Background
Amyotrophic lateral sclerosis (ALS), the most common form of motor neuron disease, is a severe adult-onset neuromuscular disease affecting motor neurons in the spinal cord, brainstem and motor cortex. Up to 90% of ALS cases are sporadic (sALS), the rest 10% bear a strong genetic component (familial ALS, fALS), and currently mutations in more than 20 genes are known to cause fALS [
1]. The complexity of the disease hinders development of ALS therapeutics, and those two drugs that have been approved for the treatment of ALS so far, riluzole and edaravone, have very limited efficacy.
A multifunctional RNA-binding protein TDP-43 encoded by
TARDBP gene is believed to be the main culprit in ALS: TDP-43 pathology is typical for ~ 95% of sALS cases and for fALS cases caused by
C9ORF72 gene mutation [
2]; in addition, dozens of mutations in
TARDBP have been identified in fALS and sALS patients [
3,
4]. Hallmarks of all these ALS cases include protein clearance from the nucleus, its cytoplasmic accumulation and aggregation [
5,
6]. Therefore, both loss and gain of TDP-43 function are implicated in ALS however the relative contribution of these two mechanisms is still debated.
The paraspeckle is a prototypical nuclear body localized on the border of splicing speckles [
7]. A long non-coding RNA (lncRNA) NEAT1 serves as a scaffold for paraspeckles, spatially organizing a variety of proteins by direct binding or piggy-back mechanism [
8‐
11]. The
NEAT1 locus produces two transcripts, NEAT1_1 and NEAT1_2. The longer NEAT1 isoform, NEAT1_2, is essential for paraspeckle assembly [
10,
12]. Functions of paraspeckles described so far include nuclear retention of specific RNAs, including inverted Alu repeat-containing transcripts; regulation of gene expression by sequestration of transcription factors; and modulation of miRNA biogenesis [
13‐
16].
There is an established association of paraspeckles and their components with a variety of pathological states and conditions, from cancer to neurodegeneration. Paraspeckles protect cancer cells against DNA damage and replication stress, regulate hormone receptor signaling and hypoxia-associated pathways thereby increasing their survival [
17‐
19]. Paraspeckles become enlarged in cells primed by viral or synthetic double-stranded (ds) RNAs and play an important role in antiviral response [
14]. An unusually tight association of paraspeckle components with neurodegenerative conditions, and ALS in particular, has recently emerged. Firstly, enhanced paraspeckle formation has been reported in spinal motor neurons of sALS patients [
20]. This finding was surprising because levels of the longer NEAT1 isoform, NEAT1_2, essential for paraspeckle formation, are very low in the adult nervous system [
21]. Secondly, at least seven paraspeckle proteins, including TDP-43 and FUS, are genetically linked to ALS and a related condition, frontotemporal lobar degeneration (FTLD) [
22‐
25]. FUS, a protein structurally and functionally similar to TDP-43, is required to build paraspeckles [
8,
23]. TDP-43 association with paraspeckles has also been reported [
8]. TDP-43 directly binds NEAT1, and this interaction is increased in the brain of FTLD patients [
26,
27]. Overall, currently available data support the role of paraspeckles in molecular pathology of ALS, however the underlying mechanisms of their enhanced formation in spinal neurons are not understood.
In current study we show that loss of TDP-43 is sufficient to stimulate paraspeckle formation – a phenomenon likely linked to the function of TDP-43 in microRNA (miRNA) processing and as an RNA chaperone. Furthermore, we provide evidence that paraspeckles are protective in cells with impaired function of the miRNA machinery and those with activated dsRNA response. Finally, we show that enoxacin, an enhancer of the miRNA pathway, promotes paraspeckle formation.
Methods
Stable cell line maintenance, transfection and treatments
SH-SY5Y neuroblastoma cells and MCF7 cells were maintained in 1:1 mixture of Dulbecco’s Modified Eagle’s Medium and F12 medium supplemented with 10% fetal bovine serum (FBS), penicillin-streptomycin and glutamine (all Gibco, Invitrogen). For differentiation into neuron-like cells, SH-SY5Y cells were grown on poly-L-lysine (Sigma) coated coverslips in advanced DMEM/F12 (ADF)/Neurobasal A mixture supplemented with 10 μM all-trans retinoic acid (Sigma), B27 (Life Technologies) and BDNF (Miltenyi, 10 ng/ml) for 6 days. The following gene-specific siRNAs were used: ADAR1; Dicer; Drosha; FUS; Ago2; IFNB1 (all Life Technologies, Silencer®); TARDBP (Silencer Select®, s23829 and EHU109221, Mission® esiRNA, Sigma); NEAT1 (Silencer Select®, n272456). Scrambled negative control was AllStars from Qiagen. Plasmids for expression of TDP-43 dNLS and TDP-43 C-termical fragment are described elsewhere [
28]. Cells were transfected with siRNA (400 ng/well), plasmid DNA (200 ng/well) or poly(I:C) (Sigma, 250 ng/well) using Lipofectamine2000 (Life Technologies) in 24-well plates. TDP-43 specific shRNA plasmid was from Sigma (MISSION® SHCLNG-NM_007375). To delete the NLS of endogenous TDP-43, Feng Zhang lab’s Target Finder (
http://crispr.mit.edu/) was used to identify guide RNA target sequences flanking the genomic region of
TARDBP gene encoding NLS. Respective forward and reverse oligonucleotides for two pairs of guides were annealed and cloned into pX330-U6-Chimeric_BB-CBh-hSpCas9 (pX330) vector provided by Feng Zhang (Addgene deposited plasmid) as described [
29]. MCF7 cells were transfected with plasmids encoding upstream and downstream guide RNAs (500 ng/well) using Lipofectamine2000 and analysed after 72 h. Guide RNA sequences: T1: 5’-TTATTTAGATAACAAAAGAAAAA-3′, T2: 5’-AACATCCGATTTAATAGTGT-3′, T3: 5’-GGAATTCTGCATGCCCCAGATGC-3′, T4: 5’-ACATCCGATTTAATAGTGTT-3′. Cellular treatments were as follows: 1 × 10
4 IU interferon beta-1a (IFNbeta), 0.5 μg/ml LPS, 100 μg/ml zymosan, 50 μM suramin, 500 nM TSA, 2 mM sodium butyrate, 10 and 50 μM enoxacin, 10 μM riluzole, 10 μM edaravone (all Sigma). Human ES cell derived neurons were transfected with 15 μg/well of poly(I:C) using FuGENE®HD (Promega). Enoxacin, edaravone and riluzole toxicity was assessed using resazurin-based CellTiter-Blue Cell Viability Assay (Promega).
Primary culture of mouse neurons
Primary cultures of mouse hippocampal neurons were prepared from P0 CD1 mice as described [
28] and maintained for 5–14 days.
Differentiation of human ES cells into motor neuron enriched cultures
Cultures of human neural precursor cells (NPCs) and motor neurons differentiated from H9 hES cell line were prepared as described previously [
30]. Briefly, hES cells were maintained in mTESR2 media (Stemcell Technologies) on Matrigel® (Corning) coated dishes. Confluent hES H9 cultures were switched to differentiation medium composed of ADF supplemented with SB431542 (10 μM, Abcam). Purmorphamine (1 μM, Cayman Chemicals) and retinoic acid (0.1 μM, Sigma) were added on Day 4. On Day 8, cells were split in 1:2 ratio and on Day 16, NPCs were dissociated using Accutase®, plated onto Matrigel® coated dishes and cultured in ADF with GlutaMAX, penicillin-streptomycin, B27 (12587–010) and N2 supplements (all Life Technologies) and BDNF (Miltenyi, 10 ng/ml). On Day 23, Accutase® was used to re-plate neurons on dishes/coverslips at desired density. Neurons were cultured in 50:50 mixture of ADF/Neurobasal A with the above supplements until Day 40.
Immunocytochemistry and RNA-FISH on cultured cells
Cells were fixed on coverslips with 4% paraformaldehyde on ice for 15 min and permeabilized in cold methanol (or 70% ethanol in case of RNA-FISH). Coverslips were incubated with primary antibodies diluted in blocking solution (5% goat serum in 0.1% Triton X-100/PBS) for 1 h at RT or at 4 °C overnight. Secondary Alexa488- or Alexa546-conjugated antibody was added for 1 h at RT. For RNA-FISH, commercially available NEAT1 and MALAT1 probes (Stellaris® FISH Probes against human NEAT1, middle segment or 5′ segment, or human MALAT1, all Biosearch Technologies) were used as per standard protocol. Fluorescent images were taken using BX61 microscope equipped with F-View II camera and processed using CellF software (all Olympus). Paraspeckle quantification (number of individual paraspeckles per DAPI-visualised nucleus) was performed manually, by the same person for all conditions, blinded to the experimental condition. Clusters of paraspeckles were counted as a single paraspeckle. For quantification of cleaved caspase 3 positive cells, ‘Analyze particles’ tool of Image J software was used (8–10 fields were analysed per condition).
RNA analysis
Total cellular RNA was extracted using GenElute total RNA kit (Sigma) and possible DNA contamination was removed using RNase free DNase kit (Qiagen). First-strand cDNA synthesis were performed using random primers and Superscript IV (Invitrogen). For analysis of miRNA levels, RNA was extracted with QIAzol (Qiagen) followed by reverse transcription with Qiagen miScript II RT Kit. Real-time qPCR was conducted using SYBR green master mix as described [
28]. For miRNA quantification, forward miRNA-specific primers were used in combination with the universal reverse primer (unimiR). All primer sequences are given in Table
1.
Table 1
Primers used in the study
GAPDH | 5’-TCGCCAGCCGAGCCA-3′ | 5’-GAGTTAAAAGCAGCCCTGGTG − 3′ |
NEAT1 total | 5’-CTCACAGGCAGGGGAAATGT-3′ | 5’-AACACCCACACCCCAAACAA-3′ |
NEAT1_2 | 5’-AGAGGCTCAGAGAGGACTGTAACCTG-3′ | 5′-TGTGTGTGTAAAAGAGAGAAGTTGTGG-3’ |
TDP-43 | 5’-TCAGGGCCTTTGCCTTTGTT-3’ | 5’-TGCTTAGGTTCGGCATTGGAT-3’ |
IL8 | 5’-ACACTGCGCCAACACAGAAA-3′ | 5’-CCTCTGCACCCAGTTTTCCT-3’ |
ADARB2 | ATATTCGTGCGGTTAAAAGAAGGTG | ATCTCGTAGGGAGAGTGGAGTCTTG |
Alu RNA | 5’-GAGGCTGAGGCAGGAGAATCG-3’ | 5’-GTCGCCCAGGCTGGAGTG-3’ |
DICER | 5’-TTAACCTTTTGGTGTTTGATGAGTGT-3’ | 5’-GCGAGGACATGATGGACAATT-3’ |
DROSHA | 5’-CGGCCCGAGAGCCTTTTAT-3’ | 5’-TGCACACGTCTAACTCTTCCA-3’ |
ADAR1 | 5’-TTGTCAACCACCCCAAGGT-3’ | 5’-CCATCAGCCAGACACCAGTT-3’ |
AGO2 | 5’-CACCATGTACTCGGGAGCC-3’ | 5’-TCCCAAAGTCGGGTCTAGGT-3’ |
FUS | 5’-GCGGGGCTGCTCAGT-3’ | 5’-TTGGGTTGCTTGTTGGGTAT-3’ |
CHOP | 5’-TTAAAGATGAGCGGGTGGC-3′ | 5’-GCTTTCAGGTGTGGTGATGTA-3’ |
CXCL10 | 5’-TGCCATTCTGATTTGCTGCC-3’ | 5’-ATGCTGATGCAGGTACAGCG-3’ |
IFNB1 | 5’-ACGCCGCATTGACCATCTAT-3’ | 5’-AGCCAGGAGGTTCTCAACAA-3’ |
IFNA1 | 5’-TCTGCTATGACCATGACACGAT-3’ | 5’-CAGCATGGTCCTCTGTAAGGG-3’ |
IFNA2 | 5’-AGGAGGAAGGAATAACATCTGGTC-3’ | 5’-GCAGGGGTGAGAGTCTTTGAA-3’ |
MALAT1 | 5’-GGATCCTAGACCAGCATGCC-3’ | 5′- AAAGGTTACCATAAGTAAGTTCCAGAAAA-3’ |
IFIH1 | 5’-GCATGGAGGAGGAACTGTTGA-3’ | 5’-GCATGGAGGAGGAACTGTTGA-3’ |
CYCS | 5’-TCGTTGTGCCAGCGACTAAA-3’ | 5’-GCTTGCCTCCCTTTTCAACG-3’ |
STAT1 | 5’-CTGTGCGTAGCTGCTCCTTT-3’ | 5’-GGTGAACCTGCTCCAGGAAT-3’ |
MYD88 | 5’-TGACCCCCTGGGGCAT-3’ | 5’-AGTTGCCGGATCATCTCCTG-3’ |
Pri-miR-17–92 | 5’-CAGTAAAGGTAAGGAGAGCTC AATCTG-3’ | 5’-CATACAACCACTAAGCTAAAGAAT AATCTGA-3’ |
Pri-miR-15a | 5’-CCTTGGAGTAAAGTAGCAGCAC-3’ | 5’-CCTTGTATTTTTGAGGCAGCAC-3’ |
miR-18a | 5’-CATCATCGGTAAGGTGCATC-3’ | 5’-GAATCGAGCACCAGTTACGC-3′ (unimiR) |
miR-92a | 5’-GAGTCTATTGCACTTGTCCC-3’ | unimiR |
miR-106a | 5’-AAAAGTGCTTACAGTGCAGGTAG-3’ | unimiR |
RNA immunoprecipitation (RIP) and PCR analysis
MCF7 cells were transfected with equal amounts of plasmids to express GFP-tagged FUS or NONO together with TARDBP siRNA or scrambled control siRNA. After 48 h, cells were scraped in RIP buffer prepared using RNase-free water (1xPBS with 1% Triton-X100 and protease inhibitors cocktail). Cells were left on ice for 10 min with periodic vortexing, and the lysate was centrifuged at 13,000 rpm for 10 min. GFP-Trap® beads (Chromotek) were washed in RIP buffer 4 times and added directly to cleared cell lysates with subsequent rotation at + 4 °C for 3 h. Beads were washed 4 times in RIP buffer and RNA was eluted by resuspension in TRI-reagent (Sigma). RNA was purified according to manufacturer’s protocol, and equal amounts of RNA were used for cDNA synthesis as described above.
Protein analysis
Total cell lysates were prepared for Western blot by lysing cells in wells in 2× Laemmli (loading) buffer followed by denaturation at 100 °C for 5 min. Proteins were resolved by SDS-PAGE and transferred to PVDF membrane (Amersham) by semi-dry transfer. The membrane was blocked in 4% non-fat milk in TBST and incubated in primary antibodies prepared in milk or 5% BSA overnight. Secondary HRP-conjugated antibodies were from Amersham. For detection of proteins, WesternBright Sirius ECL reagent (Advansta) was used. β-actin was used for normalisation.
Primary antibodies
The following commercial primary antibodies were used: TDP-43 (rabbit polyclonal, 10782–2-AP, Proteintech and mouse monoclonal, MAB7778-SP, R&D Biosystems); FUS (rabbit polyclonal, Proteintech, 11570–1-AP); p54nrb/NONO (rabbit polyclonal C-terminal, Sigma); PSF/SFPQ (rabbit monoclonal, ab177149, Abcam); Tuj (β-Tubulin III, mouse monoclonal, Sigma); dsRNA (mouse monoclonal, J2, Kerafast); cleaved caspase 3 (rabbit polyclonal, 9661, Cell Signaling); NF-κB p65 (rabbit monoclonal, D14E12, Cell Signaling); IFIT3 (rabbit polyclonal, Bethyl); p-eIF2α (rabbit monoclonal, ab32157, Abcam); p-PKR (rabbit polyclonal, Thr451, ThermoFisher); PKR (mouse monoclonal, MAB1980-SP, R&D Systems); eIF2α (rabbit monoclonal, D7D3, Cell Signaling); β-actin (mouse monoclonal, A5441, Sigma). Antibodies were used at 1:500–1:1000 dilution for all applications.
Analysis of human tissue samples
Human spinal cord paraffin sections from a panel of clinically and histopathologically characterised ALS cases and neurologically healthy individuals were obtained from the Sheffield Brain Tissue Bank and MRC London Neurodegenerative Diseases Brain Bank (Institute of Psychiatry, King’s College London). Consent was obtained from all subjects for autopsy, histopathological assessment and research were performed in accordance with local and national Ethics Committee approved donation. Human spinal cord sections were 7 μm thick. For conventional RNA-FISH, slides were boiled in citrate buffer for 10 min, washed in 2xSSC prepared with DEPC-treated water and incubated with NEAT1 probe (Stellaris® FISH Probes against human NEAT1 5′ segment, Biosearch Technologies) diluted in hybridisation buffer (10% formamide/2xSSC, 5 μl probe in 200 μl buffer per slide under a 24 × 60 mm coverslip) in a humidified chamber at 37 °C overnight. Nuclei were co-stained with DAPI. Paraspeckles were analysed using BX61 microscope/F-View II camera (Olympus) at 100× magnification. For RNAscope® ISH analysis, Hs-NEAT1-long (411541) probe (Advanced Cell Diagnostics) was used according to manufacturer’s instructions. For qRT-PCR analysis, total RNA was extracted from thick frozen spinal cord sections and cDNA prepared using Ready-To-Go You-Prime First-Strand Beads (GE Healthcare). For laser capture microdissection (LCM), frozen spinal cord sections (total of 5 sections per patient/case) were cut into 5–10 μm thin sections using a cryostat, mounted on glass slides and fixed in cold acetone for 3 min. Sections were stained using toluidine blue, dehydrated in ascending alcohol series for 30 s and placed in xylene for 1 min. The PixCell® II Microdissection system (Applied Biosystems) was used for LCM. Motor neurons from the anterior grey horn were laser captured (300–500 or 30–80 per patient for healthy controls and ALS cases respectively), with the Macro-LCM cap films peeled and placed in test tubes with 50 μl extraction buffer (Pico Pure® RNA Isolation Kit; Thermo Fisher Scientific) on ice. The extracted films were incubated at 42 °C with the extraction buffer for 30 min and frozen at -80 °C until RNA extraction. Total RNA purification was performed using the above kit as per manufacturer’s instructions. RNA samples were analysed using the Agilent RNA 6000 Pico Kit (Agilent Technologies®) and used for qRT-PCR.
Statististical analysis
GraphPad Prism software was used for statistical analysis. Statistical test used in each case is indicated in the figure legend. N indicates the number of biological replicates. On all graphs, error bars represent SEM.
Discussion
Nuclear bodies spatially organize and modulate various cellular processes [
54]. Therefore it is not surprising that these membraneless organelles and their components have been implicated in multiple human diseases. Prominent examples are PML bodies and Gems linked to carcinogenesis and motor neuron degeneration, respectively [
55,
56]. Paraspeckles have recently come into the limelight in the ALS field because of the extensive involvement of paraspeckle proteins in ALS pathogenesis. In the present study, we found that paraspeckle assembly in the spinal cord is shared by ALS cases with different aetiology and, as such, a hallmark of the disease. Using cell models, we identified two possible mechanisms which may initiate paraspeckle assembly in the spinal cord cells of the majority of ALS cases – compromised miRNA biogenesis and activated dsRNA response – both downstream of loss of TDP-43 function.
In the CNS, miRNAs are highly abundant and are subject to abnormal regulation in many neurodegenerative diseases, including ALS [
57‐
61]. Levels of mature miRNAs in ALS spinal cord were reported to be globally reduced [
52,
57,
62]. This dysregulation is consistent with TDP-43 loss of function in the majority of ALS cases since this protein is a known miRNA biogenesis factor [
32]. An important role of paraspeckles in miRNA processing is supported by two recent studies [
16,
63]. Thus, paraspeckle hyper-assembly in ALS motor neurons affected by TDP-43 loss of function may serve as one of the mechanisms to compensate for miRNA biogenesis deficiency. We also show that not only compromised function of the miRNA pathway but also its pharmacological enhancement results in paraspeckle hyper-assembly. This suggests that paraspeckles can respond to bi-directional changes in the activity of the miRNA pathway to either compensate for its compromised function or to meet the demand for miRNA precursors when its final step is over-active.
Another function of TDP-43 is acting as a chaperone to control RNA secondary structure [
38] and therefore cellular dsRNA response. Paraspeckles are known to respond to exogenous dsRNA (viral and its analogues) [
14], and here we show that abnormal accumulation of endogenous dsRNA can also initiate paraspeckle response. Given a significant crosstalk between miRNA and dsRNA response pathways [
64], it is not surprising that paraspeckles function as a regulatory platform for both pathways. Although dsRNA response triggered by dysfunction of the miRNA pathway factors is mediated via different molecular sensors, including TLR3 (for Drosha, our unpublished observations), MyD88 (for Dicer) [
65] and MDA5/RIG-I (for ADAR1) [
66], it eventually converges on type I IFN. In contrast to the previous study [
14], we found that IFNbeta treatment alone can stimulate NEAT1 expression and paraspeckle formation. This discrepancy is likely due to the transient effect of IFN treatment on paraspeckles which peaks at the 4-h time-point, whereas in the previous work, the 24 h time-point was examined. It is possible that IFN levels oscillate to maintain the dsRNA response active but at the same time preserve cellular viability [
67]. Our in vitro data are consistent with a recent in vivo study demonstrating that TDP-43 knockdown in the adult murine nervous system leads to widespread upregulation of immune and, more specifically, antiviral genes [
27]. Loss of TDP-43 function in the nervous system might be sufficient to trigger a chronic neuroinflammatory response.
In a previous study, siRNA-mediated TDP-43 knockdown led to decreased paraspeckle numbers in HeLa cells [
8]. One possible explanation for this discrepancy is differences in cellular response to dsRNA and/or differences in the miRNA pathway regulation between the cell lines. Indeed, in the study on TDP-43 functions as an RNA chaperone, dsRNA was shown to be accumulated only in the nucleus of HeLa cells, whereas in neuroblastoma M17 cell line it was mainly cytoplasmic [
38], similar to our study. Another possibility is the reliance of paraspeckle assembly on some TDP-43 function(s) specifically in HeLa cells.
Loss of TDP-43 function can explain paraspeckle hyper-assembly in the majority of ALS cases, i.e. almost all sALS cases as well as fALS cases caused by mutations in
TARDBP and
C9ORF72 genes. Recently, Drosha has been identified as a component of C9orf72 dipeptide inclusions in patient’s neurons [
68]. Therefore in fALS-C9 cases, loss of function for both TDP-43 and Drosha can jointly contribute to paraspeckle response. In a subset of sALS patients, activation of an endogenous retrovirus (ERV), HERV-K, was reported [
69]. Elevated expression of ERVs can initiate dsRNA response [
70,
71]. Activation of HERV-K may therefore contribute to paraspeckle hyper-assembly at least in some sALS cases. It still remains to be established whether paraspeckle formation is typical for other fALS cases such as those caused by mutations in genes encoding SOD1, FUS, TBK1 or OPTN and, if so, the underlying mechanisms. Many of ALS proteins function in miRNA and dsRNA metabolism, for example FUS is involved in miRNA biogenesis and miRNA-mediated silencing [
35,
72], whereas TBK1 is one of the central factors in dsRNA response and type I IFN signaling. Thus compromised function of these pathways may represent a common mechanism behind paraspeckle response in different ALS cases.
Previously, paraspeckles were shown to be protective against cell death caused by proteasomal inhibition [
13]. In current study, we show that paraspeckles confer protection to cells with compromised metabolism of miRNA and activated dsRNA response. Intriguingly, many of miRNA-controlled cytotoxicity-associated ISGs [
48] were also reported to be regulated by paraspeckles either by sequestration of transcription factors or by nuclear retention of edited RNAs [
14,
49,
73] suggesting a multi-layered control of cellular toxicity by paraspeckles. It should be noted however that the effect of paraspeckle disruption on survival in stable cell lines was small both in this and in the previous [
13] report, despite the use of cells completely lacking NEAT1 and hence paraspeckles in the latter study. Such limited effect is in line with the fact that NEAT1 knockout mice do not have an overt phenotype [
21] and further supports a modulatory role for paraspeckles in cellular responses (such as miRNA biogenesis, gene expression, RNA retention) which only becomes relevant under stressful/pathophysiological conditions. However, such modulatory activities of paraspeckles might be particularly important for neurons coping with neurodegeneration-inducing stresses.