Introduction
Lung cancer is the most prevalent diagnosed cancer worldwide and a major contributor of cancer mortality. And non-small cell lung cancer (NSCLC) accounts for approximately 85% of the diagnosed lung cancers [
1‐
3]. In recent years, immunotherapy targeting T cells has increasingly shown its potentiality in the treatment of a wide variety of solid tumors, such as NSCLC [
4‐
6]. Although encouraging, it is the fact that still only a small fraction of patients obtain long-term benefit, which is likely correlated with the complex network of the tumor microenvironment (TME) [
7]. TME, a complex physical and biochemical system, plays a pivotal role in tumor initiation, progression, metastasis, and drug resistance [
8]. It contains cells of the immune system, tumor cells, tumor vasculature and extracellular matrices (ECM) [
9]. Among them, tumor cells could express inhibitory ligands that suppress the T-cell activity to evade immune destruction. Immune cells could produce some cytokines, growth factors, enzymes, and angiogenic mediators to promote the growth of tumor [
10]. And ECM consists of biological barriers around the tumor tissue to hamper lymphocyte penetration. Therefore, better understanding of the interactions in the TME would increase the ratio of patients benefiting from cancer therapies.
Traditional herb medicines and herbal derived components are playing increasingly critical roles in prevention and treatment of cancers [
11,
12]. Compared with conventional chemotherapy, they are low toxicity and pleiotropic actions, targeting the complex network of TME by modulating multiple cell-signaling pathways involved in immune. Thereby, natural products could be a great repository for the development of novel therapeutic approaches in cancer treatment. As a well-known herbal medicine used worldwide for centuries, to date, several reports have published the immunomodulatory activity of licorice on multiple cancers, including colon cancer, breast cancer, acute myeloid leukemia, gastric cancer, melanoma, and prostate cancer [
13‐
16]. However, the molecular underpinnings of licorice exert its immunomodulatory potential have not been fully elaborated.
To address this question, we used a systems pharmacology strategy [
17] to elaborate that how licorice exerts anti-tumor effects by regulating multiple immune-related signaling pathways and targets, influencing cell cycle progression, and mitigates the growth of NSCLC cancer. First, by screening the poly-pharmacology molecules of licorice, predicting the targets of active compounds, constructing the networks, and linking the targets to the immune phenotype in lung cancer patients, we observed that the active ingredients of licorice targeted a great variety of tumor-related signaling pathways, including cell cycle, inflammation, and migration. Then, we used in vitro and in vivo experiments to reveal the anti-tumor effects of licorice. On the one hand, we found that licorice down-regulates CDK4-Cyclin D1 complex, resulting in G0/G1 phase arrest and increased PD-L1 levels in lung cancer cells. On the other hand, we also found that licorice increased antigen presentation and infiltration of CD8
+ T cell, significantly decreased tumor volume of mouse models of NSCLC in vivo. Taken together, our studies indicate that the systems pharmacology strategy greatly uncovered the action mechanism of poly-pharmacology molecules of licorice, contributing the use of natural products for further anti-cancer drug development.
Discussion
Natural products were shown broadly to interfere growth signals by multi-specific actions [
42], which may open an opportunity to treat NSCLC effectively. In a panel of human cancers, licorice has been uncovered to provide growth-limiting activities [
16,
38,
43]. Although changes in the cell-cycle have been noted under licorice treatment settings [
29,
30], dissecting mechanism of the biological activity of licorice remains a challenge. Here, the critical findings of our study, summarized in Figs.
5c and
2d, include the discovery that licorice limits lung cancer growth mainly related with down-regulating CDK4-Cyclin D1 complex and enhancing intra-tumoral CD8
+ T cell infiltration. Our detailed investigation shows that licorice induces G1 cell-cycle arrest in lung cancer cells by inhibiting CDK4-Cyclin D1 complex, which in turn increases antigen presentation and results in intra-tumoral CD8
+ T cell infiltration but increase PD-L1 levels. These findings convincingly argue for a potential treatment option of licorice in the prevention and treatment of NSCLC.
Beginning with systems pharmacology analysis, flow cytometry analysis of cell cycle profile and western blot, we observed that licorice treatment led to G1 cell-cycle arrest and inhibit the expression of CDK4-Cyclin D1 complex in H1975 cells. This biological activity was further validated in licorice-treated tumor. It is well known that CDK4-Cyclin D1 complex were required for progression of cells cycle through the G0/G1 phase [
44‐
46], which would suggest that G1 cell-cycle arrest is largely associated with decreased levels of CDK4-Cyclin D1 after licorice treatment. The tumor regression caused by down-regulation of CDK4-Cyclin D1 complex has been demonstrated in CDK4/CDK6 inhibitor studies. As a kind of CDK4/6 inhibitors, abemaciclib caused regression of bulky tumors in mouse models of mammary carcinoma [
41]. Furthermore, many human cancers harbor genomic or transcriptional aberrations that could activate CDK4/6 [
47‐
49]. Therefore, our findings revealed that licorice inhibit the expression of CDK4-Cyclin D1 complex would be critically important for prevention and treatment of lung cancers.
Moreover, CDK4-Cyclin D was found negatively regulates PD-L1 protein stability in several tumor cell lines [
37,
50]. And previous studies revealed that response to PD-1/PD-L1 blockade might correlate with PD-L1 expression levels in tumor cells [
51‐
53]. Notably, we discovered that licorice treatment induced increased expression of PD-L1 levels both in vitro and in vivo. These studies, together with our findings, shed light on a viable option for the management of NSCLC, with or without other treatments in conjunction, to enhance the efficiency of cancer immunotherapies.
The functional impairment of T cell-mediated immunity in the TME is a defining feature sharing by many cancers, and CD8
+ T cells became the central focus of new cancer therapeutics [
54,
55]. Data showed that licorice could increase the expression of antigen presentation genes and promote CD8
+ T cell infiltration within the circumstance of cell cycle arrest. So, we concluded that licorice induces G1 cell-cycle block in lung cancer cells by inhibiting CDK4-Cyclin D1 complex, which in turn increase antigen presentation and results in intra-tumoral CD8
+ T cell infiltration. Consistent with the results of multiple studies, cell cycle blockade can activate anti-tumor immunity by increasing the immunogenicity of tumor cells [
56] and can also increase the expression of PD-L1 to inhibit anti-tumor immunity [
57]. Theoretically, licorice increases the infiltration of CD8
+ T cells into the TME, which may enhance the anti-tumor effect of anti-PD-L1. However, the expected enhancement effect was not observed in the combination of licorice and anti-PD-L1. We speculate that licorice may affect the activation of CD8
+ T cells through the direct PD-1/PD-L1 signaling pathway of T cells, which is consistent with the function of anti-PD-L1. Therefore, the combination of licorice and anti-PD-L1 did not show a synergistic anti-cancer effect. In fact, licorice has been known to promote maturation and differentiation of lymphocyte in order to activate the immune system [
58,
59]. In the subsequent research, we will focus in-depth research and verification on this problem.
In summary, this study evidenced that licorice induced G0/G1 phase cell cycle arrest by down-regulating CDK4-Cyclin D1 complex on tumor cells. In addition, licorice increased the expression of antigen presentation genes and infiltration of CD8+ T cells in TME . Therefore, this study illuminated a novel mechanism of anti-tumor effect of licorice in NSCLC treatment, and provide functional evidence for the development of natural products in anti-tumor immunity.
Methods
Pharmacokinetic evaluation
The ingredients of licorice were identified based on Traditional Chinese Medicine Systems Pharmacology Database (TCMSP,
http://tcmspw.com/) [
60] and Bioinformatics Analysis Tool for Molecular mechANism of Traditional Chinese Medicine (
http://bionet.ncpsb.org.cn/batman-tcm/), [
61], and active ingredients (shown in Table
1) were further screened out by the in silico ADME system, with the criteria of oral bioavailability (OB) ≥ 50%, drug-likeness (DL) ≥ 0.40.
Target fishing and validation
We identified direct and indirect targets of licorice on the basis of two
in-house computational methods: WES and SysDT. The WES model was introduced to detect drug direct targets of the active ingredients based on a large-scale of 98,327 drug-target relationships. As a novel tool, the obtained model performs well in predicting the binding with average sensitivity of 85% (SEN) and the non-binding patterns with 71% (SPE) with the average areas under the receiver operating curves (ROC, AUC) of 85.2% and an average concordance of 77.5% [
62]. SysDT is performed with the combination of the chemical, genomic and pharmacological information based on Random Forest (RF) and Support Vector Machine (SVM) for target identification effectively. The obtained model is served as a valuable platform for prediction of drug-target interactions with an overall accuracy of 97.3%, an activated prediction accuracy of 87.7% and an inhibited prediction accuracy of 99.8% [
63].
Then obtained targets were uploaded to Uniprot (
http://www.uniprot.org) [
64] to normalize their name and organisms. And the targets of Homo sapiens were chosen for further investigation. We used Cytoscape 3.7.0 software to construct and analyze compound-target network.
GO enrichment analysis and KEGG analysis for targets
GOenrichment analysis and KEGG analysis were performed through mapping targets to DAVID (
http://david.abcc.ncifcrf.gov) for classification. We chose the terms with
P value less than 0.05.
Cell proliferation assay
Cellular proliferation was assayed using a Cell Counting Kit‐8 (CCK‐8, Beyotime, China). In brief, 1 × 104 cells were seeded in 96‐well microplates. After 24 h, cells were treated with different concentrations of licorice or vehicle for 48 h. Then, 10μL CCK‐8 solution was added to each well and incubated at 37 °C for 4 h. Absorbance at 450 nm was measured using a microplate reader (Molecular Devices, California, USA).
Cell lines, compounds, and reagents
H1975 A549 cells (National Collection of Authenticated Cell Cultures, Shanghai, China) were maintained in RPMI 1640 medium (C11875500BT, Gibco, Thermo Fisher Scientific) supplemented with 10% fetal bovine serum (10099141, Gibco, Thermo Fisher Scientific).
Licorice powder was purchased from LEMETIAN MEDICINE. And Typical HPLC chromatogram of licorice extract performed by LEMETIAN MEDICINE (Additional file
1: Figure S1).
FACS analysis of cell cycle
Once H1975 cells achieved a 70% to 80% confluency, they were treated with 0.1% DMSO or different concentration of licorice for 48 h. Then, cells were fixed with ice-cold 70% ethanol at − 20 °C overnight. After fixation, cells were washed thrice with cold PBS and then stained with Cell Cycle and Apoptosis Analysis Kit (C1052, Beyotime Biotechnology) according to the manufacturer’s instructions. Samples were then analyzed using a NovoCyte Flow Cytometer (ACEA Biosciences). The results were analyzed by Flow Jo software (BD bioscience).
Western blotting
For western blot analysis, cells or tumor tissue were lysed in lysis buffer from the Qproteome Mammalian Protein Prep Kit (37901, QIAGEN) with the addition of protease inhibitors after PBS washing. Protein concentrations were measured by a microplate reader (Molecular Devices, California, USA) using the BCA Protein Assay Kit (P0010S, Beyotime, China). Then equal amounts of protein were resolved on SDS-PAGE and transferred to nitrocellulose membranes (Millipore, Bedford, MA, USA) and incubated with primary antibodies against: CDK4 (1:5000, ab108357, Abcam), cyclin D1 (1:1000, 554180, BD Bioscience, USA), cyclin A2 (1:2000, ab181591, Abcam), cyclin B1 (1:50000, ab32053, Abcam), P21 (1:5000, ab109520, Abcam), PD-L1 (1:500, ab205921, Abcam or 1:2000, PA5-28115, Thermo Fisher scientific) and β-actin (1:2000, ab8227, Abcam); Secondary antibodies were goat anti-rabbit HRP (1:10000, ab6721, Abcam) and goat anti-mouse HRP (1:5000, ab97023, Abcam). Immunoreactive polypeptides were detected by electrochemiluminescence (ECL) reagents (Cat#170-5061, Bio Rad) using ChemiDoc™ XRS + Imaging System (Bio-Rad). Western blot band intensity quantification was calculated using ImageJ.
Cell synchronization and FACS analyses
For synchronization into the G2/M phase of the cell cycle progression, H1975 cells were treated with 100 ng/mL of nocodazole (M1404, Sigma-Aldrich) for 16 h. Then cells release was collected at the indicated time points and fixed by 70% ethanol at − 20 °C overnight. After fixation, cells were washed 3 times with cold PBS and stained with Cell Cycle and Apoptosis Analysis Kit (C1052, Beyotime Biotechnology) according to the manufacturer’s instructions. Stained cells were sorted with NovoCyte Flow Cytometer (ACEA Biosciences). The results were analyzed by Flow Jo software (BD bioscience).
Experimental model in vivo and subject details
All animal protocols described in this study were approved by the Institutional Animal Care and Use Committee (IACUC: 2018120202) at The Kanion Parmaceutical. C57BL/6 female mice (purchased from The Comparative medicine center of Yangzhou University) with 6–8 weeks of age were used. To generate tumor model, 5 × 105 LLC cells/mouse were injected into the flanks of mice. Licorice (200 mg/kg of body weight) was administered daily by gastric gavage from day 2 after inoculation; Anti-PD-L1 (B7-H1) (10F.9G2) (BE0101, BioXCell) was administered by intraperitoneal (i.p.) injection on day 4, 7, and 10 after inoculation (200 ug of each mouse); control mice were treated with vehicle (0.9% NaCL) 5 ml/kg by i.p. injection. Tumor volume was measured once every two days when diameter of tumor reached 5 × 5 mm, and tumor volume was calculated by using the formula: 1/2 × length × width2. Mice with tumors greater than 2000 mm3 were sacrificed and tumors were collected and snap-frozen. And mice body weight of all the groups was also recorded every three days during the experiment.
Real-time RT-PCR analyses
Total RNAs were extracted using the RNeasy mini kit (74106, QIAGEN), and reverse transcription reactions were performed using the Prime Script RT reagent Kit with gDNA Eraser (Perfect Real Time) (RR047A, Takara). After mixing the generated cDNA templates with primers/probes and Green® Premix Ex Taq™ II (Tli RNaseH Plus) (RR820B (A × 2), Takara), reactions were performed with the Step One Plus TM Real-Time PCR System (Applied Biosystems).
Mouse GAPDH: Forward, 5′-AGGTCGGTGTGAACGGATTTG-3′,
Reverse, 5′-GGGGTCGTTGATGGCAACA-3′;
Mouse Tap1: Forward, GGACTTGCCTTGTTCCGAGAG,
Reverse, GCTGCCACATAACTGATAGCGA;
Mouse Tap-2: Forward, CTGGCGGACATGGCTTTACTT,
Reverse, CTCCCACTTTTAGCAGTCCCC;
Mouse Tap-bp: Forward, GGCCTGTCTAAGAAACCTGCC.
Reverse, CCACCTTGAAGTATAGCTTTGGG.
Mouse Erap1: Forward, TAATGGAGACTCATTCCCTTGGA.
Reverse, AAAGTCAGAGTGCTGAGGTTTG.
Single cell generation from tumor tissue and flow cytometry analysis
Tumor tissues were minced and digested with Collagenase IV (2 mg/ml, 17104-019, Gibco) and DNase I (2000U/ml, D7073, Beyotime) and Hyaluronidase (0.5 mg/ml, S10060, YuanYe Biotechnology) and Dispase II (0.5 mg/ml, S25046, YuanYe Biotechnology) in DMEM for 30 min at 37 °C. Cells were then collected by centrifuge and filtered through a 70 μm strainer (15–1070 BIOLOGIX) in DMEM. Cell pellets were suspended and lysed in red blood cell lysis buffer (Beyotime Biotechnology) for 5 min. The cells were then filtered through a 40 μm strainer (15-1040, BIOLOGIX) in 1 × PBS with 2% BSA. 1×106 cells were incubated with antibodies against Anti-mouse CD3e APC (145-2C11) (05122-80-25, Biogems), Anti-mouse CD8a PE (53-6.7) (100707, BioLegend), Anti-mouse CD45 PE/Cy7 (30-F11) (103114, BioLegend) at room temperature for 30 min. Cells were washed by 1 × PBS with 2% BSA 3 times and detected by NovoCyte Flow Cytometer (ACEA Biosciences).
Elisa analysis
Cytokines of mouse serum in licorice-treated group and control group were analyzed according to the manufacturer’s recommendations: Mouse IFN-γ Immunoassay (Cat#MIF00, R&D, USA.). Absorbance was measured on a microplate reader (Molecular Devices, California, USA) using Prism 8.0.2 (GraphPad Software, Inc.).
Quantification and statistical analysis
Statistical analyses were performed with Prism 8.0.2 (GraphPad Software, Inc.). Two groups comparison using student’s t test. Multiple comparisons using one-way analysis of variance (ANOVA) followed by Tukey test. Tumor volume were analyzed using two-way ANOVA followed by Tukey test. Differences were considered statistically significant at a p value ≤ 0.05. Data are presented as the mean ± SD. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. All data shown is representative two or more independent experiments, unless indicated otherwise.
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.