Study design and participants
This cross-sectional survey utilized specimens collected from women enrolled in a randomized clinical trial from 2010 to 2013, evaluating the efficacy of different artemisinin-based combination therapy to treat malaria in women in their second and third trimester of pregnancy. The study design and results have previously been reported [
21]. The criteria for enrolment in the study were: age ≥15 years old; gestation ≥16 weeks;
P. falciparum mono-infection of any density, with or without symptoms; haemoglobin concentration ≥7 g/dL; residence within the health facility catchment area; willing to deliver at the health facility; and, ability to give informed consent. The study was carried out in Nchelenge district, Luapula province in the northern part of the country. This is an area of stable transmission with the entomological inoculation rate estimated at 4–48 infectious bites per 6 months in 2013 [
22]. We collected and analysed specimens from pregnant women with a positive malaria smear who were enrolling the trial and before they received any antimalarial treatment. Comparisons were made to historical studies conducted in the Copperbelt and Central Province of Zambia. Although these areas are not geographically close to the study site, they are rural areas of Zambia and the results were expected to be similar to Nchelenge.
The participants were diagnosed with malaria by a rapid diagnostic test [(RDT) SD Bioline, Standard Diagnostics] that detects histidine-rich protein-II antigen. Drops of blood were collected and dried on 3 M Whatman filter paper. The specimens were collected from enrolled participants prior to any study treatment. Specimens with adequate quantities of blood were selected for molecular analysis.
Molecular analysis
Parasite DNA was extracted from the dried blood spots. The specimens underwent nested PCR followed by pyrosequencing to genotype of position 76 in
Pfcrt. Details of the protocol used for molecular analysis of the samples can be found on the website [
23]. A summary of DNA extraction, amplification and sequencing is described here.
The DNA was extracted from each dried blood spot sample using a commercially procured kit (QIAamp
® DNA 96 Blood Kit, Qiagen), following a modified procedure for DNA extraction. The DNA was eluted in 150 μl of AE Buffer (Qiagen) and stored at −80 °C until time of use. Amplification of
Pfcrt 76 was carried out using nested PCR. The primers are listed in Table
1. The PCR and pyrosequencing primers for the
Pfcrt 76 gene were synthesized by IDT (Coralville, IA, USA). Primer sequences were designed using the Pyrosequencing™ Assay Design Software (Qiagen). PCR was performed using the Biorad T100™ and C1000 Touch™ thermocyclers (Bio-Rad, Hercules, CA, USA). The reaction volume for both the primary and nested PCR was 25 μL, and contained 1X PCR buffer (diluted from 10X Buffer, Qiagen), 200 μM mixture of dNTPs (Invitrogen), 2 mM MgCl2, (Qiagen), 1.5 units of HotStarTaq
® DNA Polymerase (Qiagen), 0.2 μM (0.8 μM for nested reactions) external forward and reverse primers and 1 μL of DNA. Thermal cycling conditions for the primary and nested PCR reactions were 95 °C for 15 min (HotStarTaq DNA Polymerase activation), followed by 40 cycles (25 cycles for nested reaction) with denaturation at 95 °C for 30 s, annealing at 45 °C for 45 s, and extension at 72 °C for 1 min; one cycle at 72 °C for 10 min and a final hold at 4 °C. Successful amplification was confirmed by running the nested PCR product and visualized on commercially procured E-gels (Invitrogen).
Table 1
Primers for amplification of the region of PfCRT 76
72–97 | External forward | GACCTTAACAGATGGCTCAC | 20 | 347 bp |
| External reverse | TTTTATATTGGTAGGTGGAATAG | 23 | |
| Internal forward | Biotin-GGTAAATGTGCTCATGTGTTTAAACTTATT | 30 | 241 bp |
| Internal reverse | TTACTTTTGAATTTCCCTTTTTATTTCCA | 29 | |
72–76 | Pyrosequencing primer | AGTTCTTTTAGCAAAAATT | 19 | |
For pyrosequencing, single-stranded biotinylated PCR products were prepared using the PyroMarkTM Vacuum Prep Tool and Workstation (Qiagen). 3 μL of Streptavidin Sepharose HP beads (Amersham Biosciences, Uppsala, Sweden) was added to 40 μL binding buffer (10 mM Tris–HCl, pH 7.6, 2 M NaCl, 1 mM EDTA, 0.1% Tween 20) and mixed with 2–5 μL PCR product (depending on the band intensity seen for the nested PCR product on the Qiaxcel) and 28 μL water for 5 min at room temperature using a thermomixer (Eppendorf) at a speed of 1400 rpm. The beads containing the immobilized template were captured on the filter probes of the Vacuum Prep Tool after the vacuum was applied and then washed with 70% ethanol for 15 s, denaturation solution (0.2 M NaOH) for 15 s, and washing buffer (10 mM Tris–acetate, pH 7.6) for 15 s. The vacuum was then released, and the beads were released into a PyroMarkTM Q96 HS Plate (Qiagen) containing 12 μL annealing buffer (20 mM Tris–acetate, 2 mM MgAc2, pH 7.6) and 0.4 μM sequencing primer. The plate was incubated at 80 °C for 2 min on a digital heat block, and allowed to cool at room temperature for 5 min. Pyrosequencing reactions were performed according to the manufacturer’s instructions using the PyroMark® Gold Q96 Reagent Kit (Qiagen), which contained the enzyme, substrate and nucleotides. The assays were performed on the PyroMarkTM Q 96MD instrument (Qiagen). The sequence to analyse (STA) entered into the instrument was: G/TTA/TTT/CA/CATTACACA/TTACACTTAAATA. The nucleotide dispensation order used was: CGTATCATAGCACATGAC. The sample genotype was determined using the SNP mode of the PyroMarkTM Q 96MD software.
Ethics, consent and permission
The study protocol was reviewed and approved by the Tropical Diseases Research Centre Institutional Review Board in Ndola, Zambia, and authority to conduct the research was sought in line with the existing Zambian national guidelines. Written informed consent was obtained from all individuals who agreed to participate in the study. A Material Transfer Agreement was signed prior to transferring anonymized specimens to the University of Maryland School of Medicine, Institute for Global Health, Division of Malaria Research laboratory.