Perturbation of gut microbiota decreases susceptibility but does not modulate ongoing autoimmune neurological disease

OSE (2D2 × IgH^MOG) C57BL/6 [12] and RR SJL/J [13] mice were bred and housed at the animal facility of the Max Planck Institute of Biochemistry, Martinsried. Mice were treated with ampicillin (1 g/L), neomycin (1 g/L), and vancomycin (1 g/L) dissolved in autoclaved drinking water. To increase the liquid intake, sweetener was added and the control mice also received the same sweetener in their drinking water. Since the disease development in the OSE model starts as early as 5 weeks after birth [12], OSE mice were given antibiotics either at 2 or 4 weeks of age in prophylactic treatment experiments. For therapeutic treatment experiments, mice that developed spontaneous EAE symptoms (after first signs of EAE) were randomly assigned to either control or antibiotic group and treated for 2 weeks as above. Clinical disease was assessed according to the standard 5-point scale [12, 13]. All animal procedures were approved by Regierung von Oberbayern (Munich, Germany).

Animals were sacrificed 2 weeks after treatment. The brain and spinal cords were fixed in formaldehyde and embedded in paraffin. The neuropathological analysis was done on paraffin sections of the brain (including optic nerve and chiasm) and the spinal cord stained with hematoxylin/eosin for inflammation and Luxol fast blue myelin stain for demyelination. Semiquantitative assessment of the degree of inflammation and demyelination was performed in the spinal cord and the optic nerves. The entire spinal cord was embedded in 10 standardized tissue blocks. Inflammation was quantified by counting the number of perivenous inflammatory infiltrates and providing their average number per spinal cord cross section per animal. The extent of demyelination in the spinal cord was evaluated according to the following scoring: 0, no demyelination; 1, perivenous and subpial demyelination; 2, confluent demyelinated plaques; and 3, extensive demyelination affecting more than half of the spinal cord cross section. The extent of demyelination in the optic nerve was evaluated according to the following scoring: 0, no demyelination; 1, perivenous demyelination; 2, perivenous and subpial demyelination; 3, confluent demyelinated plaques; and 4, complete focal demyelination in the optic nerve. Representative pictures for the demyelination scores are given in Supplementary Figure 2.

Isolation and phenotyping of immune cells by flow cytometry were done as previously described [4]. For the isolation of lymphocytes from the small intestine, the intestine was collected in ice-cold Hank’s Balanced Salt Solution (HBSS) buffered with 15 mM Hepes. After careful removal of Peyer’s patches, fatty tissue, and fecal contents, the intestine was opened longitudinally and cut into small pieces. The intestinal fragments were washed three times for 15 min in HBSS containing 5 mM EDTA, 15 mM Hepes, and 10% fetal bovine serum (FBS). Next, intestinal pieces were washed once for 5 min with stirring in Roswell Park Memorial Institute medium (RPMI) containing 15 mM HEPES and 10% FBS, followed by an incubation step at 37 °C with stirring (550 rpm) in RPMI with 15 mM HEPES, 10% FBS, and 100 U/ml collagenase D (Roche Diagnostics). The digested tissue was washed twice in HBSS containing 5 mM EDTA, before the lymphocytes of the small intestine were resuspended in 5 ml of 40% Percoll (Sigma-Aldrich) and overlaid on 2.5 ml of 80% Percoll. Percoll gradient separation was performed by centrifugation at 780g for 20 min at room temperature. Small intestinal lamina propria lymphocytes were harvested from the interphase of the Percoll gradient and washed once in RPMI containing 15 mM Hepes and 10% FBS. After isolation, cells were stained in FACS buffer (PBS containing 1% BSA and 0.1% NaN₃) with fluorochrome-labeled Abs against CD45 (30-F11), CD4 (RM4-5), B220 (RA3-6B2), CD11b (M1/70), and CD11c (N418). For intracellular cytokine staining, cells were activated with 50 ng/ml PMA (Sigma-Aldrich) and 500 ng/ml ionomycin (Sigma-Aldrich) in the presence of 5 μg/ml brefeldin A (Sigma-Aldrich) for 4 h at 37 °C. After surface staining, cells were fixed and permeabilized using the Transcription Factor Staining Buffer Set (eBioscience) and stained intracellularly using the following antibodies against IFN-γ (XMG1.2), IL17 (TC11-18H10), IL-22 (1H8PWSR), and TNFα (MP6-XT22). All antibodies were purchased from BD Pharmingen, eBioscience, or BioLegend. Cells were acquired on FACSVerse, and analysis was performed using FlowJo (TreeStar) software.

Fecal pellets were collected from the mice and frozen at − 80 °C until analysis. Fecal pellets of mice were weighed, suspended, and serially diluted in sterile PBS. One hundred microliters of the diluted fecal homogenates were plated on Bile Esculin (BE) agar plates. After overnight incubation at 37 °C, the colony-forming units (c.f.u.) were determined and expressed as c.f.u./g of feces.

Fecal pellets were collected from the mice and frozen at − 80 °C until analysis. Bacterial genomic DNA was extracted from fecal pellets using QIAamp DNA Stool mini kit with bead beating (Qiagen). An amplicon library targeting V3 and V4 regions of the 16S ribosomal RNA gene was amplified by PCR with specific primers and sequenced on an Illumina MiSeq instrument (2 × 300-bp paired-end reads). Paired reads were merged to assemble a contig within a length of 456 ± 11 base pairs. Contigs with low base pair quality scores as well as those with misprimes were removed. Sequences were assigned to the same species-level OTU if they had a 97% sequence identity. To identify differentially abundant members of the gut microbiome between the groups, we performed a Wilcoxon rank-sum test on OTU relative abundances and adjusted the P values for multiple testing using the false discovery rate (FDR). OTUs with an adjusted P value less than 0.05 were considered as differentially abundant.

Bacterial genomic DNA was extracted from fecal pellets using the QIAamp DNA Stool mini kit (Qiagen). Total or enterococci 16S rRNA gene-specific PCR was performed. Primers for enterococci 16S rRNA gene were as follows: GTGCCAGCMGCCGCGGTAA and GCCTCAAGGGCACAACCTCCAAG. Primers for total 16S rRNA gene were as follows: ACTCCTACGGGAGGCAGCAGT and ATTACCGCGGCTGCTGGC. All reactions were performed using the SYBR Green qPCR master Mix (Thermo Fisher Scientific) following the manufacturer’s instructions and measured using a 7900HT real-time PCR System or Quantstudio 3 (Applied Biosystems). The absolute quantity of 16S rRNA gene copies was calculated using a standard curve generated with a plasmid encoding enterococci or lactobacilli (for total 16S rRNA) 16S rRNA gene and expressed as gene copies per nanogram of DNA.