Background
Lung cancer (LC) has become the first leading cause of cancer-associated mortality worldwide [
1]. LC can be divided into small-cell lung cancer (SCLC) or non-small cell lung cancer (NSCLC), and the main histologic types of NSCLC are squamous cell carcinoma and adenocarcinoma [
2]. Molecular-targeted therapies have been widely used in cancer treatment [
3,
4]. However, due to lack of a comprehensive understanding for cancer progression, available molecular targets are currently limited.
Long non-coding RNAs (LncRNAs) are a class of RNA transcripts with more than 200 nt in length, and do not encode proteins [
5]. Study showed that lncRNAs are potential pathway-regulators during cancer development [
6]. Compared with normal tissues, large-scale RNA sequencings have demonstrated that several lncRNAs are dysregulated in tumor tissues [
7], including in laryngeal squamous cell carcinoma [
8], colorectal cancers [
9], and hepatocellular carcinoma, via regulating the expressions of miRNAs [
10] [
11]. In addition, lncRNAs are also potential prognostic markers for patients with cancer such as gastric cancer [
12]. A systematic review and meta-analysis show that multiple lncRNAs are strongly associated with prognosis of some cancers [
13]. High expression of lncRNA SChLAP1 is a significant prognostic maker predictive of metastatic progression of prostate cancer [
14]. Taken together, lncRNAs play key roles in cancer progression and should be further investigated.
In LC, lncRNAs are involved in cell growth, apoptosis and metastasis at epigenetic, transcriptional, or post-transcriptional levels [
15]. Study found that LINC00261 is a crucial tumor suppressor in various malignant tumors, including in colon cancer [
16], choriocarcinoma [
17] and endometrial carcinoma [
18]. LINC00261 also suppresses growth and metastasis via suppressing epithelial-mesenchymal transition (EMT) and Wnt signaling in non-small cell lung cancer [
19,
20]. However, the role of LINC00261 and its molecular mechanism in LC are not fully understood.
The current study aimed to explore the expression and prognostic value of LINC00261, and focused on the role and potential molecular mechanism of LINC00261 in LC, hoping to provide a new potential therapeutic target for LC treatment.
Methods
LC and adjacent normal lung tissue samples were obtained from 78 LC patients who received surgical resection between July 2015 and July 2017 in the Henan Provincial Chest Hospital, and all the samples were stored at − 80 °C. This study was approved by the Ethics Committee of Henan Provincial Chest Hospital. The clinical features of all the participants, including gender, age, TNM stage, lymph node metastasis, histological type, distant metastasis and tumor size, were collected from the hospital. The relationships between LINC00261 expression and clinic features in LC patients were shown in Table
1. The relatively high or low expression level of LINC00261 was defined according to the median level of the expression.
Table 1
The relationship between LINC00261 expression levels in cancer tissues and clinical pathological factors of patients with lung cancer
Gender |
Male | 51 | 22 | 29 | 0.463 |
Female | 27 | 14 | 13 |
Age |
< 60 | 34 | 16 | 18 | 0.888 |
≥ 60 | 44 | 20 | 24 |
TNM stage |
I–II | 49 | 27 | 22 | 0.039 |
III–IV | 29 | 9 | 20 |
Lymph node metastasis |
Yes | 28 | 8 | 20 | 0.020 |
No | 50 | 28 | 22 |
Histological type |
SCC | 44 | 20 | 24 | 0.888 |
AD | 34 | 16 | 18 |
Distant metastasis |
Yes | 29 | 9 | 20 | 0.039 |
No | 49 | 27 | 22 |
Tumor size (cm) |
< 3 | 40 | 19 | 21 | 0.807 |
≥ 3 | 38 | 17 | 21 |
Cell culture
The normal human bronchial epithelial cells (BEAS-2B, CBP60577), LC lines (A549 (CBP60084), NCI-H1299 (CBP60053), NCI-H23 (CBP60132), SPC-A1 (CBP60153)) were purchased from Cobioer Co., Ltd. (China). The LC cell line L78 was obtained from Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences. All the cells were cultured in RPMI-1640 medium (61870044, ThermoFisher, USA) containing 10% FBS (16140071, ThermoFisher, USA) at 37 °C with 5% CO2.
RNA isolation and qRT-PCR
Chloroform and isopropanol methods were used to isolate total RNAs from the tissues and cells. NanoDrop 2000 (ND-2000-GL, Thermo Scientific, USA) was used to quantify the RNAs. To determine the levels of LINC00261 and FOXO1, reverse-transcription and qRT-PCR were performed using the PrimeScript™ II 1st Strand cDNA Synthesis Kit (6210B, Takara, Japan), SYBR
® Green PCR Master Mix (4312704, ABI, USA) and Bio-Rad CFX 96 Touch Real-Time PCR Detection System (1855196, Bio-Rad, China). GAPDH served as a reference gene. The loop RT primer sequence was 5′-GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATA-CGACCCAGTAGC-3′, and used for detecting the expression of miR-1269a. U6 snRNA served as an internal reference gene. Parameters for qRT-PCR were as follows: at 95 °C for 5 min, 40 cycles at 95 °C for 15 s, at 60 °C for 30 s, and at 70 °C for 10 s. The relative expression was calculated by 2
−ΔΔCt method. All primers for qRT-PCR were shown in Table
2.
Table 2
The primers used for qRT-PCR
LINC00261 | GTCAGAAGGAAAGGCCGTGA | TGAGCCGAGATGAACAGGTG |
FOXO1 | TCGTCATAATCTGTCCCTACACA | CGGCTTCGGCTCTTAGCAAA |
GAPDH | GCTCTCTGCTCCTCCTGTTC | ACGACCAAATCCGTTGACTC |
miR-1269a | GACTGAGCCGTGCTACTGG | TGTCGTGGAGTCGGCAATTG |
U6 snRNA | CGCAAGGATGACACGCAAAT | CGGCAATTGCACTGGATACG |
Cell transfection
For cell transfections, 100 pmol miR-1269a mimic (miR10005923-1-5, Ribobio, China) was added into Opti-MEM medium (31985062, Thermofisher, USA) containing Lipofectamine 2000 (11668019, Thermofisher, USA) and mixed for 20 min at room temperature. Next, the mixture was added into a 6-well cell culture plate to culture the cells (2 × 105 cells/well) at 37 °C with 5% CO2 for 8 h. Then, the medium was replaced by RPMI-1640 containing 10% FBS. After transfection for 24 h, the cells were used for later detection.
Generation of transgenic cell lines
Full-length cDNAs of LINC00261 and FOXO1 (Tsingke Co., Ltd.) were inserted into pCDH-CMV vector (CD513B-1, System Biosciences, USA) and then infected into 293T cells (CBP60439, Cobioer, China) to produce a lentivirus, which was used to infect A549 and SPC-A1 cells (2 × 105 cells/well) in the 6-well plate. After 72 h, the cells were collected to determine the efficiencies of LINC00261 and FOXO1 overexpression. Cells were selected using 2 µg/mL puromycin starting on day 4 after the virus infection. Following assays were carried out 2 weeks after the infection.
CCK-8 assay
After cell incubation, the cells (3000 cells/well) were seeded into a 96-well plate. 10 µL CCK-8 70-CCK801 (MultiSciences, China) was added into each well for 4 h at 37 °C. Then the absorbance value at 490 nm was detected by the SpectraMax plus 384 Microplate Reader (PLUS 384, Molecular Devices, USA). The medium containing only 10 μL CCK-8 reagent served as the blank control, and each group were set up with 9 parallel wells.
The cells (1 × 102 cells/well) were seeded into a 6-well plate to be cultured for 7 d, and the medium was changed every 3 d. After the culture, the cells were fixed by paraformaldehyde at room temperature for 30 s, stained by 0.1% crystal violet solution (548-62-9, Aladdin, China) at room temperature for 30 min, and washed by PBS twice. Next, the cells were observed under a microscope (TS100, Nikon, Japan). Colony formation number and relative colony formation were calculated from 10 randomly selected fields under a microscope.
Flow cytometry
The cells (2 × 105 cells/well) were grown into a 6-well plate, cultured for 24 h, and then treated by 500 µL Trypsin (25300054, Thermofisher, USA) at 37 °C for 1 min. The cells were collected by centrifuging at 500×g, 4 °C for 5 min.
To determine cell apoptosis, the cells were resuspended in 300 μL Annexin-V kit (70-AP101-100-AVF, MultiSciences, China) binding buffer, and then mixed with 5 μL Annexin-V-FITC solution at RT for 15 min. The nuclei were stained by 5 µL PI for 5 min, and then another 200 μL binding buffer was added into the cells. For cell cycle arrest analysis, the cells were fixed in 70% ethanol at 4 °C overnight and stained by PI/RNase A mixture at 37 °C for 30 min in the dark. Finally, the cell cycle was analyzed by flow cytometer (342973, BD Biosciences, USA). FACSCalibur flow cytometer (342973, BD Biosciences, USA), and BD FACSCanto™ system software v2.4 (646602, BD Biosciences, USA) were used to detect the cell apoptosis and cell cycle.
Wound healing
A wound was created by using a 10 μL pipette tip after the cells were grown to 100% confluence. The cells were then starved and cultured for 48 h. The scratch area was measured from 3 fields in each group under a microscope (TS100, Nikon, Japan) at 0 h and 48 h.
Transwell assay
The cells (2 × 103 cells/well) were seeded in serum-free media contained the upper chamber of transwell plate (3428, Corning, USA) pre-coated with 40 μL Matrigel, while 600 μL normal medium was added into the lower chamber. After incubation for 24 h, the cells invaded from the upper chamber into the lower were fixed by methanol and stained by 0.1% crystal violet (548-62-9, Aladdin, China) at room temperature for 30 min. Then, 10 fields under a microscope were randomly selected to count invaded cells. The experiments were performed in triplicate.
Western blot analysis
Total proteins were isolated from the cells on ice using the lysis buffer (89901, Thermo Scientific, USA), and the protein concentration was measured using the BCA Protein Assay kit (23225, ThermoFisher, USA). The proteins were separated by 10% sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) and then transferred onto a PVDF membrane. The membrane was then blocked by 5% non-fat milk at RT for 10 min, and exposed to the following primary antibodies: Anti-Ki-67 (359 kD, 1:5000, ab92742, Abcam, UK), Anti-PCNA (29kD, 1:1000, ab18197, Abcam, UK), Anti-MMP-3 (54kD, 1:1000, ab53015, Abcam, UK), MMP-9 (95kD, 1:1000, ab73734, Abcam, UK), Anti-GAPDH (36 kD, 1:5000, ab8245, Abcam, UK) at 4 °C for 12 h. Anti-mouse HRP secondary antibody (1:2000, ab6728, Abcam, UK) was incubated with the membrane at RT for 2 h for detection of GAPDH. Anti-rabbit HRP secondary antibody (1:2000, ab97051, Abcam, UK) was used for detection of other proteins. Then, the membrane was treated by chemiluminescence solution (WBKLS0100, Millipore, USA) at room temperature in the dark for 1 min. The signals were finally developed by using SignalFire™ ECL reagent (6883, CST, USA).
Dual-luciferase reporter assay
StarBase (
http://starbase.sysu.edu.cn/) was used to predict the interaction between LINC00261 and miRNA, and the interaction between miR-1269a and its target mRNA was predicted by Targetscan7.2 (
http://www.targetscan.org/vert_72/). Potential binding site of LINC00261 (LINC00261-WT, 5′-CAAGAGGCAATGGTCCCAGTCCAA-3′), mutation sequence (LINC00261-MUT, 5′-CATCATCGATGCCTGCGTCAGGTA-3′), potential binding site of FOXO1 3′UTR (FOXO1-WT, 5′-AGGAACTGAGAGAAGCAGTCCAA-3′) and the mutation sequence (FOXO1-MUT, 5′-AGGAACTGAGAGAAGGTCAGGTA-3′) were inserted into dual-luciferase reporter vector (pmirGLO, E1330, Promega, USA). Those reporter plasmids were then transfected into the cells with miR-1269a mimic. Cells transfected with reporter plasmid only served as controls. After culture for 24 h at 37 °C, the luciferase activity of cells was determined by dual-luciferase assay system (E1910, Promega, USA) and Microplate Luminometer (11300010, Berthold, Germany). The firefly luciferase activity was normalized to that of renilla luciferase activity.
Xenograft Assay
We purchased 12 8-week-old male BALB/C nude mice (weighting 20 g–25 g) from Vitalriver Corporation (China). The mice were kept in the Typical SPF Laboratory Animal room at 23 °C and provided with free access to sterilized food and water. The cells (1 × 106) stably infected by pCDH-CMV empty vector (NC) or pCDH-CMV-LINC00261 were resuspended in PBS/matrigel mixture on ice and then subcutaneously injected into the nude mice (with 6 mice in each group). The tumor volumes were measured at day 5, 10, 15, 20, 25 and 30. Finally, all the mice were sacrificed and the tumors were weighted. Animal experiments were approved by the Institutional Animal Care and Use Committee of Henan Provincial Chest Hospital.
Immunohistochemistry (IHC)
FOXO1 primary antibody (1:500; ab70382; Abcam, UK) was added to the cells at 4 °C overnight. Horseradish peroxidase-labeled anti-rabbit IgG H&L secondary antibody (1:2000; ab205718; Abcam, UK) was then added to the cells and incubated at 37 °C for 30 min. DAB developer (Biyuntian Biotechnology Co., Ltd.) was used to develop the brown-yellow positive color. The tumor sections were counterstained by Hematoxylin for 3 min, differentiated with 1% hydrochloric acid alcohol, made transparent by xylene, and fixed with gum seal. The sections were then observed under a light microscope (Olympus, 100× and 200× Magnification) and photographed.
Data analysis
The statistics were analyzed using Graphpad Prism 5.02 software (La Jolla, CA, USA). The data are shown as mean ± standard deviation. Correlations of LINC00261 expression and clinic pathological characters were analyzed by Pearson’s Chi square test. Kaplan–Meier analysis was performed to plot the overall survival curves. The differences among groups were analyzed by one-way ANOVA, followed by Tukey’s post hoc test. Gene expression differences in LC and adjacent normal lung tissues were analyzed by paired t-test. Spearman’s correlation analysis was performed to evaluate the expression correlations among LINC00261, miR-1269a and FOXO1. P < 0.05 was defined as a significant difference.
Discussion
LC patients develop lymph node metastasis and distant metastasis [
21]. In this study, we found that the expression LINC00261 was reduced in LC and was associated with a poor prognosis in LC patients. Moreover, overexpression LINC00261 inhibited LC growth and progression via targeting miR-1269a/FOXO1 axis.
LINC00261 is a tumor suppressor gene in many types of cancers, for instance, LINC00261 inhibits cell growth and migration of endometriosis [
22], hepatocellular carcinoma [
23] and gastric cancer [
24]. Additionally, LINC00261 enhances chemo-sensitization of human esophageal cancer cells [
25] and human colon cancer cells [
26]. These findings indicate that LINC00261 could be a therapeutic target for cancer treatment. The current study showed that LINC00261 expression was down-regulated in the LC tissues and cells. In addition, patients with relative lower expression of LINC00261 in their tumor had a shorter overall survival time, more advanced TNM stage and a higher risk of metastasis. Previous studies reported that low expression of LINC00261 in non-small cell lung cancer and pancreatic cancer can be used as a prognostic marker [
27,
28], which was similar to our results. Further experiments demonstrated that overexpression of LINC00261 significantly suppressed the growth of LC cells, inhibited cell viability and cell colony progression, and promoted cell apoptosis. Cell cycle assay showed that cell cycle of LC cells with overexpressed LINC00261 was arrested in G1 phase, which, however, was inconsistent with a previous study [
29], and future experiments are required to be conducted to determine the protein expression levels of CHK1, CHK2, and WEE1. The suppressive role of LINC00261 was also confirmed by xenograft assays. Thus, these results proved that LINC00261 is potentially a tumor suppressor for LC.
LncRNAs are crucial signal transduction mediators in cancer signaling pathways by interacting with proteins, RNA, and lipids [
6]. Although LINC00261 shows similar function in the progression of different cancers, but the molecular mechanisms could be different. For instance, LINC00261 regulates BCL2L11 expression in endometriosis through acting as a competing endogenous RNA for miR-132-3p [
30], while LINC00261 suppresses Wnt signaling activity in colon cancer through restraining β-catenin into nuclei and causing degradation of β-catenin [
16], moreover, LINC00261 also destabilizes Slug protein in gastric cancer [
24]. The potential target miRNA was investigated to explore the molecular mechanism through which LINC00261 suppresses the cell proliferation and metastasis of LC cells, and we found that in LC cells LINC00261 was a sponge for miR-1269a, and that FOXO1 was target gene for miR-1269a.
Previous study showed that miR-1269a expression was up-regulated in late-staged colorectal cancer and promotes metastasis through forming a positive feedback loop with TGF-β [
31]. Pan-cancer analysis indicated that miR-1269a is dysregulated in 14 cancers from The Cancer Genome Atlas (TCGA) [
32]. In non-small cell lung cancer, up-regulating the expression of miR-1269a promotes cancer cell proliferation [
33]. The present study found that miR-1269a expression was up-regulated in LC tissues and cells, which was similar to previous studies conducted on other cancers. Furthermore, miR-1269a was negatively correlated with the expression of LINC00261, which indirectly supports the suppressive interaction between LINC00261 and miR-1269a.
Forkhead transcription factor 1 (FOXO1) belongs to the Forkhead box (FOX) transcription factor family, and is a key regulator during the development of multiple organs or tissue cells such as embryonic heart and islet alpha cells [
34]. The FOX transcription factor family is associated with colorectal cancer pathogenesis [
35]. FOXO1 is considered to be a tumor suppressor in multiple solid tumors, for example, up-regulation of FOXO1 is associated with a poor prognosis in patients with cervical cancer [
36]. One previous study showed that miR-27a promotes the progression of pancreatic ductal adenocarcinoma through activating Wnt/β-catenin pathway via FOXO1 [
37]. TCF19 promotes the cell growth of non-small cell lung cancer by inhibiting FOXO1 [
38]. Recently, study indicated that degradation of FOXO1 mediated by G9a at K273 residue promoted cell proliferation of colon cancer [
39]. Therefore, we considered that FOXO1 has a suppressive effect on LC progression. In our study, we confirmed that FOXO1 expression was down-regulated in LC tissues, in addition, FOXO1 was regulated by miR-1269a and LINC00261. Furthermore, functional rescue experiments indicated that FOXO1 overexpression inhibited the proliferation and metastasis of lung cancer cells, while miR-1269a mimic had opposite effects on LC cells and could block the effects of FOXO1 overexpression.
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.