Background
Ulcerative colitis (UC), as the most common form of inflammatory bowel disease (IBD), is a form of colitis that includes characteristic ulcers, or open sores [1]. Ulcerative colitis has an incidence of 1 to 20 cases per 100,000 individuals per year, and a prevalence of 8 to 246 per 100,000 individuals [2]. Patients with UC have an increased risk of developing colorectal cancer [3]. The pathogenesis of UC is not well defined, but it is proposed that genetic and environmental factors result in an aberrant immune response to a subset of commensal enteric bacteria [4],[5]. Recent genome-wide association (GWA) studies and meta-analyses have identified many single-nucleotide polymorphisms (SNPs) associated with UC [6],[7].
Interleukin-22 (IL-22) is a member of the IL-10 family of anti-inflammatory cytokines that mediates epithelial immunity [8]. IL-22 is synthesized by different cell types including T- and NK-cells, and has been reported to mediate the crosstalk between inflammatory cells and keratinocytes [9]-[11]. IL-22 expression was induced in several human inflammatory conditions, including IBD [12],[13]. IL-22 expression was found to be increased in patients with UC [14]. Several SNPs have previously been identified in the IL-22 gene [15]-[22].
Anzeige
Whether genetic polymorphisms of IL-22 also influence UC risk is still unknown. The aim of this study was to investigate the association between the IL-22 gene polymorphisms (-429 C/T, +1046 T/A and +1995 A/C) and the risk of UC in Chinese Han patients.
Methods
Study subjects
This hospital-based case-control study comprised 180 patients with UC and 180 age- and gender-matched controls during the years 2009 to 2014. Diagnosis of UC was based on clinical, radiological, endoscopic and histological examinations [23]. To confirm the diagnosis, two physicians reviewed the hospital records and validated each case. The location of disease was defined according to the Montreal classification (ulcerative proctitis, left-sided colitis, and extensive colitis) [24]. The severity of UC was determined according to Truelove and Witts criteria (mild colitis, moderate colitis, and severe colitis) [25]. According to their clinical courses, UC cases were classified into one episode, relapsing and continuous phenotypes [26]. The control group was composed of age- and gender-matched subjects who had undergone an endoscopic examinations in the same recruitment period as the UC patients, without evidence of UC. In addition, similar to the cases the controls were all required to be born in China to native Chinese Han parents. Informed consent was obtained from all subjects after a full explanation of the project according to the Declaration of Helsinki, and the specimen collecting procedures were approved by the Institutional Ethical Committee of Guangdong Medical College.
Genotyping
Whole blood (3-6 ml) was obtained by venepuncture using standard EDTA collection tubes. DNA was extracted using the QIAGEN Gentra Puregene blood kit (QIAGEN Inc., Valencia, CA, USA). Genotypes of 3 common polymorphisms of the IL-22 gene were determined by fluorogenic 5' exonuclease assays (TaqMan). Primer and probe sequences for 5'-exonuclease assays for IL-22 polymorphisms were listed in Table 1. The polymerase chain reaction (PCR) was performed in a Primus 96 plus thermal cycler using a total volume of 5 μl containing 2.5 μl of Universal-MasterMix, 0.125 μl 40x Assay-by- Design mix, 0.375 μl H2O and 2 μl DNA. Reactions were overlaid with 15 μl of mineral oil. Cycling parameters were: 10 min at 94°C for primary denaturation, followed by 40 cycles of 20 s at 92°C and 1 min at 60°C. Fluorescence was measured in a lambda Fluoro 320 Plus plate reader (MWG Biotech AG, Germany).
Table 1
Primer and probe sequences for 5′-exonuclease assays for
IL-22
polymorphisms
SNPs | rs2227485 | rs1182844 | rs1179246 |
|---|---|---|---|
Exchange | -429 C/T | +1046 T/A | +1995 A/C |
Forward Primer | AAAATGAGTCCGTGACCAAAATGC | CCACCTATGAGACTTCCCTATCAGT | GAAAAAGCCTTCCTGCCTAATGG |
Reverse Primer | ACACAATTGTTTTGTCTTAGTAGAGTTCAGAT | CACTAAAGGAAAAGGAAAGCTGTGTTT | GGTGCTGCCTAAAGGTCAGA |
Wildtype-Probe | FAM-CTCCTATAGTGACTGAGTAA-NFQ | VIC-AAACTTACTAGTAGGTATGACTC-NFQ | VIC-TGAACAGAGTTATCTGCCTC-NFQ |
Mutant-Probe | VIC-CTCCTATAGTGGCTGAGTAA-NFQ | FAM-CTTACTAGTAGGAATGACTC-NFQ | FAM-AACAGAGTTAGCTGCCTC-NFQ |
Statistical analysis
STATA program version 11.0 (StataCorp LP, TX) was used for statistical analyses. Continuous variables were analysed by t-test and presented as mean-standard deviation (SD). Categorical variables are presented as percentages and were compared by chi-squared test. Odds ratio (OR) and 95% confidence intervals (CI) were determined by logistic regression analysis. For a new work, we also use the Bonferroni correction for total number of independent comparisons. The Hardy-Weinberg equilibrium was tested for goodness-of-fit chi-square test with one degree of freedom to compare the observed genotype frequencies among the subjects with the expected genotype frequencies. The P-value less than 0.05 was considered statistically significant.
Anzeige
Results
Characteristics of participants
Demographic and clinical characteristics of study participants were showed in Table 2. No significant differences were found between the UC cases and controls in age, sex, body mass index (BMI), smoking status and family history of inflammatory bowel disease (IBD) (Table 2). The genotype were in agreement with the Hardy-Weinberg equilibrium.
Table 2
Demographic and clinical characteristics of study participants
UC | Controls |
P
| |
|---|---|---|---|
Number of subjects | 180 | 180 | |
Sex (Male/Female) | 95/85 | 98/82 | 0.75 |
Age (years, mean ± SD) | 39.7 ± 12.5 | 40.2 ± 13.1 | 0.71 |
BMI (kg/m2, mean ± SD) | 20.2 ± 3.7 | 19.8 ± 3.5 | 0.29 |
Smoking status (Ever/Never) | 79/101 | 75/105 | 0.67 |
Family history of IBD (Positive/Negative) | 14/166 | 11/169 | 0.54 |
Clinical type | |||
One episode | 16 | ||
Relapsing | 70 | ||
Continuous | 94 | ||
Location | |||
Proctitis (E1) | 73 | ||
Left side (E2) | 64 | ||
Extensive (E3) | 43 | ||
Disease severity | |||
Mild | 76 | ||
Moderate | 95 | ||
Severe | 9 |
IL-22-429C/T polymorphisms and UC
Patients with UC had a significantly higher frequency of IL-22 -429 TT genotype (OR =2.43, 95% CI = 1.35, 4.37; P = 0.003) and -429 T allele (OR =1.54, 95% CI = 1.14, 2.07; P = 0.004) than controls (Table 3). The findings are still emphatic by the Bonferroni correction. When stratifying by clinical type, location and disease severity of UC, no significant differences were found in any groups (Table 4).
Table 3
Genotype and allele frequencies of
IL-22
gene polymorphisms among ulcerative colitis cases and healthy controls
Genotypes | UC (n = 150) | Controls (n = 150) | OR (95% CI) |
P
|
|---|---|---|---|---|
-429 CC | 57(31.7) | 68(37.8) | 1.00(Reference) | |
-429 CT | 70(38.9) | 86(47.8) | 0.97(0.61,1.56) | 0.90 |
-429 TT | 53(29.4) | 26(14.4) | 2.43(1.35,4.37) | 0.003 |
-429 C allele frequency | 184(51.1) | 222(61.7) | 1.00(Reference) | |
-429 T allele frequency | 176(48.9) | 138(38.3) | 1.54(1.14,2.07) | 0.004 |
+1046 TT | 88(48.9) | 94(52.2) | 1.00(Reference) | |
+1046 TA | 63(35.0) | 61(33.9) | 1.10(0.70,1.74) | 0.67 |
+1046 AA | 29(16.1) | 25(13.9) | 1.24(0.67,2.28) | 0.49 |
+1046 T allele frequency | 239(66.4) | 249(69.2) | 1.00(Reference) | |
+1046 A allele frequency | 121(33.6) | 111(30.8) | 1.14(0.83,1.55) | 0.43 |
+1995 AA | 76(42.2) | 81(45.0) | 1.00(Reference) | |
+1995 AC | 65(36.1) | 63(35.0) | 1.10(0.69,1.75) | 0.69 |
+1995 CC | 39(21.7) | 36(20.0) | 1.16(0.67,2.00) | 0.61 |
+1995 A allele frequency | 217(60.3) | 225(62.5) | 1.00(Reference) | |
+1995 C allele frequency | 143(39.7) | 135(37.5) | 1.10(0.81,1.48) | 0.54 |
Table 4
Stratification analysis of
IL-22
-429 C/T polymorphisms in ulcerative colitis cases
Cases (n = 180) | CC | CT | TT | |||||||
|---|---|---|---|---|---|---|---|---|---|---|
n (%) | OR (95% CI) |
P
| n (%) | OR (95% CI) |
P
| n (%) | OR (95% CI) |
P
| ||
Clinical type | 180 | 57(31.7) | 1(Reference) | 70(38.9) | 1(Reference) | 53(29.4) | 1(Reference) | |||
One episode | 16 | 5(31.2) | 0.99(0.35,2.81) | 0.98 | 7(43.8) | 1.13(0.44,2.85) | 0.80 | 4(25.0) | 0.85(0.27,2.65) | 0.78 |
Relapsing | 70 | 24(34.3) | 1.08(0.62,1.88) | 0.78 | 26(37.1) | 0.96(0.56,1.62) | 0.87 | 20(28.6) | 0.97(0.54,1.74) | 0.92 |
Continuous | 94 | 28(29.8) | 0.94(0.56,1.58) | 0.82 | 37(39.4) | 1.01(0.63,1.62) | 0.96 | 29(30.8) | 1.05(0.63,1.76) | 0.86 |
Location | 180 | 57(31.7) | 1(Reference) | 70(38.9) | 1(Reference) | 53(29.4) | 1(Reference) | |||
Proctitis (E1) | 73 | 24(32.9) | 1.04(0.60,1.80) | 0.89 | 27(37.0) | 0.95(0.57,1.60) | 0.85 | 22(30.1) | 1.02(0.58,1.80) | 0.94 |
Left side (E2) | 64 | 20(31.3) | 0.99(0.55,1.77) | 0.97 | 26(40.6) | 1.05(0.61,1.78) | 0.87 | 18(28.1) | 0.96(0.52,1.75) | 0.88 |
Extensive (E3) | 43 | 13(30.2) | 0.96(0.48,1.90) | 0.89 | 17(39.6) | 1.02(0.54,1.90) | 0.96 | 13(30.2) | 1.03(0.51,2.05) | 0.94 |
Disease severity | 180 | 57(31.7) | 1(Reference) | 70(38.9) | 1(Reference) | 53(29.4) | 1(Reference) | |||
Mild | 76 | 25(32.9) | 1.04(0.61,1.79) | 0.89 | 28(36.8) | 0.95(0.57,1.58) | 0.84 | 23(30.3) | 1.03(0.59,1.80) | 0.92 |
Moderate | 95 | 29(30.5) | 0.96(0.58,1.61) | 0.89 | 38(40.0) | 1.03(0.65,1.64) | 0.91 | 28(29.5) | 1.00(0.59,1.68) | 0.99 |
Severe | 9 | 3(33.3) | 1.05(0.28,4.02) | 0.94 | 4(44.5) | 1.14(0.34,3.83) | 0.83 | 2(22.2) | 0.76(0.16,3.60) | 0.72 |
IL-22 +1046 T/A polymorphisms and UC
The IL-22+1046 T/A gene polymorphisms were not associated with a risk of UC (Table 3). When stratifying by clinical type, location and disease severity of UC, no significant differences were found in any groups (Table 5).
Table 5
Stratification analysis of
IL-22
+ 1046 T/A polymorphisms in ulcerative colitis cases
Cases (n = 180) | TT | TA | AA | |||||||
|---|---|---|---|---|---|---|---|---|---|---|
n (%) | OR (95% CI) |
P
| n (%) | OR (95% CI) |
P
| n (%) | OR (95% CI) |
P
| ||
Clinical type | 180 | 88(48.9) | 1(Reference) | 63(35.0) | 1(Reference) | 29(16.1) | 1(Reference) | |||
One episode | 16 | 7(43.7) | 0.89(0.35,2.55) | 0.81 | 6(37.6) | 1.07(0.40,2.86) | 0.89 | 3(18.7) | 1.16(0.32,4.25) | 0.82 |
Relapsing | 70 | 33(47.1) | 0.96(0.59,1.57) | 0.88 | 26(37.2) | 1.06(0.62,1.81) | 0.83 | 11(15.7) | 0.98(0.46,2.06) | 0.95 |
Continuous | 94 | 48(51.1) | 1.04(0.68,1.61) | 0.84 | 31(33.0) | 0.94(0.57,1.55) | 0.82 | 15(15.9) | 0.99(0.51,1.94) | 0.98 |
Location | 180 | 88(48.9) | 1(Reference) | 63(35.0) | 1(Reference) | 29(16.1) | 1(Reference) | |||
Proctitis (E1) | 73 | 37(50.7) | 1.04(0.65,1.66) | 0.88 | 25(34.2) | 0.98(0.57,1.67) | 0.94 | 11(15.1) | 0.94(0.44,1.97) | 0.86 |
Left side (E2) | 64 | 33(51.6) | 1.06(0.65,1.72) | 0.83 | 21(32.8) | 0.94(0.53,1.66) | 0.82 | 10(15.6) | 0.97(0.45,2.10) | 0.94 |
Extensive (E3) | 43 | 18(41.9) | 0.86(0.47,1.57) | 0.62 | 17(39.5) | 1.13(0.60,2.12) | 0.70 | 8(18.6) | 1.16(0.49,2.70) | 0.74 |
Disease severity | 180 | 88(48.9) | 1(Reference) | 63(35.0) | 1(Reference) | 29(16.1) | 1(Reference) | |||
Mild | 76 | 35(46.1) | 0.94(0.59,1.51) | 0.81 | 28(36.8) | 1.05(0.63,1.77) | 0.85 | 13(17.1) | 1.06(0.52,2.15) | 0.87 |
Moderate | 95 | 48(50.5) | 1.03(0.67,1.59) | 0.88 | 32(33.7) | 0.96(0.59,1.58) | 0.88 | 15(15.8) | 0.98(0.50,1.92) | 0.95 |
Severe | 9 | 5(55.6) | 1.14(0.37,3.49) | 0.82 | 3(33.3) | 0.95(0.25,3.63) | 0.94 | 1(11.1) | 0.69(0.08,5.65) | 0.73 |
IL-22 +1995 A/C polymorphisms and UC
The IL-22 +1995 A/C gene polymorphisms were not associated with a risk of UC (Table 3). When stratifying by clinical type, location and disease severity of UC, no significant differences were found in any groups (Table 6).
Table 6
Stratification analysis of
IL-22
+1995 A/C polymorphisms in ulcerative colitis cases
Cases (n = 180) | AA | AC | CC | |||||||
|---|---|---|---|---|---|---|---|---|---|---|
n (%) | OR (95% CI) |
P
| n (%) | OR (95% CI) |
P
| n (%) | OR (95% CI) |
P
| ||
Clinical type | 180 | 76(42.2) | 1(Reference) | 65(36.1) | 1(Reference) | 39(21.7) | 1(Reference) | |||
One episode | 16 | 7(43.8) | 1.04(0.41,2.62) | 0.94 | 6(37.5) | 1.04(0.39,2.77) | 0.94 | 3(18.7) | 0.87(0.24,3.12) | 0.83 |
Relapsing | 70 | 29(41.4) | 0.98(0.59,1.63) | 0.94 | 25(35.7) | 0.99(0.58,1.69) | 0.97 | 16(22.9) | 1.06(0.55,2.01) | 0.87 |
Continuous | 94 | 40(42.6) | 1.01(0.64,1.59) | 0.97 | 34(36.2) | 1.00(0.62,1.63) | 0.99 | 20(21.2) | 0.98(0.54,1.78) | 0.95 |
Location | 180 | 76(42.2) | 1(Reference) | 65(36.1) | 1(Reference) | 39(21.7) | 1(Reference) | |||
Proctitis (E1) | 73 | 31(42.5) | 1.01(0.61,1.66) | 0.98 | 26(35.6) | 0.99(0.58,1.68) | 0.96 | 16(21.9) | 1.01(0.53,1.92) | 0.97 |
Left side (E2) | 64 | 26(40.6) | 0.96(0.57,1.63) | 0.89 | 24(37.5) | 1.04(0.60,1.80) | 0.89 | 14(21.9) | 1.01(0.52,1.98) | 0.98 |
Extensive (E3) | 43 | 19(44.2) | 1.05(0.57,1.91) | 0.88 | 15(34.9) | 0.97(0.50,1.86) | 0.92 | 9(20.9) | 0.97(0.44,2.15) | 0.93 |
Disease severity | 180 | 76(42.2) | 1(Reference) | 65(36.1) | 1(Reference) | 39(21.7) | 1(Reference) | |||
Mild | 76 | 33(43.4) | 1.03(0.63,1.68) | 0.91 | 27(35.5) | 0.98(0.58,1.66) | 0.95 | 16(21.1) | 0.97(0.51,1.84) | 0.93 |
Moderate | 95 | 39(41.1) | 0.97(0.61,1.54) | 0.91 | 35(36.8) | 1.02(0.63,1.65) | 0.94 | 21(22.1) | 1.02(0.57,1.83) | 0.95 |
Severe | 9 | 4(44.5) | 1.05(0.32,3.52) | 0.93 | 3(33.3) | 0.92(0.24,3.52) | 0.91 | 2(22.2) | 1.03(0.21,4.93) | 0.98 |
Discussion
Recently, many studies have identified many SNPs associated with UC. A case-control study in 139 and 176 patients with UC and controls found that polymorphisms in CD14-159 C/T and TLR4-299 A/G significantly affected mCD14 and mTLR4 expression levels and also increased susceptibility to UC [27]. A case-control study in a Korean population suggested that the -1920 G > A polymorphism in IFITM1 may be associated with susceptibility to UC (P = 0.002) [28]. A case-control study in a group of 198 Mexican Mestizo patients with UC and 698 ethnically matched healthy unrelated individuals with no family history of UC suggested that the GG genotypes of the IL-20 polymorphisms (rs2981573 and rs2232360) might have an important role in the development of UC (P = 0.017) in the Mexican population [29]. A case-control study in 56 patients with UC and 50 healthy controls suggested that the IL-10 -819 CC was a candidate genotype for both IBS (P = 0.047) and UC (P = 0.007) in Japanese [30]. A case-control study suggested that the −1850 G/C polymorphism in the embryonic ectoderm development (EED) gene might be associated with the susceptibility to UC (P = 0.018) by the change of the EED expression level [31]. A meta-analysis of seventeen studies with 18,308 cases and 20,406 controls indicated that the PTPN2 polymorphism (rs2542151) was associated with increased UC risk [32]. A meta-analysis of nine studies indicated that the vitamin D receptor (VDR) polymorphisms were associated with increased UC risk [33]. A meta-analysis suggested that the migration inhibitory factor (MIF) gene -173 G/C polymorphism contributed to the susceptibility of UC [34]. A case-control study included 422 very-early-onset IBD subjects and 480 healthy subjects suggested that IL-10R polymorphisms were associated with very-early-onset ulcerative colitis (P = 0.0002) [35]. A case-control study included 171 UC and 213 healthy controls found that polymorphisms in XRCC1 Arg399Gln and APE1 Asp148Glu significantly increased the rate of apoptosis and risk of UC (P = 0.0007) [36]. A case-control study in a group of 200 Mexican patients with UC and 248 ethnically matched unrelated healthy controls suggested that IL-1 RN and IL-1B polymorphisms were associated with the genetic susceptibility to develop UC and might be associated with the presence of steroid-dependence in UC patients (P = 0.019) [37]. A case-control study in a group of 200 Mexican Mestizo patients with UC and 698 healthy unrelated individuals with no family history of UC suggested that IL-19 polymorphisms (rs2243188 and rs2243193) might have a protective role in the development of UC (P = 0.018 and P = 0.006, respectively) in Mexican individuals [38].
IL-22 expression was involved in several human inflammatory conditions and autoimmune diseases. A study included 631 HCV patients found that IL-22 polymorphisms were involved in the progression of persistent hepatitis C virus infection [15]. A case-control study in 206 cases and 196 controls suggested that Polymorphisms in the IL-22 receptor alpha-1 gene were associated with severe chronic rhinosinusitis (P = 0.0014) [16]. A case-control study in 194 patients and 287 normal controls suggested that polymorphism of IL-22 receptor alpha-1 was associated with the development of childhood IgA nephropathy (P = 0.002) [22]. IL-22 deficiency may contribute to the pathogenesis of certain chronic disorders as postulated in this paper for acne inversa [39]. A study included 94 patients with COPD, 23 healthy smokers, and 22 healthy control non-smokers found that the increased sputum IL-22 might also play important roles in the pathogenesis of chronic obstructive pulmonary disease (P< 0.01) [40]. A case-control study indicated that there was an increased expression level of IL-22 and IL-23 in patients with peri-implantitis (P< 0.05) [41]. A study in 18 cases and 21 controls suggested that increased expression of IL-22 was associated with disease activity in Behcet s disease [42]. IL-22 has been reported to be involved in systemic sclerosis lesions [43]. A study included allergic asthma (n = 18), controlled asthma (n = 17) and healthy controls (n = 12) found that IL-22 might be involved in the pathogenesis of allergic asthma in human and the level of IL-22 might have some relationship with the severity of the disease (P< 0.05) [44].
Our results should be taken with caution for some limitations. First of all, the numbers of subjects included in this study were small, and may not have been sufficient to reveal the associations between the IL-22 gene polymorphisms (-429 C/T, +1046 T/A and +1995 A/C) and the risk of UC. Secondly, our investigation was not based on genome wide screening, but UC was induced by multiple genes and environmental factors, which were not explored in the present study. Thirdly, the participants in our research are only from Han Chinese ethnic group. It would be interesting to conduct similar studies in different populations for comparison. Finally, this is a hospital based case control study, so the selection bias cannot be avoidable and the subjects may not be representative of the general population.
Conclusions
In conclusion, this study provides evidence for an association of IL-22 -429 C/T gene polymorphisms with UC risk. To the best of our knowledge this is the first study to provide evidence about the role of IL-22 polymorphisms in the development of UC. Additional well-designed large-scale multicenter studies were required for the validation of our results.
Anzeige
Authors' information
Hong Gang Chi and Xue Bao Zheng are joint first authors.
Acknowledgment
This investigation was funded by the National Natural Science Foundation of China (NSFC, No. 81173240), Science and Technology Planning Project of Guangdong Province (No. 2013B032500019), China and the PhD Start-up Fund of Guangdong Medical College (No. B2013005, B2013006).
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made.
The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder.
To view a copy of this licence, visit https://creativecommons.org/licenses/by/4.0/.
The Creative Commons Public Domain Dedication waiver (https://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.
Competing interests
The authors declare that they have no competing interests.
Authors' contributions
HGC and YZ carried out the molecular genetic studies and drafted the manuscript. XBZ carried out the genotyping. ZGW and SXD participated in the design of the study and performed the statistical analysis. HGC, XBZ, ZGW, SXD, ZW and YZ conceived of the study, and participated in its design and coordination and helped to draft the manuscript. All authors read and approved the final manuscript.