Background
Acute respiratory distress syndrome (ARDS), an acute inflammatory pulmonary process, causes intense and diffuse alveolar architecture damage and the development of interstitial and alveolar protein-rich edema, leading to acute hypoxemic respiratory failure [
1,
2]. In ARDS, the alveolar epithelium is the primary target where cell damage occurs. The degree of alveolar epithelial damage can predict the outcome of ARDS [
3,
4]. Consequently, the repair of the alveolar epithelium plays a crucial role in the resolution of ARDS [
4]. Recent literatures have demonstrated that apoptosis of alveolar epithelial cells contributed to the loss of alveolar epithelial cells and the development of ARDS [
5‐
7]. Inhibiting apoptosis has been shown to attenuate lung injury in animal models [
6].
Epithelial-mesenchymal transition (EMT) is the process in which epithelial cells differentiate into mesenchymal (fibroblast-like) cells expressing mesenchymal biomarkers such as α-Smooth muscle actin (α-SMA), and N-cadherin [
8]. The EMT was associated with lung injury and could lead to the prognosis of ARDS [
9]. Furthermore, inflammation stimulated by HCL can also lead to EMT in HCL-induced ARDS models [
10,
11]. Another study demonstrated that trichostatin A attenuated ventilation augmented-EMT playing a role in the reparative phase of ARDS [
12]. Both EMT and apoptosis of the alveolar epithelium are crucial for the progression of ARDS.
Lipoxins (LXs), as so-called “braking signals” of inflammation, are endogenous lipid mediators derived from arachidonic acid [
13]. They were the first mediators identified to have dual anti-inflammatory and inflammatory pro-resolving properties [
14]. Lipoxin A4 (LXA4) was shown to inhibit neutrophil and eosinophil recruitment [
15], promote macrophage clearance of apoptotic neutrophils [
16], and increase survival in a rat CLP model [
17]. Our previous studies showed that LXA4 inhibited inflammation following inhaled LPS-induced lung injury [
18]. LXA4 increased alveolar fluid clearance in rat lung injury model [
19], and LXA4 promoted alveolar epithelial repair by stimulating epithelial cell wound repair, proliferation, and reducing apoptosis in vitro [
20].
The alveolar epithelial cells may either undergo apoptosis or EMT in ARDS. In this study, we aimed to investigate whether LXA4 could promote type II alveolar lung epithelial cells proliferation, whilst inhibiting apoptosis in vivo and in vitro. Furthermore, we also investigated if LXA4 inhibited EMT in vivo and reduced TGF-β1 induced EMT in human primary type II alveolar epithelial cells.
Materials and methods
Materials
LXA4 and LY294002 (PI3K inhibitor) were obtained from Cayman Chemical Company (Ann Arbor, MI, USA). LPS (Escherichia coli serotype 055: B5), Sis3 (smad3 inhibitor) and SP-C antibody were purchased from Sigma (St Louis, MO, USA), BOC-2 (N-t- BOC-PHE-LEU-PHE-LEU-PHE; Gene Script USA Inc., Piscataway, NJ, USA) and BML-111 (Enzo Life Sciences, NY, United States) were purchased from Shang Hai Bo Yun. Antibody against anti-alpha smooth muscle actin (α-SMA) antibody, Vimentin and the secondary antibodies were obtained from Abcam Company (Cambridge, UK). Antibodies against E-cadherin and N-cadherin were from Cell Signaling Technology Company (Boston, USA). Recombinant Human TGF-β1 (HEK293 derived) was purchased from Peprotech Company (Rocky Hill, USA). DMEM and FBS were purchased from Life Technologies BRL (Grand Island, NY). Protein levels were determined using a Bicinchoninic acid kit (Thermo Scientific).
Primary human lung alveolar type II (HAT II) cell culture
Human alveolar type II (HAT II) cells were isolated from lungs of grossly normal appearance after lung tumor resection. The cells were isolated in accordance with approval from the local research ethics committees at the University of Wenzhou Medical University (Wen Zhou, China). Primary human AT II cells were extracted according to the methods described previously (see online supplement) [
20].
Stimuli and inhibitors
HAT II cells were treated with LXA4 (0, 0.1, 1, 10, 100 nM, Cayman Chemical Company, USA) with or without LPS (1 μg/ml, Escherichia coli serotype 055:B5). Appropriate vehicle controls were used for all experiments with inhibitors. Inhibitors were used at the following concentrations according to manufacturers’ instructions: LY294002, a PI3-kinase inhibitor (Calbiochem, Nottingham, UK); Sis3 (smad3 inhibitor), Boc-2 (N-t-Boc-Phe-Leu-Phe-Leu-Phe; GenScript USA Inc., the ALXR antagonist) and BML-111(Enzo Life Sciences, NY, United States, the ALXR agonist), all at 10 μM. Inhibitors were added to cells 30 min before every treatment.
Animal model of ALI/ARDS
C57BL/6 J mice at 6–8 weeks of age were purchased from the Shanghai SLAC Laboratory Animal Co. Ltd. The animals were acclimatized for 7 days prior to experimental use. Mice were caged with free access to food and fresh water in a temperature-controlled room (22–24 °C) on a 12-h light/dark cycle. Mice (male; ethics code: 2015048) were randomized into 5 groups of 6 mice per group: control group, LPS group (24 h, 48 h, 72 h), LPS + LXA4 group. For the induction of ARDS, mice were anaesthetised and instilled by intra-tracheal (IT) route as a model of direct lung injury with LPS (10 mg/kg dissolved in 30ul N.S) for 24 h, 48 h or 72 h. No treatment control mice were anaesthetised and instilled by intra-tracheal (IT) route with physiological saline. In LPS + LXA4 group, LXA4 was administrated by intraperitoneal injection at 1 μg/per mouse 10 min after intra-tracheal (IT) LPS administration. Mice were subsequently sacrificed by using cervical dislocation, lungs were removed and washed with sterile PBS and stored in 4% paraformaldehyde for HE and immunofluorescence, or at − 80 °C for Western blot, in tube for wet/dry ratio.
Immunofluorescence
Lung tissue were fixed and stained as the method described in the online Supplementary Information.
Quantitative real-time PCR and reverse transcriptase-PCR
Total RNA samples in HAT II cells were isolated using TRIzol reagent (Invitrogen, Carlsbad, California, USA) according to the manufacturer’s protocol. The cDNA of mRNA was synthesized using the reverse transcription kit (Bio-Rad, USA). The expression of mRNA was detected using SYBR green super-mix PCR kit (Bio-Rad) by qPCR (ABI7500, Applied Biosystems). The gene-specific primers used are listed in Table
1 and mRNA normalized to GAPDH, was calculated using the 2
-ΔΔCt method.
Table 1
Real-time PCR templates and primers used for gene manipulation
SNAIL | CCTCTCACTGGGTCTTCTGG | GGTCTTCTTCCGCTCCTCTC |
AQP5 | GCTGCCATCCTTTACTTCTACC | GGTCTTCTTCCGCTCTTCC |
FIBRONECTIN | CCAAGCAGGAGTCAAACGAG | TCTTCCATCTCACGCATCTG |
α-SMA | CCGACCGAATGCAGAAGGA | ACAGAGTATTTGCGCTCCGAA |
CDH1 | GGTCTCTCTCACCACCTCCA | CCTCGGACACTTCCACTCTC |
CDH2 | CGTGAAGGTTTGCCAGTGT | CAGCACAAGGATAAGCAGGA |
SP-C | CCTTCTTATCGTGGTGGTGGT | TCTCCGTGTGTTTCTGGCTCAT |
GAPDH | GACAACAGCCTCAAGATCATCAG | ATGGCATGGACTGTGGTCATGAG |
Protein extraction and Western blot analysis
Cells or lung sections were washed in ice-cold PBS and harvested using RIPA buffer supplemented with protease inhibitors. The resulting supernatant fraction was homogenized in 1x SDS–PAGE sample buffer and boiled for 5 min at 99 °C. For the immunoblotting, protein lysates were electrophoresed via 10% SDS-PAGE gel and then transferred to to polyvinylidene difloride membranes. Membranes were blocked and incubated with the indicated primary antibody (Ab) overnight at 4 °C. Bound primary Abs were incubated with appropriate secondary Abs for 1 h. The proteins were detected using chemiluminescence reagents (Thermo Scientific). Images were scanned with a UVP imaging system and analyzed using an Image Quant LAS 4000 mini system (GE Healthcare Bio-Sciences AB, Uppsala, Sweden).
Flow cytometry (FCM)
Apoptosis of HAT II cells was assessed using flow cytometry. HAT II cells were left in serum free media for 24 h before exposure to LPS (1 μg/ml) with or without LXA4100nM for 24 h. After treatment with LPS and LXA4, HAT II cells were harvested and suspended in the binding buffer supplied in the Annexin V-FITC/Propidium iodide (PI) Apoptosis Detection Kit, and were then stained with Annexin V-FITC and Propidium iodide (PI) according to the manufacturer’s instruction (BD Biosciences, USA). The cytometric data were analyzed with FlowJo software.
Blinding method
The present study adopted randomized, blinded methods. The randomization list of animals was computer-generated by the statistician using SAS/STAT software.
Statistical analysis
Data are presented as mean ± SD or mean ± SEM. All data were analyzed using one-way ANOVA, followed by a Tukey test for post hoc comparisons. P < 0.05 was considered significant. Statistical analyses were performed using Prism 6.0 software (Graph Pad Software, San Diego, CA).
Discussion
Our study demonstrated that LXA4 alleviated lung injury via promoting type II alveolar lung epithelial cell proliferation, whilst inhibiting apoptosis and decreasing caspase-3 activation in an intratracheal LPS murine model of ALI/ARDS. In vitro, LXA4 reduced AT II cell apoptosis and promoted AT II cell proliferation induced by LPS. We also showed that LXA4 inhibited EMT in vivo and reduced TGF-β1 induced EMT in human primary type II alveolar epithelial cells. Furthermore, treatment with LXA4 receptor antagonist, Smad2/3 inhibitor and PI3K/AKT inhibitor abolished the inhibitory effect of LXA4 on the EMT in AT II cells, indicating that LXA4 can inhibit TGF-β1-induced EMT in primary AT II cells through the SMAD, PI3K/AKT signaling pathways and activation of LXA4 receptor (ALX).
The epithelial cell is a main target in the development of ALI/ARDS [
21]. Injury of the alveolar epithelial cells (AT II cells) are acknowledged as critical hallmark of ARDS [
22]. Timely repair of AT II cells is critical for restoration of lung function in ARDS. Inappropriate repair, such as EMT, can lead to disrupted barrier function and promote fibrogenesis [
21]. Many studies reported that LXA4 exerts a protective effect on ALI in mice and on the airway epithelial cells [
18,
23,
24]. Our previous study also showed that LXA4 alleviated inflammation and pulmonary permeability [
18]. In order to investigate the potential mechanism of LXA4 in promoting resolution of ARDS, we previously demonstrated that LXA4 promoted lung epithelial repair and inhibited sFasL induced AT II cell apoptosis in vitro. In the present study we used an animal model of LPS-induced lung injury to confirm the previous results. We found that intratracheal instillation of LPS inhibited the proliferation of AT II cells and increased apoptosis of these cells. However, LXA4 restored the function of the epithelial barriers by reversing the inhibition of LPS on AT II cell proliferation and reducing apoptosis of AT II cells induced by LPS. In addition, LXA4 promoted primary AT II cell proliferation and reduced apoptosis induced by LPS [
25,
26].
As a central role in the execution of the apoptotic program, caspase-3 is primarily responsible for the cleavage of poly (ADP-ribose) polymerase (PARP) during apoptosis [
27,
28]. In our study, treatment with LPS in mice significantly increased TUNEL-positive AT II cells and cleaved caspase-3 expression in the lung tissue. However, LXA4 reduced LPS-stimulated cleaved caspase-3 expression and TUNEL-positive AT II cells at 24 h in lung tissue, indicating its anti-apoptotic effects in this murine model of lung injury.
Previous evidence in animal models of ARDS showed that pulmonary edema can happen only after the impairment of epithelium function [
5,
29,
30]. Injury to the AT II cells activates apoptotic markers such as caspases-3, while some of the AT II cells undergo EMT which includes loss of their epithelial morphology as well as epithelial biomarkers and acquisition of a mesenchymal (fibroblast-like) cell phenotype [
30‐
33]. Inflammation, which is one of the primary causes of ARDS, also results in EMT [
33]. LPS was shown to induce EMT [
32], while LXA4 could suppress EMT in proximal tubular epithelial cells, pancreatic cancer cells and hepatocarcinoma cells [
34‐
36]. In our study, LPS induced EMT in a time dependent manner. We also demonstrated that LXA4 stimulated the expression of E-cadherin while inhibiting the expressions of mesenchymal cell markers including N-cadherin, vimentin and α-SMA in LPS induced lung injury. Furthermore, we also showed that AT II cells expressed more mesenchymal biomarkers (α-SMA), which was inhibited by treatment with LXA4 in the lung tissue. These data indicate that targeting the anti-EMT actions of LXA4 may be a therapeutic strategy for treating ARDS.
To confirm the result that LXA4 suppressed EMT in lung tissue, we investigated the effect of LXA4 on EMT in vitro. We showed that TGF-β
1 induced EMT in primary human lung alveolar type II (HAT II) cells, while LXA4 inhibited TGF-β
1 induced EMT in a concentration-dependent manner. In addition, LXA4 exerts its pro-resolving action through ALX (lipoxin receptor) [
37]. In the present study, BOC-2 (ALX antagonist) reversed LXA4-suppressed EMT. Interestingly, BML-111(lipoxin receptor agonist), which was used in this study, promoted the effects of LXA4 on TGF-β
1-induced EMT in primary human AT II cells. These data imply that LXA4 may act via activation of ALX.
Various studies have demonstrated underlying mechanisms involved in TGF-β
1 induced EMT including the Smad signaling pathway and the PI3K/Akt signaling pathway [
38,
39]. Our study suggests that inhibition of Smad3 and PI3K abolished the inhibitory effects of LXA4 on EMT in AT II cells, indicating that LXA4 inhibits EMT via the Smad and the PI3K/Akt signaling pathways. Indeed, in our study, LXA4 downregulated the phosphorylation of AKT and Smad induced by TGF-β
1 in AT II cells.
Conclusion
In conclusion, we have shown that LXA4 attenuates lung injury via stimulating epithelial cell proliferation, reducing epithelial cell apoptosis and inhibits EMT. In addition, LXA4 suppressed TGF-β1 induced EMT through the SMAD, PI3K/AKT signaling pathways and activation of LXA4 receptor (ALX). Our findings provide the evidence that targeting the pro-proliferaory, anti-apoptotic and anti-EMT actions of LXA4 may be a potential approach in developing an effective strategy for the treatment of ARDS. Further experiments are necessary to understand the basic mechanism underlying the anti-apoptotic effects of LXA4.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.