumonia in Children. 2018, 33(43):e268. Ha SG, Oh KJ: Therapeutic Efficacy and Safety of Prolonged Macrolide, Corticosteroid, Doxycycline, and Levofloxacin against Macrolide-Unresponsive Mycoplasma pneumoniae Pneumonia in Children. 2018, 33(43):e268.
4.
Zurück zum Zitat Yamazaki T, Kenri T. Epidemiology of mycoplasma pneumoniae infections in Japan and therapeutic strategies for macrolide-Resistant M. pneumoniae. Front Microbiol. 2016;7:693.CrossRef Yamazaki T, Kenri T. Epidemiology of mycoplasma pneumoniae infections in Japan and therapeutic strategies for macrolide-Resistant M. pneumoniae. Front Microbiol. 2016;7:693.CrossRef
5.
Zurück zum Zitat Okazaki N, Narita M, Yamada S, Izumikawa K, Umetsu M, Kenri T, Sasaki Y, Arakawa Y, Sasaki T. Characteristics of macrolide-resistant Mycoplasma pneumoniae strains isolated from patients and induced with erythromycin in vitro. Microbiol Immunol. 2001;45(8):617–20.CrossRef Okazaki N, Narita M, Yamada S, Izumikawa K, Umetsu M, Kenri T, Sasaki Y, Arakawa Y, Sasaki T. Characteristics of macrolide-resistant Mycoplasma pneumoniae strains isolated from patients and induced with erythromycin in vitro. Microbiol Immunol. 2001;45(8):617–20.CrossRef
6.
Zurück zum Zitat Kogoj R, Mrvic T, Praprotnik M, Kese D. Prevalence, genotyping and macrolide resistance of Mycoplasma pneumoniae among isolates of patients with respiratory tract infections, Central Slovenia, 2006 to 2014. Eurosurveillance. 2015;20(37):14–20.CrossRef Kogoj R, Mrvic T, Praprotnik M, Kese D. Prevalence, genotyping and macrolide resistance of Mycoplasma pneumoniae among isolates of patients with respiratory tract infections, Central Slovenia, 2006 to 2014. Eurosurveillance. 2015;20(37):14–20.CrossRef
7.
Zurück zum Zitat Uldum SA, Bangsborg JM, Gahrn-Hansen B, Ljung R, Molvadgaard M, Fons Petersen R, Wiid Svarrer C. Epidemic of Mycoplasma pneumoniae infection in Denmark, 2010 and 2011. Euro Surveill. 2012;17(5). Uldum SA, Bangsborg JM, Gahrn-Hansen B, Ljung R, Molvadgaard M, Fons Petersen R, Wiid Svarrer C. Epidemic of Mycoplasma pneumoniae infection in Denmark, 2010 and 2011. Euro Surveill. 2012;17(5).
8.
Zurück zum Zitat Peuchant O, Menard A, Renaudin H, Morozumi M, Ubukata K, Bebear CM, Pereyre S. Increased macrolide resistance of Mycoplasma pneumoniae in France directly detected in clinical specimens by real-time PCR and melting curve analysis. J Antimicrob Chemother. 2009;64(1):52–8.CrossRef Peuchant O, Menard A, Renaudin H, Morozumi M, Ubukata K, Bebear CM, Pereyre S. Increased macrolide resistance of Mycoplasma pneumoniae in France directly detected in clinical specimens by real-time PCR and melting curve analysis. J Antimicrob Chemother. 2009;64(1):52–8.CrossRef
9.
Zurück zum Zitat Yamada M, Buller R, Bledsoe S, Storch GA. Rising rates of macrolide-resistant Mycoplasma pneumoniae in the Central United States. Pediatr Infect Dis J. 2012;31(4):409–0.CrossRef Yamada M, Buller R, Bledsoe S, Storch GA. Rising rates of macrolide-resistant Mycoplasma pneumoniae in the Central United States. Pediatr Infect Dis J. 2012;31(4):409–0.CrossRef
10.
Zurück zum Zitat Kogoj R, Praprotnik M, Mrvic T, Korva M, Kese D. Genetic diversity and macrolide resistance of Mycoplasma pneumoniae isolates from two consecutive epidemics in Slovenia. Eur J Clin Microbiol Infect Dis. 2017. Kogoj R, Praprotnik M, Mrvic T, Korva M, Kese D. Genetic diversity and macrolide resistance of Mycoplasma pneumoniae isolates from two consecutive epidemics in Slovenia. Eur J Clin Microbiol Infect Dis. 2017.
11.
Zurück zum Zitat Averbuch D, Hidalgo-Grass C, Moses AE, Engelhard D, Nir-Paz R. Macrolide resistance in Mycoplasma pneumoniae, Israel, 2010. Emerg Infect Dis. 2011;17(6):1079–82.CrossRef Averbuch D, Hidalgo-Grass C, Moses AE, Engelhard D, Nir-Paz R. Macrolide resistance in Mycoplasma pneumoniae, Israel, 2010. Emerg Infect Dis. 2011;17(6):1079–82.CrossRef
12.
Zurück zum Zitat Cao B, Zhao CJ, Yin YD, Zhao F, Song SF, Bai L, Zhang JZ, Liu YM, Zhang YY, Wang H, et al. High prevalence of macrolide resistance in Mycoplasma pneumoniae isolates from adult and adolescent patients with respiratory tract infection in China. Clin Infect Dis. 2010;51(2):189–94.CrossRef Cao B, Zhao CJ, Yin YD, Zhao F, Song SF, Bai L, Zhang JZ, Liu YM, Zhang YY, Wang H, et al. High prevalence of macrolide resistance in Mycoplasma pneumoniae isolates from adult and adolescent patients with respiratory tract infection in China. Clin Infect Dis. 2010;51(2):189–94.CrossRef
13.
Zurück zum Zitat Xin D, Mi Z, Han X, Qin L, Li J, Wei T, Chen X, Ma S, Hou A, Li G, et al. Molecular mechanisms of macrolide resistance in clinical isolates of Mycoplasma pneumoniae from China. Antimicrob Agents Chemother. 2009;53(5):2158–9.CrossRef Xin D, Mi Z, Han X, Qin L, Li J, Wei T, Chen X, Ma S, Hou A, Li G, et al. Molecular mechanisms of macrolide resistance in clinical isolates of Mycoplasma pneumoniae from China. Antimicrob Agents Chemother. 2009;53(5):2158–9.CrossRef
14.
Zurück zum Zitat Zhao F, Lv M, Tao X, Huang H, Zhang B, Zhang Z, Zhang J. Antibiotic sensitivity of 40 Mycoplasma pneumoniae isolates and molecular analysis of macrolide-resistant isolates from Beijing, China. Antimicrob Agents Chemother. 2012;56(2):1108–9.CrossRef Zhao F, Lv M, Tao X, Huang H, Zhang B, Zhang Z, Zhang J. Antibiotic sensitivity of 40 Mycoplasma pneumoniae isolates and molecular analysis of macrolide-resistant isolates from Beijing, China. Antimicrob Agents Chemother. 2012;56(2):1108–9.CrossRef
15.
Zurück zum Zitat Li X, Atkinson TP, Hagood J, Makris C, Duffy LB, Waites KB. Emerging macrolide resistance in Mycoplasma pneumoniae in children: detection and characterization of resistant isolates. Pediatr Infect Dis J. 2009;28(8):693–6.CrossRef Li X, Atkinson TP, Hagood J, Makris C, Duffy LB, Waites KB. Emerging macrolide resistance in Mycoplasma pneumoniae in children: detection and characterization of resistant isolates. Pediatr Infect Dis J. 2009;28(8):693–6.CrossRef
16.
Zurück zum Zitat Bebear CM, Pereyre S. Mechanisms of drug resistance in Mycoplasma pneumoniae. Curr Drug Targets Infect Disord. 2005;5(3):263–71.CrossRef Bebear CM, Pereyre S. Mechanisms of drug resistance in Mycoplasma pneumoniae. Curr Drug Targets Infect Disord. 2005;5(3):263–71.CrossRef
17.
Zurück zum Zitat Pereyre S, Guyot C, Renaudin H, Charron A, Bebear C, Bebear CM. In vitro selection and characterization of resistance to macrolides and related antibiotics in Mycoplasma pneumoniae. Antimicrob Agents Chemother. 2004;48(2):460–5.CrossRef Pereyre S, Guyot C, Renaudin H, Charron A, Bebear C, Bebear CM. In vitro selection and characterization of resistance to macrolides and related antibiotics in Mycoplasma pneumoniae. Antimicrob Agents Chemother. 2004;48(2):460–5.CrossRef
18.
Zurück zum Zitat Morozumi M, Takahashi T, Ubukata K. Macrolide-resistant Mycoplasma pneumoniae: characteristics of isolates and clinical aspects of community-acquired pneumonia. Journal of infection and chemotherapy : official journal of the Japan Society of Chemotherapy. 2010;16(2):78–86.CrossRef Morozumi M, Takahashi T, Ubukata K. Macrolide-resistant Mycoplasma pneumoniae: characteristics of isolates and clinical aspects of community-acquired pneumonia. Journal of infection and chemotherapy : official journal of the Japan Society of Chemotherapy. 2010;16(2):78–86.CrossRef
19.
Zurück zum Zitat Lin C, Li S, Sun H, Zhao H, Feng Y, Cao L, Yuan Y, Zhang T. Nested PCR-linked capillary electrophoresis and single-strand conformation polymorphisms for detection of macrolide-resistant Mycoplasma pneumoniae in Beijing, China. J Clin Microbiol. 2010;48(12):4567–72.CrossRef Lin C, Li S, Sun H, Zhao H, Feng Y, Cao L, Yuan Y, Zhang T. Nested PCR-linked capillary electrophoresis and single-strand conformation polymorphisms for detection of macrolide-resistant Mycoplasma pneumoniae in Beijing, China. J Clin Microbiol. 2010;48(12):4567–72.CrossRef
20.
Zurück zum Zitat Waites KB, Balish MF, Atkinson TP. New insights into the pathogenesis and detection of Mycoplasma pneumoniae infections. Future Microbiol. 2008;3(6):635–48.CrossRef Waites KB, Balish MF, Atkinson TP. New insights into the pathogenesis and detection of Mycoplasma pneumoniae infections. Future Microbiol. 2008;3(6):635–48.CrossRef
21.
Zurück zum Zitat Ji M, Lee NS, Oh JM, Jo JY, Choi EH, Yoo SJ, Kim HB, Hwang SH, Choi SH, Lee SO, et al. Single-nucleotide polymorphism PCR for the detection of Mycoplasma pneumoniae and determination of macrolide resistance in respiratory samples. J Microbiol Methods. 2014;102:32–6.CrossRef Ji M, Lee NS, Oh JM, Jo JY, Choi EH, Yoo SJ, Kim HB, Hwang SH, Choi SH, Lee SO, et al. Single-nucleotide polymorphism PCR for the detection of Mycoplasma pneumoniae and determination of macrolide resistance in respiratory samples. J Microbiol Methods. 2014;102:32–6.CrossRef
22.
Zurück zum Zitat Spuesens EBM, Hoogenboezem T, Sluijter M, Hartwig NG, van Rossum AMC, Vink C. Macrolide resistance determination and molecular typing of Mycoplasma pneumoniae by pyrosequencing. J Microbiol Meth. 2010;82(3):214–22.CrossRef Spuesens EBM, Hoogenboezem T, Sluijter M, Hartwig NG, van Rossum AMC, Vink C. Macrolide resistance determination and molecular typing of Mycoplasma pneumoniae by pyrosequencing. J Microbiol Meth. 2010;82(3):214–22.CrossRef
23.
Zurück zum Zitat Liu Y, Ye X, Zhang H, Wu Z, Xu X. Rapid detection of Mycoplasma pneumoniae and its macrolide-resistance mutation by Cycleave PCR. Diagn Microbiol Infect Dis. 2014;78(4):333–7.CrossRef Liu Y, Ye X, Zhang H, Wu Z, Xu X. Rapid detection of Mycoplasma pneumoniae and its macrolide-resistance mutation by Cycleave PCR. Diagn Microbiol Infect Dis. 2014;78(4):333–7.CrossRef
24.
Zurück zum Zitat Li SL, Sun HM, Zhao HQ, Cao L, Yuan Y, Feng YL, Xue GH. A single tube modified allele-specific-PCR for rapid detection of erythromycin-resistant Mycoplasma pneumoniae in Beijing. Chin Med J. 2012;125(15):2671–6.PubMed Li SL, Sun HM, Zhao HQ, Cao L, Yuan Y, Feng YL, Xue GH. A single tube modified allele-specific-PCR for rapid detection of erythromycin-resistant Mycoplasma pneumoniae in Beijing. Chin Med J. 2012;125(15):2671–6.PubMed
25.
Zurück zum Zitat Suzuki Y, Seto J, Shimotai Y, Ikeda T, Yahagi K, Mizuta K, Matsuzaki Y, Hongo S. Development of an endpoint genotyping assay to detect the Mycoplasma pneumoniae 23S rRNA gene and distinguish the existence of macrolide resistance-associated mutations at position 2063. J Microbiol Methods. 2016;131:130–4.CrossRef Suzuki Y, Seto J, Shimotai Y, Ikeda T, Yahagi K, Mizuta K, Matsuzaki Y, Hongo S. Development of an endpoint genotyping assay to detect the Mycoplasma pneumoniae 23S rRNA gene and distinguish the existence of macrolide resistance-associated mutations at position 2063. J Microbiol Methods. 2016;131:130–4.CrossRef
26.
Zurück zum Zitat Wolff BJ, Thacker WL, Schwartz SB, Winchell JM. Detection of macrolide resistance in Mycoplasma pneumoniae by real-time PCR and high-resolution melt analysis. Antimicrob Agents Chemother. 2008;52(10):3542–9.CrossRef Wolff BJ, Thacker WL, Schwartz SB, Winchell JM. Detection of macrolide resistance in Mycoplasma pneumoniae by real-time PCR and high-resolution melt analysis. Antimicrob Agents Chemother. 2008;52(10):3542–9.CrossRef
27.
Zurück zum Zitat Paredes R, Marconi VC, Campbell TB, Kuritzkes DR. Systematic evaluation of allele-specific real-time PCR for the detection of minor HIV-1 variants with pol and env resistance mutations. J Virol Methods. 2007;146(1–2):136–46.CrossRef Paredes R, Marconi VC, Campbell TB, Kuritzkes DR. Systematic evaluation of allele-specific real-time PCR for the detection of minor HIV-1 variants with pol and env resistance mutations. J Virol Methods. 2007;146(1–2):136–46.CrossRef
28.
Zurück zum Zitat Metzner KJ, Bonhoeffer S, Fischer M, Karanicolas R, Allers K, Joos B, Weber R, Hirschel B, Kostrikis LG, Gunthard HF, et al. Emergence of minor populations of human immunodeficiency virus type 1 carrying the M184V and L90M mutations in subjects undergoing structured treatment interruptions. J Infect Dis. 2003;188(10):1433–43.CrossRef Metzner KJ, Bonhoeffer S, Fischer M, Karanicolas R, Allers K, Joos B, Weber R, Hirschel B, Kostrikis LG, Gunthard HF, et al. Emergence of minor populations of human immunodeficiency virus type 1 carrying the M184V and L90M mutations in subjects undergoing structured treatment interruptions. J Infect Dis. 2003;188(10):1433–43.CrossRef
29.
Zurück zum Zitat Talkington DF, Thacker WL, Keller DW, Jensen JS. Diagnosis of Mycoplasma pneumoniae infection in autopsy and open-lung biopsy tissues by nested PCR. J Clin Microbiol. 1998;36(4):1151–3.PubMedPubMedCentral Talkington DF, Thacker WL, Keller DW, Jensen JS. Diagnosis of Mycoplasma pneumoniae infection in autopsy and open-lung biopsy tissues by nested PCR. J Clin Microbiol. 1998;36(4):1151–3.PubMedPubMedCentral
30.
Zurück zum Zitat Tian XJ, Dong YQ, Dong XP, Li JY, Li D, Jiang Y, Xin DL. P1 gene of Mycoplasma pneumoniae in clinical isolates collected in Beijing in 2010 and relationship between genotyping and macrolide resistance. Chin Med J. 2013;126(20):3944–8.PubMed Tian XJ, Dong YQ, Dong XP, Li JY, Li D, Jiang Y, Xin DL. P1 gene of Mycoplasma pneumoniae in clinical isolates collected in Beijing in 2010 and relationship between genotyping and macrolide resistance. Chin Med J. 2013;126(20):3944–8.PubMed
31.
Zurück zum Zitat Guo DX, Li HP, Li L, Zhuang DM, Jiao LY, Wang Z, Bao ZY, Liu SY, Liu YJ, Li JY. Allele-specific real-time PCR testing for minor HIV-1 drug resistance mutations: assay preparation and application to reveal dynamic of mutations in vivo. Chin Med J. 2010;123(23):3389–95.PubMed Guo DX, Li HP, Li L, Zhuang DM, Jiao LY, Wang Z, Bao ZY, Liu SY, Liu YJ, Li JY. Allele-specific real-time PCR testing for minor HIV-1 drug resistance mutations: assay preparation and application to reveal dynamic of mutations in vivo. Chin Med J. 2010;123(23):3389–95.PubMed
32.
Zurück zum Zitat Chan KH, To KK, Chan BW, Li CP, Chiu SS, Yuen KY, Ho PL. Comparison of pyrosequencing, sanger sequencing, and melting curve analysis for detection of low-frequency macrolide-resistant mycoplasma pneumoniae quasispecies in respiratory specimens. J Clin Microbiol. 2013;51(8):2592–8.CrossRef Chan KH, To KK, Chan BW, Li CP, Chiu SS, Yuen KY, Ho PL. Comparison of pyrosequencing, sanger sequencing, and melting curve analysis for detection of low-frequency macrolide-resistant mycoplasma pneumoniae quasispecies in respiratory specimens. J Clin Microbiol. 2013;51(8):2592–8.CrossRef
Metadaten
Titel
Allele-specific real-time PCR testing for minor macrolide-resistant Mycoplasma Pneumoniae
verfasst von
Dongxing Guo
Wenjuan Hu
Baoping Xu
Jingyi Li
Dan Li
Shaogang Li
Zhaoyong Wu
Ran Wei
Xiujun Tian
Kunling Shen
Deli Xin
Publikationsdatum
01.12.2019
Verlag
BioMed Central
Erschienen in
BMC Infectious Diseases / Ausgabe 1/2019
Elektronische ISSN: 1471-2334
DOI
https://doi.org/10.1186/s12879-019-4228-4

Weitere Artikel der Ausgabe 1/2019

BMC Infectious Diseases 1/2019 Zur Ausgabe

Leitlinien kompakt für die Innere Medizin

Mit medbee Pocketcards sicher entscheiden.

Seit 2022 gehört die medbee GmbH zum Springer Medizin Verlag

Alphablocker schützt vor Miktionsproblemen nach der Biopsie

16.05.2024 alpha-1-Rezeptorantagonisten Nachrichten

Nach einer Prostatabiopsie treten häufig Probleme beim Wasserlassen auf. Ob sich das durch den periinterventionellen Einsatz von Alphablockern verhindern lässt, haben australische Mediziner im Zuge einer Metaanalyse untersucht.

Eingreifen von Umstehenden rettet vor Erstickungstod!

15.05.2024 Fremdkörperaspiration Nachrichten

Wer sich an einem Essensrest verschluckt und um Luft ringt, benötigt vor allem rasche Hilfe. Dass Umstehende nur in jedem zweiten Erstickungsnotfall bereit waren, diese zu leisten, ist das ernüchternde Ergebnis einer Beobachtungsstudie aus Japan. Doch es gibt auch eine gute Nachricht.

Neue S3-Leitlinie zur unkomplizierten Zystitis: Auf Antibiotika verzichten?

15.05.2024 Harnwegsinfektionen Nachrichten

Welche Antibiotika darf man bei unkomplizierter Zystitis verwenden und wovon sollte man die Finger lassen? Welche pflanzlichen Präparate können helfen? Was taugt der zugelassene Impfstoff? Antworten vom Koordinator der frisch überarbeiteten S3-Leitlinie, Prof. Florian Wagenlehner.

Schadet Ärger den Gefäßen?

14.05.2024 Arteriosklerose Nachrichten

In einer Studie aus New York wirkte sich Ärger kurzfristig deutlich negativ auf die Endothelfunktion gesunder Probanden aus. Möglicherweise hat dies Einfluss auf die kardiovaskuläre Gesundheit.

Update Innere Medizin

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.