Background
Because cancer is a complex, multi-factorial disease, treating cancer based on a single-target/single-component strategy may be less effective than using a multi-target/multi-component strategy. In fact, oncology department currently administer various combination of chemical and/or recombinant drugs to cancer patients, and many ongoing clinical studies are investigating the efficacy of cocktail therapies in different types of cancer [
1-
4]. Medicinal herbs or the prescription drugs derived from them, which have been traditionally used for disease management, can be promising source materials in the development of anticancer drugs because they are originally based on multi-target/multi-component strategies. Additionally, medicinal herb extracts can be prescribed as adjuvants to produce synergistic effects with conventional anticancer drugs or to relieve the adverse side effects of the anticancer drugs. The rationale of using a combination of medicinal plants was demonstrated by Cheng’s research group, who showed that the four-herb Chinese medicine PHY906 reduced CPT-11 (irinotecan)-induced intestinal toxicity and increased the anticancer activity of CPT-11 through multiple mechanisms that act simultaneously [
5]. Natural products, particularly botanical drugs, have been shown to be effective in cancer prevention or treatment on their own or in combination with chemotherapeutics [
6-
8].
In traditional Oriental medicine, cancer is referred to as an accumulation of mass in the body. Therefore, natural products that aim to soften and resolve the hard mass or lumps have long been used to treat cancer. Sa-mi-yeon-geon-tang (SMYGT) is a decoction composed of the combination of four natural products with medicinal values, including Sargassum, Laminariae Thallus, Prunellae Spica, and Ostreae Concha (Table
1) in an equal weight ratio. SMYGT and its component drugs have been used to soften and dissipate the abnormal hard mass [
9]. The name of the formula translates as follows: Sa (four)-mi (taste)-yeon (soften)-geon (hardness)-tang (decoction). In 1983, a Chinese research group reported that SMYGT showed anti-tumor effects when administered to 511 cancer patients, including liver, stomach, and colorectal cancer [
10]. Bae et al. demonstrated that modified SMYGT which included three additional herbs, showed anti-cancer or anti-metastatic effects by inhibiting DNA topoisomerase I activity and angiogenic events [
9]. When administered to experimental mice with 1,2-dimethylhydrazine-induced murine colorectal cancer, modified SMYGT that included four additional herbs demonstrated anti-carcinogenic activity. However, the anticancer mechanism of SMYGT itself is unknown. In our preliminary in vitro activity screening, SMYGT was identified as a hit that showed anti-angiogenic potential. In this study, we demonstrate that SMYGT has anti-angiogenic potential in vitro and in ovo, and we suggest a feasible underlying mechanism.
Table 1
Four components of SMYGT
Sargassum |
Sargassum fusiforme
| Sargassaceae | 1 |
Laminariae Thallus |
Laminaria japonica
| Laminariaceae | 1 |
Prunellae Spica |
Prunella vulgaris
| Labiatae | 1 |
Ostreae Concha |
Ostrea gigas
| Ostreidae | 1 |
Methods
The four components of SMYGT were purchased from Kwangmyungdang Medicinal Herbs (Ulsan, Republic of Korea). Their identities were confirmed by Dr. Go Ya Choi, Herbal Medicines Resources Group, Korea Institute of Oriental Medicine (KIOM). The voucher specimens of Sargassum (KIOM010011), Laminariae Thallus (KIOM010019), Prunellae Spica (KIOM010023), and Ostreae Concha (KIOM010022) were deposited at KM-Based Herbal Drug Development Group, KIOM. The crude water extract was prepared by boiling a 300 g of finely pulverized dried materials that consist of equal ratio of each component (75 g of each component) in 8 L of distilled water for 4 h. The extract was filtered through Whatman No.2 filter paper, concentrated in a rotary evaporator (EYELA, Tokyo, Japan), and lyophilized in a freeze dryer (Ilshin Bio Base, Dongducheon, Republic of Korea) The yield of the extraction (78.5 g) was approximately 26.2% (w/w). The extract was dissolved in phosphate-buffered saline (PBS) at a concentration of 80 mg/mL and stored at −70°C until use.
Cell culture
Human umbilical vein endothelial cells (HUVECs) were purchased from Lonza (Walkersville, MD, USA), and cultured with an EGM-2 endothelial cell growth media kit (Lonza) in a humidified atmosphere with 5% CO2 at 37°C. The culture medium was replaced every other day. All in vitro experiments were performed using HUVECs at a passage number less than 10.
Cell proliferation and viability
One day before drug treatment, 50,000 cells per well were inoculated into a 24-well tissue culture plate containing 475
μL of EGM-2. Cells were treated with 25
μL of serially diluted test drugs and were maintained for various periods. Sulforaphane (5
μM) and vehicle (PBS) were administered in parallel as positive and negative control drugs, respectively. To determine cell proliferation and viability, the cultured medium was saved, and the cells were washed with PBS and trypsinized. The cells were resuspended in the saved cultured medium. The numbers of total (viable and dead) and dead cells were determined using an ADAM-MC automatic cell counter (NanoEnTek, Seoul, Republic of Korea) as described by Yi et al. [
11]. In brief, the number of total (viable and dead) cells was determined using the AccuStain T solution, a cell lysis solution supplemented with a cell membrane-impermeable fluorescent dye (propidium iodide, PI). The number of dead cells was determined using the AccuStain N solution, a normal saline solution containing PI. The 1:1 mixtures of cell suspension with AccuStain T or with AccuStain N were loaded into the T and N channels of AccuChip, respectively. The number of total cells and the cell viability were automatically calculated by the following equation: cell viability (%) = [No. of AccuStain T positive total cells – No. of AccuStain N positive dead cells]/[No. of AccuStain T positive total cells] × 100.
The effect of SMYGT on HUVEC tube formation was evaluated using the Cultrex In Vitro Angiogenesis Assay Kit (Trevigen, Gaithersburg, MD, USA), according to the manufacturer’s instructions. Briefly, HUVECs were resuspended in EGM-2 containing SMYGT (100 ~ 400 μg/mL) or vehicle (PBS) and then seeded at 1.5 × 104 cells/well of 96‐well plates pre-coated with basement membrane extracts (BME). Sulforaphane (5 μM) was administered in parallel as a positive control drug. After a 12 h incubation period, images of the capillary-like tube networks were obtained using an inverted microscope. The quantification of tube length and branch points was performed with MetaMorph image analysis software (Molecular Devices, Downingtown, PA, USA).
Chick chorioallantoic membrane (CAM) assay
The anti-angiogenic potential of SMYGT was evaluated with an in ovo CAM assay. Fertilized eggs purchased from CJ (Seoul, Republic of Korea) were incubated at 37°C in an egg incubator (R-COM, Gimhae, Republic of Korea), with 70% relative humidity. This time point was designated as embryonic day (ED) 0. At ED 3, approximately 2 ~ 3 mL of albumin was removed, and an eggshell window was constructed. At ED 4.5, the test drugs dissolved in 80% ethanol were loaded on a one-quarter sized Thermanox coverslip (Nunc, Naperville, IL, USA) and the solvent was completely evaporated in a clean bench. The dried Thermanox coverslip containing drugs were then applied to the CAM. Solvent only and 1 μg/egg of retinoic acid (RA, Sigma-Aldrich, St. Louis, MO, USA) was loaded in parallel as a negative and a positive control, respectively. At ED 6.5, the inhibition zone of angiogenesis was visualized by injecting 10% skimmed milk into the CAM. The drug response was scored as positive when CAM showed an avascular zone that was similar to the RA-treated CAM.
Wound healing assay
HUVECs were cultured in 24-well plates to > 90% confluence. Using a 200 μL pipet tip, a straight scratch was made through the cell sheet. The cells were photographed (t = 0 h), rinsed with fresh growth medium and then further incubated in fresh growth medium containing SMYGT or a vehicle (PBS). Sulforaphane (5 μM) was administered in parallel as a positive control drug. After 12 h of incubation, digital images were recorded using an inverted microscope, and quantification of the healed area (%) was determined using the MetaMorph image analysis software according to the following formula: healed area (%) = [1-wounded area (t = 12 h)/wounded area (t = 0 h)] × 100.
Cell adhesion assay
HUVECs (2 × 104) were inoculated into 24-well plates pre-coated with Matrigel (BD, NJ, USA) in a growth medium containing SMYGT or a vehicle (PBS). Sulforaphane (5 μM) was administered in parallel as a positive control drug. After 2 h, wells were washed with PBS to remove unattached cells. The adherent cells were fixed with 70% ethanol for 10 min and visualized with a commercially available cell staining solution (Trevigen). The cells were washed with water and completely dried by turning the plates upside down. Stained cells in three randomly selected fields per well (× 100 magnification) were digitally captured and counted using an inverted microscope.
Cell invasion assay
The invasion assays were performed in 24-well plates equipped with cell culture inserts with a transparent PET membrane containing 8 μm pores (BD). One day before the assay, HUVECs were serum-starved in EBM basal medium (Lonza) supplemented with 0.5% FBS. The cells were harvested and resuspended at a concentration of 5 × 105/mL in serum-free medium. Two hundred microliters (1×105 cells) of resuspended cell solution with SMYGT or vehicle (PBS) were added to the inserts pre-coated with diluted Matrigel. EGM-2 complete medium was added to the bottom chamber as a chemo-attractant. Sulforaphane (5 μM) was administered in parallel as a positive control drug. After 16 h, the media were carefully aspirated from the inserts and the membrane filters were fixed with 70% ethanol for 10 min. The cells on the upper surface of the filters were completely removed using cotton swabs, and the invading cells on the opposite surface of the filter were stained with methylene blue. The GAPDH-visualized invading cells in three randomly selected fields per well (× 100 magnification) were digitally captured and counted using an inverted microscope.
The activity of MMP2 secreted by HUVECs into the culture media was determined using an MMP activity gel. The culture media containing 40 μg of protein were loaded onto a 7.5% sodium dodecyl sulphate -polyacrylamide gel electrophoresis (SDS-PAGE) gel that had been copolymerized with 1 mg/mL of gelatin (Sigma-Aldrich). After washing the gels 4 times to remove SDS, the enzyme activity was initiated by incubating the gel in a substrate buffer containing 50 mM Tris (pH 7.6), 1 μM ZnCl2, and 5 mM CaCl2 overnight at 37°C. The degradation of the gelatin substrate by MMP2 was visualized by staining the gel with a 0.1% Coomassie blue solution.
Quantitative polymerase-chain-reaction (qPCR)
The total RNA was extracted from HUVECs with an Easy-spin™ Total RNA Extraction Kit (iNtRON Biotechnology, Seoul, Republic of Korea). Complementary DNAs (cDNAs) were synthesized using the iScript™ cDNA Synthesis Kit (Bio-Rad, Hercules, CA, USA), according to the manufacturer’s instructions. qPCR, which was performed with SsoAdvanced™ Universal SYBRR Green Supermix (Bio-Rad) on a CFX™ 96 Real-Time Detection System (Bio-Rad), was initiated by activation at 95°C for 30 s, followed by 40 cycles of amplification (denaturation at 95°C for 5 s, annealing/elongation at 60°C for 30 s). Gene expression was normalized to the housekeeping gene for glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Each sample was measured in triplicates. The sequences of gene specific primers and their amplicons are illustrated in Table
2.
Table 2
Sequences of gene specific primers
MMP2 | ATGCCGCCTTTAACTGGAG | GGGAAGCCAGGATCCATTTT | 103 |
GAPDH | AAGGCTGAGAACGGGAAG | GGACTCCACGACGTACTC | 114 |
Western blot analysis
Western blot analysis was performed as previously described [
11]. The total focal adhesion kinase (FAK) and phospho-FAK (pFAK, Y397) antibodies were obtained from Cell Signaling Technology (Danvers, MA, USA), and the β-actin antibody was obtained from Bio-Rad.
Statistics
Statistical data analysis was performed using one-way analysis of variance and the level of statistical significance was set at p < 0.05.
Discussion
Angiogenesis is a multi-stepped process of de novo vessel formation from the established blood vasculature by endothelial cells. It is essential for continuous tumor growth because it supplies tumors with nutrients and oxygen and removes cellular waste, which may be toxic to cancer cells, from the tumor mass. Since the idea of tumor angiogenesis was suggested in the 1970s by Folkman [
13], the blockade of tumor-induced angiogenesis has been considered to be an attractive anticancer strategy because anti-angiogenic agents can be used irrespective of cancer types because tumor-induced angiogenesis is a general hallmark of cancer, and the agents target vascular endothelial cells with genomic stability, which rarely develop drug resistance [
14,
15]. Angiogenesis is a process that is coordinated by the functional balance between pro-angiogenic and anti-angiogenic factors. Therefore, anti-angiogenesis can be accomplished by blocking the signaling pathway mediated by pro-angiogenic proteins, such as vascular endothelial growth factor (VEGF) and basic fibroblast growth factor, and/or by up-regulating the expression of endogenous anti-angiogenic proteins, such as endostatin and tissue inhibitor of metalloproteinases-1 (TIMP-1).
In this study, we described the novel anti-angiogenic effect of SMYGT, an extract that is a traditional Korean medicinal cocktail. We demonstrated that SMYGT exerts its anti-angiogenic potential in vitro by inhibiting the cell adhesion and invasiveness of endothelial cells. We also demonstrated that SMYGT inhibits intracellular FAK signaling by modulating its phosphorylation status and down-regulates MMP2 activity by reducing intracellular levels of MMP2 mRNA. In general, phosphorylation of FAK is known to be related to the adhesion of cells to the extracellular matrix, as well as the motility and survival of endothelial cells [
16]. We observed that SMYGT down-regulated FAK signaling and inhibited endothelial cell adhesion to the extracellular matrix, but cell proliferation, viability, and mobility were not affected by SMYGT. This differential response of HUVECs to SMYGT may be related to the partial inhibition of FAK by SMYGT, which is adequate to affect cell adhesion but not sufficient to affect cell survival, proliferation, and motility. FAK signaling is considered to be a promising anti-cancer target because phosphorylation of FAK, particularly at Y397, is also critical for angiogenesis, metastasis, and the invasion of tumor cells because of its effects on regulating cell adhesion to the extracellular matrix, cell survival, motility, and proliferation [
17,
18]. MMPs also contribute to endothelial cell-mediated angiogenesis by loosening focal cell-to-cell interaction and by degrading the basement membrane and extracellular matrix surrounding blood vessels [
19,
20]. In this study, we demonstrated that SMYGT could down-regulate MMP2 activity in HUVECs. However, MMP9 was not detected in a gelatinase activity gel assay using HUVEC cultured medium which is consistent with our previous studies of other anti-angiogenic medicinal herb extracts [
11]. MMP2 activity has also been reported to be effectively reduced by anti-cancer agents that target tumor vessel formation [
21,
22]. MMP2 activity can be regulated during the transcriptional, post-transcriptional (e.g., mRNA stability), translational, and post-translation (e.g., extracellular secretion) steps. In this study, we suggest that SMYGT can down-regulate MMP2 activity by decreasing intracellular level of mRNA. However, we did not investigate whether SMYGT-mediated MMP2 regulation is controlled transcriptionally or post-transcriptionally. It is known that when endothelial cells are subjected to hypoxic conditions (low PO
2) such as inside of a tumor mass, MMP2 expression is elevated, and its specific endogenous inhibitor TIMP-2 and the hypoxic conditions enhance MMP2-dependent endothelial cell migration [
19].
SMYGT, a traditional medicinal decoction, has been used to treat cancer patients in Korean Oriental medicine clinics [
9], and it has been revealed that this herbal prescription has an inhibitory effect on inflammation and fecal enzyme activity in an ulcerative colitis animal model [
10]. Modified SMYGT has also demonstrated potentially cytotoxic activity against various cancer cells, such as A549, SK-OV-3, B165-F10, and SK-MEL-2, and it has been shown to suppress lung metastasis and angiogenesis in an animal model [
9]. SMYGT consists of four components in equal weights.
Sargassum fusiforme and
Laminaria japonica are members of the brown algae family, which is widely distributed in Far East Asia, including Korea, China, and japan;
S. fusiforme and
L. japonica have been used as therapeutic agents for thousands of years [
23,
24], and polysaccharides extracted from
S. fusiforme and
L. japonica are known to have various biological activities, such as anti-tumor [
25], anti-oxidant [
24], immunity enhancing [
26], and anti-hyperlipidemia activities [
27]. The shell of
Ostrea gigas has been prescribed with other medicinal herbs to treat various symptoms, such as palpitations, insomnia, dizziness, tinnitus, scrofula, subcutaneous nodules, and abdominal masses [
28]. Recent studies have revealed that Ostreae Concha pharmacologically functions to boost the immune system and relieves gastric ulcers, sedation, viral infections, and tumors [
29].
Prunella vulgaris is widely distributed in the temperate zone, and it has been used to treat inflammation, eye pain, headaches, and dizziness [
30].
P. vulgaris has anti-inflammatory, anti-bacterial, anti-viral, and anti-tumor effects, and these pharmacological functions may be attributed to its immunomodulatory activity [
31]. In the prescription, Sargassum and Laminariae Thallus primarily help to soften and resolve hard masses, Prunellae Spica reduces pathogenic heat, and Ostreae Concha alleviates pains. These ingredients enhance the efficacy of SMYGT, according to traditional oriental medicine theory. We did not determine whether the anti-angiogenic potential of SMYGT is attributed to a single component or a combination of components of SMYGY.
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made.
The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder.
Competing interests
The authors have declared that there is no competing interest.
Authors’ contributions
JMY, and NSK developed the study concept and experimental design, performed data acquisition and analysis, and drafted the manuscript. OSB supervised the entire study and assisted with the study concept and with the revision of the manuscript. All authors read and approved the final manuscript for submission.