Background
NF-kB has long been recognized as a potent tumor promoter and a lot drugs are targeting NF-kB in cancer treatment. However, more recent evidence suggests that NF-kB can also inhibit the tumor growth. The first pieces of evidence that NF-kB can function as a tumor suppressor came from studies of chemically-induced skin cancer, in which inhibition of NF-kB via IĸB-SR expression in keratinocytes enhanced the multiplicity of squamous cell carcinomas in response to 7,12-Dimethylbenz(a)anthracene (DMBA). Furthermore, inhibition of NF-kB in primary human keratinocytes promoted Ras-mediated transformation. The tumor suppressing activity of NF-kB was explained either by inhibition of cell cycle or by downregulating of MAPKs pathway [
1‐
3]. Members from distinct signaling cascades of the MAPK family such as SAPK/JNK, p38 MAPK, and ERK1/2 are known to determine cell fate during DNA damage, mitogenic stimuli, and survival. Nevertheless, in different cell line and under different irritation, the involved signaling cascades of MAPKs are different [
1,
4‐
7]. In particular, the interplay between NF-kB and JNK may play a critical role in the development of Den- induced hepatocellular carcinoma (HCC), while ERK activation was seen in Ras-IĸBα tumors and patient’s squamous cell carcinoma (SCCs).
Our previous study showed that in ovarian carcinoma cell lines OVCA433 and OVCR3, introduction of a dominant negative mutant IĸBα (IĸBαM), which constitutively suppresses NF-kB function, resulted in cell proliferation and inhibition of apoptosis through ERK/MAPKs pathway. Despite the solid evidence supporting the potential relevance of both activation of Ras/MAPK pathway and blockade of NF-kB in at least a subset of spontaneous human epidermal SCCs, the exact functions latent mechanism of NF-kB and MAPK pathways in low grade ovarian cancer are still unknown. The KRAS and BRAF are the upstream of MAPKs pathway and genetic alterations in these genes are associated with carcinogenesis [
8‐
11]. Because therapeutics interventions inhibiting Ras and NF-kB pathways are being developed to treat human ovarian cancer, it is crucial to assess the effects of altering these regulators. Since the quantities of active Ras-GTP were comparable in Ras-IĸBα tumors and in human epithelial cancer cells with defined Ras mutations [
12,
13], it is not hard to propose that the tumorigenesis was not due to expression of more active Ras than is expressed by endogenous mutant alleles. The mechanism about Ras and its phophorylated MAPK targets and the activity of NF-kB were uncertain, however, by critical shortage of ras mutation cell line and mouse model. Excitedly, HOC-7 provides us a kras mutation model to learn about the potential mechanism of these factors.
The origin, development and outcome of low-grade ovarian cancer are different from high-grade ovarian cancer. P53 overexpression and mutations are infrequent in low-grade ovarian cancer but occur in as many as 50 to 80 % of high-grade ovarian cancer. Depending on the morphologic, immunohistochemical and molecular genetic analyses of p53 comparing with low- and high-grade ovarian cancer, functional mutations, defined as mutations leading to the alteration of the structure of encoded protein, were detected in 50.8 % of high-grade cancer and 8.3 % of low-grade cancer. In our study, the role of p53 in NF-kB-related tumor suppression was also mentioned.
In this study, we investigated the functional role of NF-kB in cancer development using ovarian cancer as a model system. Our study provides first experimental evidence that NF-kB may inhibit the HOC-7 tumorigenesis in a p53 independent signaling manner.
Methods
HOC-7 with an average doubling time of 16.4 days is a kind gift from Dr R. N. Buick (University of Arizona, Tucson), which was derived from ascites of a patient with a well-differentiated Stage III serous adenocarcinoma of the ovary [
9,
14]. SKOV3 human ovarian cancer cell lines were bought from the American Type Culture Collection (Rockville, MD). HOC-7 and SKOV3 cell lines were cultured in Minimum Essential Alpha 1×/ RPMI-1640 medium (GIBCO BRL, Life Technologies, Gaithersburg, MD) supplemented with 10 % fetal bovine serum (HyClone, Logan, UT) at 37 °C with 5 % CO
2. Both HOC-7 and SKOV3 were transfected with dominant negative mutant IĸB, henceforth IĸBαM, using N-[1-(2,3-dioleoyloxyl)propyl]-N,N,N-trimethylammoniummethyl sulfate liposomal transfection reagent (Boehringer Mannheim, Indianapolis, IN) and selected by neomycin antibiotics (2.5ug/ml) for 14 days. The plasmid used for stable transfection was a pBabe-U6/puromycin vector (5.4 kb) containing IkBαM under cytomegalovirus (CMV) promoter expression control. The primers used to sequence IkBαM were p1: catatggatccatgtttcagccagctgggcacg p2: cctatctcgagttataatgtcagacgctggcctc. The mutation place in the serines 32 and 36 of IkBα were replaced by glycine and alanine, which damaged the phosphorylation and followed proteolysis, eventually led to the irreversible binding to Rel/NF-kB and inhibited its translocation in nuclei [
9,
15‐
18]. In addition, we transfected HOC-7 and IkBαM expressing HOC-7 cell line with p53 siRNA, the positive colony were selected by puromycin (300ug/ml). SiRNAs against p65 and p53 and control siRNA were purchased from Santa Cruz Biotechonology.
Mutantional analysis of KRAS in HOC-7 and SKOV3 cell lines
Genomic DNA was purified from all of the HOC-7 and SKOV3 cell lines using the QIAGEN’s DNeasy Tissue Kit (QIAGEN Inc, Chatsworth, CA, USA). PCR was performed ensued by nucleotide sequencing using the iCycler (Bio-Rad, Hercules, CA, USA), which is including the exon 1 of KRAS. The primers used to sequence were: 5-taaggcctgctgaaaatgactg-3 (forward); 5-tggtcctgcaccagtaatatgc-3 (reverse); and 5-ctgcaccagtaatatgcatattaaaac-3 (sequencing); The thermal profile was: first denaturation step 95 °C 2 min, followed by 95 °C 30 s, 58 °C for 30s, 72 °C for 35 s, total 35 cycles; 72 °C for 10 min [
19,
20]. The Lasergene program (DNASTAR, Madison, WI) was used to analyze these sequences.
Electrophoretic mobility shift assay (EMSA) and luciferase reporter assay
The electrophoretic mobility shift assay was performed as described before. Briefly, the nuclear extracts of different cell lines were prepared by lysed in nuclear extract buffer (20 mM HEPES, 400 mM NaCl, 1 Mm EDTA, 1 Mm EGTA, 10 μM dithiothreitol, 20 μg/ml leupeptin, 20 μg/ml aprotinin, 500 μg/ml benzamidine) and the concentrations were determined using the Coomassie brilliant blue G250 assay kit. Double-stranded deoxyoligonucleotides containing the NF-kB consensus recognition site (5′-AGT TGA GGG GAC TTT CCC AGG C-3′ and 5′-GCC TGG GAA AGT CCC CTC AAC T-3′, Santa Cruz Biotechnology Inc, Santa Cruz, CA) were labeled with (r-32p)ATP using T4 polynucleotide kinase according to the protocol. The nuclear probe was incubated with the radiolabeled probe DNA (3.5pmol, 10 μCi) and 4 μl 5 × binding buffer. For the supershift, the proteins were incubated with p65 or p50 monoclonal antibody before 32p labeled. All of the DNA-protein complexes were resolved on 5 % PAGE in Tris/glycine buffer after incubated at room temperature for 30 min. For the NF-kB transcription assay, seeded cells were precultured to 75 % confluence and transfected with and HIV promoter-driven luciferase cDNA plasmid, and then tested according to promega kit.
Cell proliferation assay
Cell proliferation was determined by examined by 3-[4, 5-dimethylthiazol-2-yl]-2, 5-diphenyltetrazolium bromide assay (MTTassay; Sigma) with the CellTiler 96 Aqucous One Solution Cell Proliferation Assay Kit (Promega) according to the manufacturer’s protocol. Four different cell lines HOC-7, HOC-7 IĸBαM, HOC-7 P53i and HOC-7 IĸBαM P53i were seeded at 5 × 103 cells/well in 96-well tissue culture plates. Cell growth curve was assessed every 24 h and totally 3 days.
Soft agar growth assay was performed as previously described (Difco, Detroit, MI). The four cell lines were mixed with 0.4 % agar were overlaid above the supporting 0.6 % agar and cultured total 25 days with replenished medium. Random fields were recorded using a Leica TCS4D confocal scanning laser microscope (Leica, Solms, Germany) and the total number and the size of the colonies were counted.
Western blot analysis
Western blot analysis was performed as preciously described. Lysates of treated cells or tumor samples were collected and lysed in radioimmunoprecipitation assay buffer. Equal amounts of proteins were resolved on SDS-PAGE and then transferred onto a polyvinylidene difluoride membrane. Specific primary antibodies were used for the following molecules : IĸBα(Cabiochem, San Diego, CA, USA), p65, Iĸĸα, Iĸĸβ, AKT, p-AKT, MEK, p-MEK, ERK, p-ERK, p38, caspase-10, caspase-1, cyclinA, cyclinB, PUMA, BID, CIAP, Bad, p-Bad, PKC (Cell signaling Technology), JNK2/1, p-JNK, TSP1, Bcl-2, Bcl-xL, Bax, APAF1, Fas, caspase-8, Mrg1, cyclinD, p53, MMP1 (Santa Cruze Biotechnology, CA), caspase-9, caspase-3 (BioLegend). β-Actin (Santa Cruze Biotechnology, CA) was used to assess the equal loading. The phosphorylated protein controls obtained from blots that had been stripped and re-probed for the same sample lane. Sixty microgram of cell protein extract was loaded per lane. CS-710 Calibrated Imaging Densitometer (Bio-Rad) was utilized for densitometric quantification.
Apoptosis detection
Derivative cells and control cells were cultured to 80 % confluence. Cells were harvested after being washed three times with ice-cold phosphate-buffered saline (PBS). Subsequently, cells were labeled with Annexin V and propidium iodide according to the manufacturer’s protocol (BD ApoAlert Annexin V-FITC Apoptosis kit; BD Biosciences, PaloAlto, CA) [
21]. The percentage of apoptotic cells was determined by (M2) peak in the histogram generated by FACSCalibur system and Cell Quest software (BD Biosciences).
Tumor xenograft in nude mice
The xenograft tumor model has been described earlier [
22]. Briefly, 5 × 106 cells of either wild type HOC-7, SKOV3, IĸBαM expressing HOC-7 and SKOV3 or P53-inactivating cells were subcutaneously injected into 4- to 6-week-old female BALB/athymic nude mice (NCI-Frederick, NIH). Each group includes 8 mice. One week after implantation, the mice were checked every 2 days per week. The control group received saline (PBS) only. The same quantity of saline was used in these groups to resuspend different cell lines. General clinical observation of the mice included determination of syndrome, side effect and body weight. To determine tumor size, we measured two perpendicular diameters of the xenograft in centimeters by calibers. Tumor weight was then estimated using formula 1/2a × b2, where a is the long diameter and b is the short diameter [
23,
24]. 66 days after the first injection, all mice were euthanized by carbon dioxide asphyxiation and the tumor tissues were processed for immunohistochemistry staining followed by 10 % formalin fixation overnight. All protocols for animal use were reviewed and approved by the Animal Care Committee of West China Second University hosipital in accordance with Institutional Animal Care and Use Committee guidelines.
Patient tissue specimens
The use of tissue blocks and chart reviews were approved by the Institutional Review Board of Sichuan University. The specimens, including controls, used in our study were preserved and stored by the Tissue Bank Core Facility at Sichuan University. Detailed quality control procedures for tissue sampling were chosen and implemented by the Tissue Bank Core Facility at Sichuan University. Patients had been treated with either chemotherapy or irradiation by the treating physicians, and the selection of patient tissues was not based on the treatments. Follow up information was updated through March 2011 by reviewing medical records. The randomly selected formalin-fixed paraffin-embedded tissues included normal ovarian tissues (
n = 20) and low-grade serous ovarian carcinomas (
n = 416) were not matched. Tumor sample collection and tissue microarray construction have been described previously [
25,
26]. Briefly, ovarian tissue microarray blocks were diagnosed in duplicate by two gynecologic pathologists who reviewed hematoxylin and eosin–stained sections and constructed by taking core samples from morphologically representative areas of paraffin-embedded tumor tissues and assembling them on a recipient paraffin block. The follow-up protocol have been mentioned previously, the same as the characteristics of exclusion criteria and eligible participants. All of the participants provided written informed consent and the study protocol was agreed by the institutional review boards of Sichuan University (no.11789).
Immunohistochemical staining and analysis
The streptavidin-peroxidase immunohistostaining method for NF-kB p65 was performed as described elsewhere [
27,
28]. Briefly, samples were fixed in 10 % formalin buffer and embedded in paraffin. Tissue sections (4 μm thick) were steamed in universal decloaker (Biocare Medical, Walnut Creek, CA, USA) for antigen retrieval, followed by 19 min protein-blocking (Biocare Medical). All slides were first incubated against NF-kB p65 (1:500, for 1 h at room temperature; Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA) and then treated with secondary antibody (Biocare Medical) and horseradish peroxidase for 15 min each. The tissues were stained for 3 min with high sensitivity 3,3′-diaminobenzidine tetrahydrochloride, counterstained with hematoxylin, dehydrated and then mounted [
29,
30].
Statistical analysis
Statistical analysis was performed by using Fisher’s exact test at different time points for the mean tumor sizes of each group. X-tile software was used to find the optimal cut-off point. Monte Carlo simulations was used to determine the prognostic significance. Disease-specific survival rates were calculated by the Kaplan-Meier method and compared by the log-rank test. Cox proportional hazards regression models in Statistica software (SAS Institute, SAS Language Reference, version 8, SAS Institute, Inc) were used for multivariate analyses of survival. The rest of statistical analysis was performed by using Student’s t-test (STATISTICA6 software, StatSoft, Tulsa, OK). Differences with P-value was less than 0.05 were considered significant. All statistical tests were two-sided.
Discussion
For a long time, the role of NF-kB was described as oncogeic with respect to its function in promoting cell proliferation, angiogenesis, transformation and invasion [
9,
32‐
34]. A novel role for NF-kB has been suggested in several recent studies, specifically, involvement of NF-kB in tumor suppress has been demonstrated in skin and liver [
35‐
37]. It seems NF-kB can either promote or inhibit carcinogenesis depending on the tumor type or cell specialty. Because therapeutics inhibiting NF-kB pathway are being used as a strategy in cancer treatment, it is crucial to explore potential mechanism and altering function of NF-kB that can protect or contribute to apoptosis. In this study, we characterized an ovarian cell line derived from a well-differentiated (low grade) serous carcinoma and defined a tumor suppressor role of NF-kB in tumor development. We demonstrated that introduction of a dominant negative mutant IĸBα (IĸBαM), which can firmly binding with NF-kB and inhibit NF-kB translocation, resulted in cell proliferation and inhibition of apoptosis in low grade ovarian epithelial cancer in vitro and in vivo.
Ras, the important genes in tumorigenesis, were found to contain activating point mutations in human low grade ovarian epithelial carcinoma cell line HOC-7 [
8]. The mutations of KRAS may initiate the development of additional genetic “hit” in tumorigenesis [
38,
39]. Since the mutations of KRAS are early events involved in tumor initiation, HOC-7 provide a good model to explore the connection between ras-raf-MAPKs pathway and NF-kB in tumorgenesis [
6]. HOC-7 cell lines have the KRAS mutation, presumably keeping activated the MAPKs pathway, showed phosphorylation of MEK after infection of IkBαM, while SKOV3 cell line, which sequenced to be the KRAS wild type, showed dephosphorylation of both MEK and ERK following the infection of IkBαM. No matter MAPK pathway activated or not, both transgenic cell line SKOV3- IkBαM and HOC-7- IkBαM showed potential tumorigenesis potent both in vitro and in vivo. All together, the IkBαM construct in cancer cell can induce the tumor growth in a ras independent way. NF-kB can serve as a tumor suppressor through its pro-apoptotic function in ovarian cancer cells in Ras-MAPKs independent pathway.
Accumulating evidence shows that nuclear function of IkBα is its participation with NF-kB in an autoregulatory negative feedback loop culminating in the translocation of NF-kB into the nucleus. The recent identification showed that phosphorylation of CBP by Ikkα can switch the binding reference of CBP from p53 to NF-kB, which provided an important link between p53 and NF-kB [
40‐
42]. Furthermore, Ikkα up-regulates the expression of p53 antagonist MDM2, which can dominantly localized in the nucleus and promotes increased degradation of p53 [
41‐
43]. Since Ikkα was regarded to release upon phosphorylation IkBα, it was therefore postulated that IkBα maybe affect the balance between p53 and NF-kB. In our study, the HOC-7 p53i showed overexpression of Ikkα, implied the increase activity of NF-kB [
44,
45]. In parallel with these results, we also found that HOC-7 IkBα decreased the expression of NF-kB responsive promoter CIAP and increased those with p53-responsive promoter (p21 and mdm2). All of above suggested that Ikkα and downstream IkBα regulated the antagonism crosstalk between NF-kB and p53. To further examine if p53 paly a possible role in the development of transgenic tumors, we set up the xenograft model of HOC-7-53i, HOC-7-IkBαM and HOC-7-IkBαM-p53i. We observed an increased tumor growth in HOC-7 p53i, suggestion an involvement of p53 in the development of these tumors, which consist with previous knowledg.e that the tumor suppressor p53 inhibits cell growth through activation of cell-cycle arrest and apoptosis. Mutation analysis of exons 5–8 of p53 in HOC-7 parental and transfected cells did not reveal any mutation. Kevin M showed that induction of p53 causes an activation of NF-kB which correlates with the function of p53 to induce apoptosis [
46]. Inhibition of NF-kB activity abrogated p53-induced apoptosis, indicating that NF-kB is essential in p53-mediated cell apoptosis. Loss of NF-kB activity specifically abrogated the p53-mediated apoptosis response. Activation of NF-kB by p53 was different from that mediated by tumour-necrosis factor-a and involved MEK1 and the activation of pp90rsk. Inhibition of MEK1 blocked activation of NF-kB by p53 and completely abrogated p53-induced cell death. Our studies showed knocking down p53 augment tumor growth in HOC-7 IkBαM cells, suggesting that NF-kB is crucial but not cover all part in p53-mediated cell apoptosis.
Conclusions
The results indicated a new role of NF-kB in the inhibition of tumor growth. Inhibition of NF-kB signaling in ovarian tissue results in an increased proliferation rate and the development of ovarian tumors. Furthermore, neither mutations in the KRAS nor decreasing expression of p53 gene can affect the tumor development induced by IkBαM [
47]. The drugs used targeted the NF-kB, where p53 is itself an important mediator of chemosensitivity, such therapy seems very dangerous to the tumor treatment due to its repression of p53-mediated tumor cell death function. Liu demenstrated that NF-kB can be reprogrammed to a tumor-promoting oncogene conferring drug resistance following standard chemotherapy with carboplatin and paclitaxel, clinical treatment of ovarian cancer using anti-NF-kB agents should be cautiously considered and guided by specific markers that can distinguish whether NF-kB is functioning as a tumor suppressor or an oncogene. Comparing Bcl-xL expression between primary and recurrent ovarian tumors after chemotherapy might be a useful marker to determine the function of NF-kB and direct clinic individualized drug therapy.
Abbreviations
CMV, cytomegalovirus; EMSA, electrophoretic mobility shift assay; HCC, hepatocellular carcinoma; MAPK, mitogen-activated protein kinase; SCCs, squamous cell carcinoma
Acknowledgments
The authors do not have any acknowledgements.
Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (
http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (
http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.