Background
Deep vein thrombosis (DVT) occurs when a blood clot forms in the deep vein of human body, and is a common peripheral vascular disease that causes major morbidity and mortality in various medical conditions [
1]. Moreover, lower and upper extremities DVT cause post-thrombotic syndrome (PTS) and pulmonary embolism (PE), which could result in over 15 % death rate in the first 3 month after diagnosis [
2]. Currently, anticoagulation therapy is the standard method for DVT, but the failure to the removal of existing thrombus and the risk of PE hinder the use of the therapy [
3]. Therefore, it is urgent to develop a safe and efficient therapy for DVT treatment.
Endothelial progenitor cells (EPCs), a bone marrow-derived circulating progenitor for the endothelial lineage, play an important role in pathological and physiological neovascularization in the adult [
4,
5]. EPCs were recruited into the thrombus during a resolution and involved in thrombus recanalization [
6‐
8]. Lower numbers of EPCs in the thrombus may result in diminished thrombus recanalization and resolution. Therefore, effective recruitment of EPCs into the thrombus may be a problem of clinical significance.
MiRNAs participate in various biological events [
9,
10], and recent studies suggested that miRNAs are involved in EPCs function [
11]. The upregulation of miR-107 in hypoxia condition led to EPCs differentiation inhibition by targeting HIF-1β [
12]. miR-130a was involved in the regulation of autophagy function in EPCs via targeting Runx3 [
13]. In addition, our previous studies showed that miR-150 and miR-126 contributed to EPCs function in vitro and improved thrombus recanalization and resolution in vivo [
14,
15].
Here we reported the upregulation of miR-483-3p in DVT patients and demonstrated that ectopic expression of miR-483-3p attenuated the migration, tube formation and increased the apoptosis of EPCs via SRF in vitro. Moreover, we tested the efficacy of miR-483-3p modified EPCs in the treatment of vein thrombosis using a rat model.
Methods
Subjects
Eighty milliliter of peripheral blood were collected from DVT patients (n = 3) and control subjects (n = 3) at the Second Affiliated Hospital of Soochow University, Suzhou, China. The included DVT patients were confirmed by Color doppler ultrasound and lower extremity angiography without a history of hypertension, diabetes mellitus and other chronic diseases. Patients and healthy controls were matched by the age, gender and other risk factors (Table
1). The protocols were approved by the Institutional Review Board of the Second Affiliated Hospital of Soochow University and written informed consent was obtained from each participant.
Table 1
Baseline characteristics of DVT patients and healthy controls
Age, years (mean, SD) | 55.4 ± 11.6 | 57.1 ± 13.2 |
Gender, females/males | 7/6 | 7/6 |
Hypertension | 0 | 0 |
Diabetes mellitus | 0 | 0 |
Other chronic diseases | 0 | 0 |
Isolation of EPCs
EPCs were isolated and characterized according to previous methods [
16,
17]. Peripheral blood mononuclear cells (PBMCs) were isolated using Ficoll-Isopaque Plus (Histopaque-1077; Sigma, MO, USA) gradient centrifugation method. The PBMCs were seeded onto fibronectin-coated cell culture flask, cultured in endothelial basal medium-2 (EBM-2; Lonza, MD, USA) supplemented with 20 % fetal bovine serum (FBS), vascular endothelial growth factor (VEGF; R&D Systems, MN, USA), human recombinant long insulin-like growth factor-1 (R3-IGF), ascorbic acid, and hydrocortisone and maintained at 37 °C, 5 % CO
2 incubator. Medium change was performed after 4 days culture and early EPCs developed an elongated spindle-shaped morphology after 7 days culture. EPCs were characterized by confocal microscopy and flow cytometry. The cells were incubated with agglutinin 1 (FITC-UEA-1; Sigma Deisenhofen, Germany) and 1, 19-dioctadecyl-3, 3,3939-tetramethylindocar-bocyanine perchlorate (DiI)-labeled acetylated low density lipoprotein (Dil-Ac-LDL) as described previously [
18]. Incorporation of DiI-Ac-LDL and binding of FITC-UEA-1 were detected under confocal microscope (Leica Microsystems GmbH, Germany). Cells with double positive staining of DiI-Ac-LDL and UEA-1 were identified as EPCs. The phenotypes of EPCs were analyzed for surface expression of CD34, CD133 and VEGFR-2 (all antibodies were purchased from MiltenyiBiotec, Bergisch, Germany). The third or fourth passages of EPCs were used.
MiRNA expression profiles
Total RNA was extracted from EPCs using Trizol reagent (Invitrogen, CA, USA) according to the manufacturer’s instructions. MiRNA expression profiling was performed using a miRNA microarray analysis and miRNA array probes (LC Sciences) according to previous methods [
19,
20]. For each sample, triplicates were analyzed and significant differences between DVT and healthy controls for a given detectable miRNA signal were calculated. The ratio of the two sets of detected signals (log2 transformed, balanced) and the P values for the t-test were calculated. The differentially detected signals with P < 0.01 were analyzed (Table
2).
Table 2
The primers of target sequences
hsa-miR-199a-3p | RT primer | GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACCTGCCC |
Forward primer | GGTGTCACTCCTCTCCTCC |
Reverse primer | CAGTGCGTGTCGTGGA |
hsa-let-7e-5p | RT primer | GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACAACTAT |
Forward primer | GGGGTGAGGTAGGAGGTTGT |
Reverse primer | GTGCGTGTCGTGGAGTCG |
hsa-miR-483-3p | RT primer | GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACAAGACG |
Forward primer | GGTGTCACTCCTCTCCTCC |
Reverse primer | CAGTGCGTGTCGTGGA |
U6 (human) | RT primer | CGCTTCACGAATTTGCGTGTCAT |
Forward primer | GCTTCGGCAGCACATATACTAAAAT |
Reverse primer | CGCTTCACGAATTTGCGTGTCAT |
hsa-miR-199a-3p | Agomir: sense | ACAGUAGUCUGCACAUUGGUUA |
Agomir: antisense | ACCAAUGUGCAGACUACUGUUU |
Antagomir: sense | UAACCAAUGUGCAGACUACUGU |
hsa-let-7e-5p | Agomir: sense | UGAGGUAGGAGGUUGUAUAGUU |
Agomir: antisense | CUAUACAACCUCCUACCUCAUU |
Antagomir: sense | AACUAUACAACCUCCUACCUCA |
hsa-miR-483-3p | Agomir: sense | UCACUCCUCUCCUCCCGUCUU |
Agomir: antisense | GACGGGAGGAGAGGAGUGAUU |
Antagomir: sense | AAGACGGGAGGAGAGGAGUGA |
rno-miR-483-3p | Overexpression | GGAUCCGCACUCCUCCCCUCCCGUCUUGUCUGAGAAACAAGACGGAAGGAAACGUCACUUUUUUGAAUUC |
rno-miR-483-3p sponge | Sponge | GGAUCCACAAGACGGGCCCGAGGAGUGCGAUACAAGACGGGCCCGAGGAGUGACCGGUACAAGACGGGCCCGAGGAGUGUCACACAAGACGGGCCCGAGGAGUGUUUUUUGAAUUC |
rno-miR-483-3p | Forward primer | GCTGACTCACTCCTCCCCTC |
Reverse primer | TATGGTTGTTCACGACTCCTTCAC |
U6 (rat) | Forward primer | ATTGGAACGATACAGAGAAGATT |
Reverse primer | GGAACGCTTCACGAATTTG |
SRF (human) | Forward primer | GAGATCGGTATGGTGGTCGG |
| Reverse primer | GTCAGCGTGGACAGCTCATA |
SRF siRNA (human) | Sense | GCAUCAUGAAGAAGGCCUAUU |
Anti-sense | UAGGCCUUCUUCAUGAUGCUU |
β-actin (human) | Forward primer | ACATCCGCAAAGACCTGTAC |
Reverse primer | GCCATGCCAATCTCATCTTG |
SRF (rat) | Forward primer | ACCAGCTTCACTCTCATGCC |
Reverse primer | TGCATGGGGACTAGGGTACA |
β-actin (rat) | Forward primer | ACCCGCGAGTACAACCTTC |
Reverse primer | ATGCCGTGTTCAATGGGGTA |
MiRNA quantitative real time RT-PCR analysis
Quantitative real time PCR was carried out using a Roche Light Cycler 480 (Roche, Switzerland), miRNA Qqcr Quantitation Kit (GenePharma, Shanghai, China), and 200 ng total RNA. RNA was transcribed into cDNA Synthesis Kit (Thermo Scientific, MA, USA). Expression of the U6 RNA was assessed as an internal control.
Agomir and antagomir transfection
To overexpress and knockdown miR-483-3p, agomir and antagomir of miR-483-3p were transfected into EPCs using Lipofectamine 3000 (Invitrogen, CA, USA) according to the manufacturer’s instructions. Cells were collected at 48 h after transfection, and the expression of miRNA was confirmed by real time RT-PCR.
Migration assay
Migration assay was performed in a transwell system as described previously. EPCs (2 × 105 cells) were resuspended in serum-free EBM-2 medium and seeded on the upper chamber. The lower chamber was filled with EBM-2 medium supplemented with 20 % FBS. After incubation at 37 °C, 5 % CO2 for 24 h, the cells were stained with hematoxylin and the cell number in each well was counted in three randomly picked fields (200× magnification) under a light microscope. All the experiments were performed in triplicate.
In vitro matrigel tube formation assay was performed to determine the angiogenic activity of EPCs as previously described [
18]. Briefly, EPCs (5 × 10
4 cells) were transfected with miR-483-3p agomir or antagomir and then seeded onto matrigel coated 48-well plate, and tubular structures of EPCs in the matrigel were evaluated under microscope after 24 h incubation. To quantify the length of newly formed tubes, six random phase contrast photos per well were taken, and the length of each tube was measured using Image J software. Tube length obtained from miR-483-3p antagomir transfected cells was set to 100.
Apoptosis analysis by flow cytometry
EPCs were stained with annexin V and propidium iodide (PI) (eBioscience, CA, USA), and analyzed by flow cytometry as previously described [
18].
Luciferase assays
The pMIR-SRF-3′ UTR plasmid containing the putative binding site of the SRF 3′UTR downstream of the firefly luciferase gene was generated by cloning and inserting of a 395 bp sequence located at 3′UTR downstream into the SpeI and HindIII sites of the pMIR-REPORT Luciferase vector (Ambion, TX, USA). For luciferase activity measurement, HEK293 T cells were grown in 24-well plates until 60–70 % confluence and co-transfected with 100 ng Luciferase plasmid and 50 ng Renilla plasmid (Ambion) as a control for transfection efficiency, along with 650 ng miR-483-3p agomir or antagomir or negative control. The activity of Luciferase and Renilla was assessed after 48 h with the Dual Luciferase Reporter 1000 Assay System (Promega, WI, USA).
Western blot analysis
EPCs were lysed in RIPA buffer followed by high-speed centrifugation. Cellular proteins were quantified using bicinchoninic acid, separated by sodium dodecyl sulfate–polyacrylamide gel electrophoresis and transferred onto polyvinylidenedifluoride membranes. After blocking, the membranes were incubated with the antibody for serum response factor (SRF) monoclonal (Cell Signaling Technology, MA, USA) or Actin (Sigma, MO, USA). Next the membranes were incubated with horseradish peroxidase-conjugated secondary antibodies and protein bands were detected with SuperSignal West Pico Chemiluminescent Substrate (Pierce, Rockford, IL) on x-ray films (Kodak, Tokyo, Japan).
Lentivirus, vector production and cells transduction
The lentivirus, vector production and cell transduction were performed as previously described [
21‐
23]. Partial pre-miR-483 sequences flanked by EcoRI and AgeI restriction site were constructed into the H1 promoter of lentivirus infectious virions pGLV3-H1-GFP-Puro (GenePharma, Shanghai, China). EPCs were infected with the viruses and selected in the presence of 5 μg/ml puromycin (Sigma), and the green fluorescent protein (GFP) signal of the infected cells was detected under microscope, and the expression of the miR-483 cluster in EPCs was measured by quantitative real-time PCR. To generate miR-483-3p sponge lentivirus virion, the sequences to miR-483-3p with mismatches at position 9–12 were constructed into the pGLV3-H1-GFP-Puro lentivirus infectious virions and used to infect EPCs.
Rat EPCs isolation
Male Sprague–Dawley (SD) rats weighted 300 g were purchased from SLAC Experimental Animal Company (Shanghai, China). Isolation of rat EPCs was performed as previously described [
7,
15,
24]. Bone marrow was harvested from both femurs and tibias of SD rats. Density gradient centrifugation with Ficoll-paque (GE Healthcare, Piscataway, NJ, USA) was used to isolate mononuclear cells. The cells were seeded into flask pre-coated with human fibronectin (Sigma) and cultured in EGM-2-MV (Lonza, MD, USA) medium at 37 °C in a 5 % CO
2 incubator. After 4 days, non-adherent cells were removed by PBS washing, and the adherent cells were cultured with fresh medium. The third and fourth generations of EPCs were used.
Rat model of venous thrombosis
The animal protocol was approved by the Institutional Animal Care and Use Committee of Soochow University. SD rats were purchased from the Experiment Animal Center of Soochow University. The rats were anesthetized by intraperitoneal injection of 10 % chloral hydrate. A midline laparotomy was performed. The infrarenal inferior vena cava (IVC) was exposed and all side branches were ligated with 7-0 Prolene suture. The posterior venous branches were blocked by electric coagulation. A 7-0 Prolene suture was tied down on the IVC just below the left renal vein. At the same time, a microvascular clamp was attached to the confluence of iliac veins for 15 min to block the blood flow and induced the thrombus in IVC. The skin was sutured and the rats were allowed to recover after the surgery. Then the rats were divided into four groups for cell transplantion via tail intravenous injection (n = 10): (A) blank control group (blank control) received same volume of cell culture medium; (B) EPCs/pGLV3-H1-GFP-Puro vector group (EPCs/vector) received 1.0 × 106 EPCs transfected with pGLV3-H1-GFP-Puro control vector; (C) EPCs/pGLV3-H1- GFP-Puro-miR-483-3p group (EPCs/miR- 483-3p) received 1.0 × 106 EPCs transfected with pGLV3-H1-GFP-Puro-miR-483-3p; (D) EPCs/pGLV3-H1-GFP-Puro-miR-483-3p sponge group (EPCs/miR-483-3p sponge) received 1.0 × 106 EPCs transfected with pGLV3-H1-GFP-Puro-miR-483-3p sponge.
Histology
Seven days after the injection of either EPCs or control medium, the animals were sacrificed and IVC segments containing the thrombus were carefully harvested, and excess blood was absorbed with filter paper. The thrombi were weighed and embedded in optimal cutting temperature (OCT) media and flash-frozen in a −80 °C. Five micrometer cryosections were cut for histological analyses and a confocal microscope (Leica Microsystems) was used to analyze the homing of EPCs. The remaining samples were used for the analysis of thrombus organization and recanalization with hematoxylin and eosin (HE) staining.
DSA
IVC venography was performed with digital subtract angiography (DSA, GE Innova 3100, USA) by injecting contrast media into rat caudal vein or femoral vein to determine the recanalization and resolution of thrombus in vivo.
Statistical analyses
All statistical analyses were carried out using SPSS v21 (SPSS, Chicago, IL). Data are presented as mean ± SEM. Student’s t-test or one way ANOVA followed by Least Significant Difference test was used to compare the differences between or among the groups. Univariate comparisons of two independent groups were done using the Mann–Whitney-U test. Comparisons of multiple groups were performed with the Kruskal–Wallis test. P < 0.05 was considered significant.
Discussion
In the present study, we reported several important findings on the role of miR-483-3p in EPCs. First, miR-483-3p expression was increased in EPCs derived from patients with DVT. Overexpression of miR-483-3p decreased migration and angiogenic potential of EPCs while increased apoptosis of EPCs. Moreover, we identified SRF as the target of miR-483-3p in EPCs. The migration, angiogenic potential and apoptosis of EPCs were positively regulated by SRF, and the suppression of SRF by miR-483-3p contributed to the effects of miR-483-3p on EPCs function. In addition, we established a rat model of vein thrombosis and observed that transplantation with EPCs transfected with miR-483-3p displayed increased homing ability and improved the thrombus recanalization and resolution in vivo. Taken together, our data suggest that miR-483-3p plays an important role in EPCs dysfunction, and upregulated miR-483-3p in EPCs from DVT contributes to impaired EPCs function, which is likely due to decreased SRF.
Vein thrombi resolution is a complex and spontaneous process that requires the orchestration of different cells [
25]. Three main steps include the infiltration of inflammatory cell into the thrombus, tissue remodeling and angiogenesis. The vascularization of the thrombus is an early and important event on the efficacy of thrombus resolution [
25]. Growing evidences have suggested that bone marrow-derived EPCs are recruited into the thrombus and involved in the thrombus organization and resolution [
8,
26]. Several studies have reported the importance of EPCs in injured vessels repairmen and ischemic tissues revascularization [
27]. We previously demonstrated that bone marrow-derived EPCs transplantation altered the vein microenvironment in a rat model of chronic vein thrombosis [
28].
When DVT occurs, EPCs could home and migrate to the sites of neovascularization, increase new blood vessel formation in the injured site [
29], and secrete a variety of vasoactive and angiogenic factors to improve angiogenesis thrombus resolution [
25,
30]. In addition, EPCs have the potential to protect differentiated endothelial cells from apoptosis and to preserve their angiogenic capacity under conditions of oxidative stress [
31]. The proposed mechanisms of EPCs in thrombus resolution are as follows. EPCs can home and integrate into the site of the injured vessels and thrombi and participate in orchestrating the angiogenesis process. EPCs residing in the thrombi can release a source of paracrine pro-angiogenic factors to induce vascularization. Moreover, EPCs produce proteinases to break down thrombi and secrete other factors to interact with platelets to prevent the apoptosis of mature endothelial cells and the formation of new thrombosis [
32].
MiRNAs have been shown to play key roles in vascular development, homeostasis, function, disease and regeneration [
33]. In particular, miRNAs have impact on angiogenesis and modulate the behavior of EPCs [
15,
34,
35]. Therefore, we proposed that miRNA modified EPCs could improve the efficacy of EPCs in the thrombus resolution and recanalization. However, the potential of EPCs-mediated cancer initiation should be paid attention [
36].
MiR-483-3p is located within the insulin growth factor (IGF2) locus at chromosome 11p15.5 and implicated in various human cancers including colon, breast, liver cancers and squamous cell carcinomas [
37,
38]. IGF2 is involved in angiogenesis through the regulation of the IGF/IGF2R system, and miR-483-3p was an intronic miRNA within IGF2. Until now, the exact role of miR-483-3p in the function of EPCs has not been determined yet. In the present study, miR-483-5p emerges as a novel angio-miR that negatively regulates angiogenesis. By in vitro tube formation assay, we demonstrated that miR-483-3p modulated angiogenic potential of EPCs. Moreover, we found that miR-483-3p regulated the migration and apoptosis of EPCs.
To elaborate putative mechanism by which miR-483-3p regulates EPCs function, we employed bioinformatics tool and molecular biology method to identify target gene. Our results suggested that SRF could be the potential target of miR-483-3p. SRF is involved in the regulation of multiple genes implicated in cell growth, proliferation, migration, apoptosis, cytoskeletal organization, energy metabolism and myogenesis [
39,
40]. Moreover, SRF is important for the appropriate expression of structural proteins such as β-actin, VE-cadherin and several integrins in endothelial cells, and changed expression of SRF could lead to defective vascular morphogenesis [
41]. In addition, SRF was reported to mediate FGF signaling in tracheal terminal branching and VEGF/FGF signaling in sprouting angiogenesis [
42]. Indeed, previous study reported that miR-483-5p directly targeted SRF in human umbilical vein endothelial cells and inhibited angiogenesis in vitro [
43]. Therefore, our present study extended previous findings on miR-483-SRF pathway from endothelial cells to EPCs.
There are some limitations in this study. Our results confirmed that SRF was a target of miR-483-3p and the suppression of SRF by miR-483-3p was involved in the effects of miR-483-3p on EPCs function. However, additional target genes are likely to participate in the anti-angiogenic effect of miR-483-3p, which remain to be investigated in the near future. Furthermore, the criteria of EPCs are still controversial. In this study, we used adherent PBMCs with the features of DiI-ac-LDL endocytosis and UEA-I expression binding, and the cells also showed the expression of CD34, CD133 and VEGFR-2. These EPCs have been shown to self-renew and form tube-like structures in vitro, and there might be several cell subpopulations in these EPCs.
Authors’ contributions
XL and CL conceived the project. LK, NH, XD, WW, HC, WL, SW and HZ performed the patient collection, carried out the study protocol and data analysis. LK and NH wrote the paper. All authors read and approved the final manuscript.