Lupeol inhibits osteosarcoma progression by up-regulation of HMGA2 via regulating miR-212-3p

MNNG/HOS and MG-63cells were bought from Cell Bank of the Chinese Academy of Sciences (Shanghai, China), MNNG/HOS and MG-63 cells were cultured as described previously [19], and cells were plated in 24-well plate for 24 h before transfection.

Moreover, Lupeol (Sigma-Aldrich, St. Louis, MO, USA) was re-suspended with ethyl alcohol to the concentration of 30 mmol/L mother liquor preparation. It would be diluted in dimethyl sulfoxide (DMSO; Solarbio, Beijing, China) at a 1:1 ratio. The final concentrations were diluted by cell culture medium for preparation.

MiR-212-3p mimics or inhibitor, HMGA2 expression plasmid (pcDNA-HMGA2), and their negative controls were obtained from Ribobio Co. (Guangzhou, China). The oligos or plasmids were transfected into the cells with following the instruction of Lipofectamine 3000 (Thermo Fisher Scientific, Waltham, MA, USA).

MTT kit (Sigma, St Louis, MO, USA) was applied to assess the cell viability. After 48 h of transfection, untransfected or transfected MNNG/HOS and MG-63 (3 × 10⁴ cells/well) cells were treated with various concentrations of lupeol (0, 10, 20, 30 μM) for 12 h, 24 h, or 48 h. At the indicated time points after treatment, each well was added with 20 μL of MTT reagent, and cells were incubated for another 4 h. Subsequently, cells were collected and intracellular formazan crystals were dissolved with 200 μL of DMSO (Solarbio, Beijing, China) [20]. Finally, the absorbance at 570 nm was detected with a microplate reader (Thermo Labsystems, Waltham, MA, USA).

Total RNA in cells was isolated using TRIzol reagent (Thermo Fisher Scientific), according to the previous description [21]. Then, All-in-One™ miRNA Prime Script™RT reagent kit (Takara, Shiga, Osaka, Japan) was used for reverse-transcription according to manufacturer’s instructions. qPCR was performed in a 20 μL total reaction volume comprised of 10 μL of SYBR Green qPCR Master Mix (2×) (Bio-Rad Laboratories, Lnc., Hercules, CA, USA), 1 μL of each gene-specific primer, 2 μL of cDNA templates, and 6 μL of PCR-grade water. Reactions were conducted on the 7500 Fast Real-Time PCR system (Thermo Fisher Scientific) in line with manufacturer’s protocol: denaturation at 94 °C for 2 min, 94 °C for 30 s, 54 °C for 30 s, 72 °C for 35 s, 30 cycles. The relative expressions were calculated by the 2^−ΔΔCt method and normalized to internal U6 small nuclear RNA (U6-snRNA, for miRNA) and GAPDH (for mRNA). The primers for miR-212-3p and U6 were purchased from Sangon Biotech (Shanghai, China). Primer sequences (5’-3’) of HMGA2 and GAPDH for qPCR were listed as follows: HMGA2-F (ATGAGCGCACGCGGTGAGGGC), HMGA2-R (GTTAGAAGACTCAAAGGAACAG), GAPDH-F (AAGCTGGTCATCAATGGGAAAC), GAPDH-R (ACCCCATTTGATGTTAGCGG).

After washed with iced-phosphate buffered saline (PBS), cells were resuspended in binding buffer. AnnexinV-fluorescein isothiocyanate propidium iodide (AnnexinV-FITC/PI) kit (BD Pharmingen, San Diego, CA, USA) was used to strain the cells according to the instructions. The samples were verified by flow cytometry (BD Biosciences, San Jose, CA, USA).

Transwell assay was employed to evaluate cell invasion. The upper chamber coated with Matrigel (Corning Life Sciences, Corning, NY, USA) was added 100 μL of serum-free medium containing cells (1 × 10⁵ cells per well). Cell medium with 10% serum was added into the basolateral chamber. After 24 h of incubation at 37 °C, cells located on the lower surface of the upper chamber was attached with paraformaldehyde (PFA; Sigma) and stained with crystal violet. Cells were analyzed under a microscope.

After cells were cultured for 24 h, the wide-type and mutated HMGA2 3′UTR pMIR-REPOR luciferase vector (OBio Biology, Shanghai, China) were constructed and co-transfected with miR-212-3p mimic or negative control by using Lipofectamine 3000 (Thermo Fisher Scientific). The Dual-Luciferase Reporter AssaySystem (Promega, Madison, WI, USA) was used to detect the luciferase activities at 48 h post-transfection. Renilla luciferase served as an internal control.

Total proteins were isolated by RIPA buffer (Solarbio, Beijing, China) and quantified using a NanoDrop 3000 (Thermo Fisher Scientific). After subjected to Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), protein samples were transferred onto polyvinylidene fluoride membranes (Millipore, Bradford, MA, USA). Next, 5% fat-free milk buffer was used to block the membranes for 2 h at 37 °C. And then primary antibodies rabbit-anti-HMGA2 (1:500; Cell Signaling Technology, Danvers, MA, USA) or rabbit-anti-human GAPDH (1:1000; Cell Signaling Technology) was used to incubate the membranes overnight at 4 °C. The membranes were then washed with TBST and incubated with secondary antibody marked goat anti-rabbit IgG horseradish peroxidase (HRP) (1:2000; Cell Signaling Technology). After washing with TBST, the blots were detected using an ECL detection kit (Pierce Biotech, Rockford, IL, USA) and analyzed by Image Pro-Plus 6.0 software.

To detect the effects of lupeol on cytotoxicity, MNNG/HOS and MG-63 cells were incubated with lupeol at various concentrations (0 μM, 10 μM, 20 μM, and 30 μM) for 12 h, 24 h, and 48 h. We found that cell viability was negatively related to lupeol concentration (Fig. 1a, b). Based on these findings, we selected 20 μM lupeol (24 h treatment) [13] for further studies. QRT-PCR was performed to explore the expression of miR-212-3p in MNNG/HOS and MG-63 cells treated with lupeol. The analysis showed that the expression level of miR-212-3p was significantly increased as the concentration elevated (Fig. 1c, d). From these data, it could be deduced that lupeol repressed viability and upregulated the expression of miR-212-3p in OS cells in vitro.

To investigate the functional effects of lupeol and miR-212-3p in OS, MNNG/HOS and MG-63 cells were transfected with miR-NC ormiR-212-3p. The result showed that lupeol management and the transfection of miR-212-3p caused a high expression level of miR-212-3p in MNNG/HOS and MG-63 cells. Interestingly, both overexpression of miR-212-3p and lupeol treatment enhanced mRNA expression of miR-212-3p in cells (Fig. 2a). MTT assay indicated that the viability of OS cells was significantly inhibited by lupeol treatment or overexpression of miR-212-3p (Fig. 2b, c). Flow cytometry assay demonstrated that lupeol treatment and overexpression of miR-212-3p led to an apparent increase in apoptosis rates in two OS cells (Fig. 2d, e). In addition, transwell assay revealed that lupeol treatment and overexpression of miR-212-3p could inhibit cell invasion of OS cells (Fig. 2f). These data above suggested that both lupeol and overexpression of miR-212-3p exerted an effect on inhibiting viability and invasion, promoting apoptosis on OS in vitro.

To verify the mechanism by which lupeol regulating apoptosis and invasion and figure out the relationship between lupeol and miR-212-3p in OS cells, MNNG/HOS and MG-63 cells were transfected with anti-miR-NC or anti-miR-212-3p, respectively. As shown in Fig. 3a, the expression level of miR-212-3p was downregulated in the Lupeol + anti-miR-212-3p group, compared with the negative control group. MTT and transwell assay demonstrated that viability and invasion were significantly inhibited by lupeol, and its effect could be overturned by knockdown of miR-212-3p (Fig. 3b, c, e). Flow cytometry analysis implied that miR-212-3p silencing reduced the high apoptosis rate resulting from lupeol administration (Fig. 3d). These results above uncovered that lupeol could regulate cell viability, apoptosis, and invasion by upregulatingmiR-212-3p in vitro.

By the TargetScan, bioinformatics software online, we identified that HMGA2 was a potential target of miR-212-3p. The binding site between HMGA2 and miR-212-3p locate at its 3′-UTR of HMGA2 with binding site 5′-ACUGUUC-3′ (Fig. 4a). To explore the potential interaction, the pMIR-REPOR-HMGA2-WT and the pMIR-REPOR-HMGA2-MUT plasmids were constructed. The luciferase reporter assay demonstrated that luciferase activity was obviously reduced in cells co-transfected with miR-212-3p and pMIR-REPOR-HMGA2-WT, while had no evident change in cells transfected with miR-212-3p and pMIR-REPOR-HMGA2-WT (Fig. 4b, c). We also detected the mRNA and protein levels of HMGA2 in OS cells with overexpression or knockdown of miR-212-3p. The results showed that HMGA2 was significantly decreased when cells were transfected with miR-212-3p, whether at the mRNA level (Fig. 4d) or protein level (Fig. 4f). By contrast, HMGA2 expression was significantly raised when cells were transfected with anti-miR-212-3p at both mRNA levels (Fig. 4e) and protein level (Fig. 4g).

To investigate the functional roles of HMGA2 in tumor cells, HMGA2 over-expressing vector was constructed and co-transfected into MNNG/HOS and MG-63 cells along with miR-212-3p. Cells co-transfected with miR-212-3p and HMGA2 exhibited high expression of HMGA2 at mRNA level (Fig. 5a) and protein level (Fig. 5b, c). In addition, we found that overexpression of HMGA2 restored the down-regulated effect on viability (Fig. 5d, e) and invasion (Fig. 5g) and upregulated effect on apoptosis induced by miR-212-3p (Fig. 5f). Taken together, the miR-212-3p exerts a cancer suppressor role in OS partially by inhibiting its target gene HMGA2.

To verify whether the inhibitory action of lupeol on OS development was mediated by regulating the miR-212-3p/HMGA2 axis, transwell assay and western blot assay were used to evaluate invasion and the protein expression level of HMGA2 in MNNG/HOS and MG-63 cells, respectively. As shown in Fig. 6a, the silencing of miR-212-3p recovered invasion ability of the two cell lines, which was inhibited by lupeol. Meanwhile, a high expression level of HMGA2 (Fig. 6b, c) in Lupeol + anti-miR-212-3p were observed in vitro.