Background
Bladder cancer is one of the most frequent malignancies in the world which includes several types of malignancy arising from the epithelial lining of the urinary bladder. Chromosomal anomalies, genetic polymorphisms, genetic and epigenetic alterations have been reported to be included in the tumorigenesis and progression of bladder cancer [
1]. Recently, the applications of microRNAs (miRNAs) as potential biomarkers and therapy targets have been widely investigated in many kinds of cancers.
MiRNAs are endogenous small non-coding RNA molecules functioning in transcriptional and post-transcriptional regulation of gene expression. Recent studies have documented that miRNAs act as oncogenes or tumor suppressors in a variety types of cancer, such as lung, breast, hepatic, and pancreatic cancer [
2]–[
7]. Currently, the aberrant expression of miRNAs has been observed in bladder cancer and several miRNAs have been reported to play important roles in bladder cancer tumorigenesis and progression. For example, miR-582-5p and miR-582-3p are decreased in high-grade bladder cancer clinical samples, and synthetic miR-582 molecule can suppress bladder tumor growth and metastasis in animal model [
8]. miR-125b was reported to suppress bladder cancer development by down-regulating oncogene SIRT7 and oncogenic long noncoding RNA MALAT1 [
9]. Down-regulation of miR-99a/100 in bladder cancer tissues and their tumor suppressor roles in bladder cancer cells was also reported [
10]. In addition, some preliminary experiments suggested that miR-23b, miR-16, miR-124-3p and miR-26a might function as tumor suppressors in bladder cancer [
11]–[
14]. Meanwhile, miR-21 was reported to be up-regulated in high-grade bladder cancer and can suppress p53 function [
10]. Several oncogenic miRNAs including miR-144, miR-10b, miR-200c and so on were reported to be involved in bladder cancer progression [
15],[
16]. However, the aberrant expression of miRNAs in numbers of bladder cancer patients and their intensive roles and mechanisms in bladder cancer are poorly understood.
miR-19a/b are recognized to be the most important miRNAs in the oncomiRs—miR-17-92 cluster. miR-19a/b has been reported to be deregulated in many kinds of cancers including acute myeloid leukemia, colorectal cancer and gastric cancer, and might promote tumor growth and metastasis [
17],[
18]. High serum levels of miR-19a are also associated with poor outcome in metastatic inflammatory breast cancer [
19]. The up-regulation of miR-19a in baldder cancer has been reported by deep sequencing in nine bladder urothelial carcinoma patients [
20]. However, the expression pattern and the exact role of miR-19a in bladder cancer have not been elucidated.
In this study, we used Taqman probe stem-loop real-time PCR to accurately measure the levels of miR-19a in 100 pairs of bladder cancer tissues and the adjacent non-neoplastic tissues. We found that miR-19a was significantly up-regulated in bladder cancer tissues. Enforced expression of miR-19a can promote the proliferation of bladder cancer cells, whereas repression of endogenous miR-19a led to the suppression of cell growth of bladder cancer cells. In addition, we improved that miR-19a acted its oncogenic role in bladder cancer partially through targeting PTEN. Furthermore, investigation of miR-19a expression in the plasma of bladder cancer patients showed that miR-19a was also increased in plasma of bladder cancer patients which strongly supported miR-19a could be developed as potential diagnostic marker of bladder cancer.
Methods
Cell culture and transfections
The human bladder cancer cell lines (J82, HT1376, RT4, T24 and TCCSUP) and immortalized human bladder epithelium (HCV29 and HU609) cells were propagated in DMEM (Invitrogen) supplemented with 10% FCS at 37°C in 5% CO2 cell culture incubator. miR-19a mimics, inhibitors and scramble control were obtained from Dharmacon and transfected with DharmFECT1 (Dharmacon) at a final concentration of 50 nM. The plasmid expressing PTEN was obtained from Origene (SC119965) and co-transfected with miR-19a mimics at 2 μg/ml.
Patients and specimens
The human clinical samples were collected from surgical specimens from 100 patients with bladder cancer at Suining Central Hospital. The corresponding adjacent non-neoplastic tissues from the macroscopic tumor margin were isolated at the same time and used as controls. All samples were immediately snapped frozen in liquid nitrogen and stored at −80°C until RNA extraction.
Whole blood samples were prospectively collected from bladder cancer patients and control patients without urologic malignancies. Whole blood (5–8 ml) was collected in an ethylene diamine tetracetic acid (EDTA) tube. The sample was centrifuged twice at 4°C. Plasma (supernatant after second centrifugation) was then stored at −80°C. The Clinical Research Ethics Committee of Suining Central Hospital approved the research protocols and written informed consent was obtained from the participants.
Total RNA was extracted from tissues and cells using Trizol reagent (Invitrogen, CA, USA) according to the manufacturer’s instructions. Total RNA of plasma was isolated using a commercially available kit (mirVana; miRNA Isolation Kit, Applied Biosystems, Carlsbad, CA) according to the manufacturer’s protocol. RNA was quantified and cDNA was synthesized by M-MLV reverse transcriptase (Invitrogen) from 2 μg of total RNA. A stem-loop RT primer was used for the reverse transcription. Quantitative RT-PCR was performed in a Bio-Rad CFX96 real-time PCR System (Bio-Rad, CA, USA) using TaqMan probes (Applied Biosystems, Foster City, CA, USA) according to the manufacturer’ s instructions. The PCR conditions were as follows: 95°C for 30 s, followed by 40 cycles of 95°C for 5 s and 60°C for 34 s. The data were normalized using the endogenous U6 snRNA. The 2-ΔΔCT method was used in the analysis of PCR data. Primer sequences are presented in Table
1.
Table 1
Sequence of primers used in qRT-PCR
miR-19a-RT | GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTCAGTTT |
miR-19a-forward | CTGGAGTGTGCAAATCTATGC |
miR-19a-reverse | GTGCAGGGTCCGAGGT |
miR-19a-probe | FAM-CTGGATACGACTCAGTTT-MGB |
U6-RT | AAAATATGGAACGCTTCACGAATTTG |
U6-forward | CTCGCTTCGGCAGCACATATACT |
U6-reverse | ACGCTTCACGAATTTGCGTGTC |
U6-probe | FAM-CCATGCTAATCTTCTCTGTA-MGB |
Cell proliferation assay and colony formation assay
To measure the effect of miRNA mimics or FSCN1 siRNA on cell proliferation, cells were incubated in 10% CCK-8 (DOJINDO) diluted in normal culture media at 37°C until visual color conversion appears. Proliferation rates were determined at day 1, 2, 3, 4 post-transfection, and quantification was done on a microtiter plate reader (Spectra Rainbow, Tecan) according to the manufacturer's protocol. Meanwhile, the mimic-transfected cells were trypsinized and replated at 200 cells per well in 6-well plates, cultured for 7 days, then fixed with methanol and stained with 0.1% crystal violet in 20% methanol for 15 min.
Western blotting
Whole-cell lysate or nuclear extract was subjected to Western blot analysis as described previously [
21]. The following antibodies were used for Western blot: GAPDH (10494-1-AP, Proteintech), PTEN (22034-1-AP, Proteintech).
Statistics
The statistical analyses for miR-19a expression in clinical samples, correlation of miR-19a expression with patients’ clinicopathological variables were conducted using the Bonferroni multiple-comparison test. The other statistical analyses were evaluated by independent samples T test (two-tailed). P ≤ 0.05 was considered statistically significant.
Discussion
The up-regulated expression of miR-17–92 cluster has been reported in a variety of cancers including multiple myeloma, leukemia, colorectal cancer and breast cancer [
22]–[
24]. The miRNA cluster produces a single primary transcript yielding the six mature miRNAs: miR-17, miR-18a, miR-19a, miR-20a, miR-19b, and miR-92a. miR-19 has been identified as the key member responsible for the oncogenic activity [
25],[
26]. However, the role of miR-19 in bladder cancer remains unknown. In this study, we investigated the expression of miR-19a in a great deal of patients with bladder cancer and dissected the roles and mechanisms of miR-19a in bladder cancer carcinogenesis. We found that miR-19a was significantly up-regulated in bladder cancer tissues and the high expression of miR-19a was associated with the more aggressive phenotypes of bladder cancer. Gain or loss of function of miR-19a in bladder cancer cells also indicated that miR-19a can promote cell growth which was consistent with its role in other cancer types. The important role of miR-19a in regulating bladder cancer cell invasion, migration and
in vivo carcinogenesis needs to be further confirmed. In case anti-miRs of miR-19a can suppress tumor growth
in vivo significantly, miR-19a can be further developed as new target for bladder cancer therapy as miRNAs has advantages of being small and easy to delivery, safer than other gene therapy methods [
27],[
28].
To further dissect the mechanism by which miR-19a functioned as an oncogenic miRNA in bladder cancer, we analyzed the relationship of miR-19a and PTEN in bladder cancer and found that the regulatory role of miR-19a in bladder cancer cells was dependent on targeting PTEN. PTEN is identified as a tumor suppressor that is mutated in a large number of cancers at high frequency. It negatively regulates intracellular levels of phosphatidylinositol-3,4,5-trisphosphate in cells and functions as a tumor suppressor by negatively regulating AKT/PKB signaling pathway [
29]–[
31]. AKT/PKB signaling pathways answer to growth factors and other extracellular stimuli to regulate several cellular functions including nutrient metabolism, cell growth, apoptosis and survival. miR-19a may repress the expression of PTEN which further lead to the unlimited cell proliferation of bladder cancer cells. The correlation of expression level of miR-19a and PTEN in patients with bladder cancer will be investigated further to confirm that PTEN was a direct target of miR-19a in bladder cancer.
Earlier studies discovered that extracellular miRNAs circulated in the bloodstream and the circulating miRNAs were remarkably stable. Detection of elevated levels of tumor associated miRNAs in serum of patients with diffuse large B-cell lymphoma [
32] leads to widely investigation of circulating miRNAs in many human cancers, including breast cancer [
33], lung cancer [
34], prostate cancer [
35], and renal cell carcinoma [
36] and so on. The expression profile of miRNAs in serum/plasma of the patients with bladder cancer was also investigated and some important circulating miRNAs in bladder cancer had been identified [
37],[
38]. These studies support the use of serum/plasma miRNAs as noninvasive means of bladder cancer detection. Serum miR-19a expression has been reported to correlate with worse prognosis of patients with non-small cell lung cancer [
39]. We detected the level of miR-19a in plasma of patients with bladder cancer and found that miR-19a was also increased which was consistent with its high level in the cancer tissues. The up-regulation of miR-19a in the plasma might origin from the tumor cells which needs to be improved further. MiRNAs can be detected easily in small amount samples and are stable against degradation and can be detectable in bodily fluids including serum, plasma, saliva, urine and tears [
40],[
41]. The innate properties of miRNAs make them attractive as potential biomarkers. So miR-19a can be developed as a new diagnostic marker for bladder cancer detection. Further analysis of the correlation of miR-19a expression level with clinical outcome will offer important information about the relationship of miR-19a levels with the clinical diagnosis, therapy and outcome, which will be useful for individualized therapies. In consideration of the possible secretion of miR-19a from the tumor cells to the plasma, the level of miR-19a in urine samples of the patients will be examined. Voided urine can be noninvasively obtained, be designed not only for diagnosis, but also for monitoring disease recurrence and response to therapy [
42],[
43]. So development of miR-19a as a novel urinary biomarker for bladder cancer will be urgently required for early detection of cancer and individualized therapies.
Conclusion
In summary, we determined the high expression of miR-19a in the cancer tissues and plasma of patients with bladder cancer and also indicated the oncogenic roles of miR19a in bladder cancer which was dependent on targeting PTEN. Our data provided the potential diagnostic and therapeutic roles of miR-19a in bladder cancer firstly.
This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (
http://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (
http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.
Competing interests
The authors declare no competing financial interests.
Authors’ contributions
Y-GF conceived the project; designed the experiments and carried out the majority of the experiments; JL conducted the bioinformatics analysis; Y-MK, YH and BL helped to collect clinical samples. PY and ZY helped to culture cells; all authors discussed the results; Y-GF and JL wrote the manuscript. All authors read and approved the final manuscript.