Background
Breast cancer is the most common cancer and the leading cause of oncologic mortality for women worldwide [
1]. The primary risk factors of this disease include age, high hormone level, race, economic status, and iodine deficiency in diet [
2]. Early diagnosis is key to successful treatment of breast cancer. Diagnostic procedures often include clinical examination, mammography, ultrasound, magnetic resonance imaging and biopsy. Standard treatment often requires complete tissue removal, chemotherapy, radiotherapy, and hormone therapy [
3]. Many studies aimed to demonstrate the gene expression profiles of breast cancer have led to the recognition that the disease is highly heterogeneous and newly discovered molecular markers have allowed categorization of the disease into several biological subtypes, ultimately enabling the optimization of clinical practices in many aspects, such as prediction of prognosis and treatment responses [
4‐
6]. Despite the overall advancement in the field, metastatic relapse of the disease at the advanced stage remains a major problem.
The non-protein-coding regions in human genome have been well recognized as important regulatory and functional units, most of which encode long non-coding RNAs (lncRNAs) [
7]. Like, protein-coding mRNA, many lncRNAs are transcribed by RNA polymerase II and undergo maturation through 5′ cap modification, 3′ polyadenylation and splicing. On the other hand, many features of lncRNAs can distinguish them from protein-coding mRNAs. Generally, lncRNAs lack coding potential, expressed at relatively lower levels, prone to localize in the nucleus and evolve faster [
7]. Accumulating evidence has supported involvement of a broad spectrum of lncRNAs in a variety of disease states including oncogenesis [
8]. In breast cancer research, both oncogenic and tumor suppressive lncRNAs have been identified. They are involved in the regulation of gene expression at various levels that ultimately affect cancer cell growth, apoptosis, migration, invasion and stemness maintenance [
9]. Notably, several lncRNAs modulating the TGF-β (transforming growth factor beta) signaling pathway, a central function for mammary development, have been found aberrantly expressed in breast cancer [
10,
11].
Linc-ROR (lncRNA ROR) was initially discovered as a modulator for reprogramming of human induced pluripotent stem cells and proven to have strong impact on self-renewal and differentiation of human embryonic stem cells [
12,
13]. Since then, dysregulation of linc-ROR has been found in a variety of tumors [
14]. In many breast cancer cell lines and tissues, linc-ROR is dramatically upregulated and has been implicated to contribute to malignancy and treatment resistance of advanced breast cancer [
15‐
19]. The oncogenic function of linc-ROR has been linked to the regulation of multiple signaling pathways, which are presumably important for the development and progression of cancers. However, a complete picture of the regulatory network associated with linc-ROR is still missing. This has hampered the application of linc-ROR as a diagnostic biomarker and development of new therapeutic approaches.
We found that linc-ROR was overexpressed in both breast cancer cell lines and patient tissues. The high expression levels of linc-ROR ware associated with poor prognostic outcomes. Further characterization suggested the role of linc-ROR in enhancing proliferation and invasion of breast cancer cells as well as promoting tumor growth in nude mice. We also found that the expression levels of linc-ROR affected several factors in the TGF-β pathway suggesting that the regulatory link between linc-ROR and TGF-β is potentially important for progression of advanced breast cancer. The results provided new insights into the signaling networks associated with the oncogenic action of linc-ROR and might help develop new diagnostic and therapeutic strategies.
Materials and methods
Breast tissue samples
Collection of patient samples was approved by the Ethics Committee of Taihe Hospital affiliated to Hubei University of Medicine. The breast tissues were obtained from 94 breast cancer patients who had surgery in the Taihe Hospital between 2015 and 2017. The patients were 31–59 years old (45 ± 13.5 years old on average) without smoking history. Their breast cancer conditions were diagnosed by two pathologists following the American Society of Clinical Oncology guidelines. Both tumor and the adjacent normal tissues were collected. The normal tissues were at least 2 cm away from the edges of the tumors and contained no obvious tumor cells. All the tissue samples were obtained from fresh surgical specimens, flash-frozen in liquid nitrogen, and stored at − 80 °C.
Cell lines and culture conditions
The human breast cancer cell lines (MDA-MB-231 and MCF-7) and the normal mammary fibroblast cell line (Hs578Bst) were purchased from Beijing Zhongyuan Ltd. and Shanghai Kexing Biotech Ltd. respectively. The MDA-MB-231 cells were maintained in L-15 medium, while the MCF-7 and Hs578Bst cells were maintained in DMEM (Dulbecco’s Modified Eagle’s Medium). All culture media were supplemented with 10% FBS (fetal bovine serum), 100 U/mL of penicillin, and 100 μg/mL of streptomycin, unless otherwise specified. All the cells were incubated at 37 °C in 5% CO2.
Cell transfection
The siRNA specifically targeting ROR (si-ROR) and the scrambled control (si-nc) were synthesized by Shanghai GenePharma Co. Ltd. The RNAs were transfected into cells using the Lipofectamine RNAiMAX reagents (Thermo Fisher Scientific, USA) according to the manufacturer’s protocol. The si-nc and si-ROR sequence are below. si-nc: UUCUC CGAAC GUGUC ACGU; si-ROR: GGAGA GGAAG CCUGA GAGU.
RNA extraction and qRT-PCR
RNA was isolated from tissues or cells using the TRIzol reagent (Thermo Fisher Scientific) and quantitatively analyzed by qRT-PCR (quantitative reverse transcription polymerase chain reaction). Briefly, RNA was reverse transcribed using the SuperScript First Strand cDNA System kit (Thermo Fisher Scientific) and the DNA was subjected to quantitative PCR in a Thermo Fisher Scientific 7300 Real-Time PCR System. The RNA level of GAPDH (glyceraldehyde-3-phosphate dehydrogenase) was used as an internal control. The delta Ct (threshold cycle) method was used to quantitate gene expression levels, while the delta–delta Ct method was used to determine the relative fold changes in gene expression.
The primers used are listed below. ROR:5′-CTCCAGCTATGCAGACCACTC-3′;5′-GTGACGCCTGACCTGTTGAC-3′. GAPDH:5′-AATGGACAACTGGTCGTGGAC-3′,5′-CCCTCCAGGGGATCTGTTTG-3′.
Western blot analysis
The harvested cells lysed and the supernatants were quantitated by BCA assays using a Varioskan multimode microplate spectrophotometer (Thermo Scientific, USA). Equal amounts of proteins were subjected to 10% sodium dodecyl sulphate–polyacrylamide gel electrophoresis (SDS-PAGE). The separated proteins were transferred on to nitrocellulose membranes. The membranes were blocked with 10% no-fat milk in phosphate buffered saline (PBS) at 37 °C for 1 h. Specific antibodies against TGF-β (ab31013, abcam), Smad2 (ab40855, abcam), α-SMA (#19245, CST) and GAPDH (ab9485, abcam) were added for overnight incubation at 4 °C. After the antibodies were removed, membranes were incubated with secondary antibodies (ab6721, abcam) for 1 h at 37 °C. Protein bands were detected with the Odyssey Infrared Imaging System (LI-COR Inc., USA). Protein levels were averaged from triplicates.
MTT assay
Cells were seeded into 96-well plates at a density of 5 × 103/well. The cells transfected with siRNA were incubated for 48 h before being resuspended and seeded into the 96-well plates. The MTT solution (20 μL) was added to the plates at 12-, 24-, 48-, and 72-h time points and the cells were further incubated for 4 h at 37 °C. The culture medium was then replaced by 150 μL DMSO (dimethyl sulfoxide) and the cells were oscillated for 15 min. The absorbance at 490 nm was determined with an enzyme-labeled analyzer.
Cell invasion assays
Cell invasion was analyzed using Transwell invasion chambers (Corning, USA). Briefly, 3 × 104 transfected cells in serum-free DMEM were added onto the upper chambers of 8 μm-diameter Transwell inserts pre-coated with Matrigel (R&D Systems, USA), and 0.5 mL DMEM with 10% FBS was added to the lower chamber. After 48 h incubation at 37 °C, cells on the bottom chamber were fixed with 70% ethanol, stained with 0.1% crystal violet, and photographed under an inverted microscope. The numbers of cells in five random fields per well were counted and averaged as the invading cell number.
Tumor xenograft model
The MCF-7 and MDA-MB-231 breast cancer cells were transfected with lenti-control (sh-nc) or lenti-shRNA-ROR (sh-ROR) (GeneChem, Shanghai, China) and selected for puromycin resistance (10 μg/mL). Female nude mice, 4–5 weeks of age, were purchased from Vital River Laboratory Animal Technology Ltd. (China). Stable MCF-7 and MDA-MB-231 cells (2 × 106 cells in 50% matrigel, BD Biosciences, USA) with or without shRNA transfection were subcutaneously injected into the right flank of nude mice. The formation and growth of tumor volume in the nude mice were monitored. At day 31, the mice were sacrificed and the tumors were isolated and weighted.
Tumor volume was calculated by the formula below.
$${\text{Volume}}\, = \,{\text{Width}}^{ 2} \, \times \,{{\text{Length}} \mathord{\left/ {\vphantom {{\text{Length}} 2}} \right. \kern-0pt} 2}$$
The primer sequences for sh-nc and sh-ROR are listed below.
GATCCCCTTCTCCGAACGTGTCACGTTTCAAGAGAACGTGACACGTTCGGAGAATTTTTC.
GATCCCCCCTGAGAGTTGGCATGAATTTCAAGAGAATTCATGCCAACTCTCAGGTTTTTC.
Statistical analysis
All statistical analyses were carried out using the SPSS 17.0 software (SPSS Inc., USA). Most datasets were analyzed using Independent Samples t Test. The overall survival was estimated using the Kaplan–Meier method. The results with p < 0.05 were considered statistically significant.
Discussion
Our study has confirmed aberrant overexpression of linc-ROR in both breast cancer cell lines and patient tumors, demonstrating its strong correlation with poor prognostic outcomes. The results, together with those from many previous studies, have thus reinforced the hypothesis that this lncRNA is an oncogenic factor that can promote the development and progression of breast cancer [
15‐
19]. Our results have further suggested that the TGF-β signaling pathway may be a downstream target of linc-ROR, responsible for promoting breast cancer. This is line with the previous conclusion that TGF-β is a central signaling molecule in mammary development as well as tumorigenesis [
10].
Many studies have recognized that the function of TGFβ in the progression of breast cancer can be different depending on the stage of cancer [
10,
20,
21]. In normal conditions, TGF-β has been shown to inhibit cell cycle and promote apoptosis that together significantly contribute to the suppressive role in the initiation and progression of tumorigenesis [
22]. In the late stages of tumor progression, however, TGF-β acts as a tumor promoter largely by inducing and promoting epithelial-to-mesenchymal transitions [
23,
24]. Our study has indicated that overexpression of linc-ROR is required to constitutively upregulate critical factors in the TGF-β signaling pathway. This suggests that the oncogenic activity of linc-ROR is at least needed for the progression of breast cancer in the advanced stages, although it likely regulates a highly complex signaling network that can impact many other biological processes that ultimately contribute to multiple steps along the progression of the disease.
Although the survival rates have been gradually increased in some countries because of remarkable improvements in the understanding and management of breast cancer, the disease is still a major medical burden worldwide [
25]. Major challenges include developing cost-effective diagnosis, treating metastatic cancer and overcoming drug resistance in targeted therapies.
Conclusion
Our data suggest that linc-ROR, in combination with other lncRNAs associated with breast cancer, may serve as a clinically beneficial biomarker for detecting neoplastic cells, differentiating the different stages of breast cancer and predicting prognostic outcomes. Furthermore, blocking the functional impact of linc-ROR may represent a novel therapeutic strategy that may help overcome a plethora of cellular mechanisms exploited to favor drug resistance.
Authors’ contributions
LH, JT and FC designed and carried out the study. HY, FY, MW, JL, JF, and GZ participated in experiments and statistical analysis. LH, JT and FC wrote the manuscript. JT and FC revised the manuscript. All authors read and approved the final manuscript.
Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (
http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (
http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.