nach oben

European Journal of Nutrition

Erschienen in:

Open Access 30.09.2019 | Original Contribution

Maternal high-protein diet modulates hepatic growth axis in weaning piglets by reprogramming the IGFBP-3 gene

verfasst von: Rihua Cong, Xiaoli Qu, Hui Zhang, Yongling Hu, Silin Ye, Demin Cai, Xian Li, Hao-Yu Liu

Erschienen in: European Journal of Nutrition | Ausgabe 6/2020

Abstract

Purpose

The aim of this study was to investigate the effects of maternal high dietary protein intake on the hepatic growth axis in offspring.

Methods

Fourteen primiparous purebred Meishan sows were fed either a standard-protein (SP, n = 7) diet or a high-protein (HP, 150% of SP, n = 7) diet during pregnancy. Offspring (one male and one female per group, n = 14) on day 70 of the embryonic stage and on days 1, 35 and 180 after birth were selected, weighed and killed. Serum samples were analyzed for Tch, insulin and insulin-like growth factor-binding protein 3 (IGFBP-3) levels. Liver samples were analyzed for IGFBP-3 and IGF-I mRNA expression by qRT-PCR and for IGFBP-3, IGF1R and growth hormone receptor (GHR) protein expression by Western blotting. The underlying mechanism of IGFBP-3 regulation was determined by methylated DNA immunoprecipitation (MeDIP) and chromatin immunoprecipitation (ChIP).

Results

High-protein exposure resulted in significantly higher body and liver weights of piglets, and it increased their serum T3 and T4 levels at birth and/or at weaning. Furthermore, the IGFBP-3 protein content in the liver and serum was significantly reduced in the HP-exposed weaning piglets, whereas at the transcriptional level IGFBP-3 mRNA expression was downregulated in the livers of HP group piglets. Finally, DNA hypermethylation and higher enrichment of the histone repressive marks H3K27me3 and H3K9me3 were observed.

Conclusions

Taken together, these results suggest that a maternal high-protein diet during gestation epigenetically reprograms IGFBP-3 gene expression to modulate the hepatic growth axis in weaning piglets.

Rihua Cong and Xiaoli Qu contributed equally to this study.

ChIP

Chromatin immunoprecipitation

Embryonic

GHR

Growth hormone receptor

High protein

IGFBP-3

Insulin-like growth factor-binding protein 3

IUGR

Intrauterine growth retardation

LPD

Low-protein diet

MeDIP

Methylated DNA immunoprecipitation

Meishan

PCR

Polymerase chain reaction

SDS

Sodium dodecyl sulfate

Standard protein

Introduction

The insulin-like growth factor (IGF) system consists of two IGF ligands (IGF- I and IGF-II), two IGF receptors (IGF-1R and IGF-2R), and a group of at least six IGF-binding proteins (IGFBP-1 to 6) [1]. These components are found in a variety of tissues or bodily fluids [2] and act through endocrine, paracrine, and/or autocrine modes of action [3]. As a result, the IGF system, with all components working together, regulates biological processes, including cell proliferation, differentiation, survival and apoptosis that are essential to life [4, 5]. In particular, the IGF system plays an important role in the link between nutrition and postnatal growth and development [6]. For example, fetal nutrient supply determines the fetal IGF axis [7‐9] and can continue shaping the IGF axis after birth, as revealed in rodents [10] and humans [11]. It has been shown that a maternal low-protein diet (LPD) is associated with a reduced fetal liver weight in rats [12, 13]. The livers of progeny whose mothers were fed a high-protein diet during gestation were 8.3% heavier [12, 13]. Accordingly, a maternal LPD causes a decrease in fetal hepatic IGF-I gene expression, but increases IGFBP levels in fetal plasma and liver, which may contribute to fetal growth retardation, as observed in rats [14‐18]. Previous studies have demonstrated that gene expression is associated with progesterone, IGF-I and IGFBP-5, which are upregulated in the fetus in response to maternal high-protein intake [17, 19, 20]. In the case of large litters in pigs, the excess of dietary protein seems to be beneficial for preventing intrauterine growth retardation (IUGR) resulting from intrauterine crowding [20]. Notably, recent studies have revealed that maternal protein supplementation during gestation affects human fetal body weight independent of IGF-I [21]. In addition, hormones, especially those from the thyroid, are thought to be key players connecting the IGF growth axis and maternal factors/fetal nutrient supply. Thyroid hormones can regulate IGF-I production by activating the hepatic growth hormone receptor (GHR) [22, 23], and they are sensitive to maternal nutritional reprogramming [24, 25]. Nevertheless, the exact nature of these events is still unclear and warrants further exploration.

Interestingly, it has been well documented that epigenetic regulation modifies fetal gene expression during maternal nutrition programming. For instance, in cancer research, the IGFBP-3 gene is described to be vulnerable to epigenetic regulation, including DNA methylation and histone modification [26]. It is worth mentioning that IGFBP-3 can block IGF-I and IGF-II from binding to their receptors and therefore plays an important role in cell proliferation stimulation. However, whether maternal dietary intervention affects gene expression in offspring via epigenetics has not been well explored. Nawathe et al. showed that DNA methylation is involved in changes of gene expression in the IGF axis in fetal growth disorders [27], while maternal undernutrition alters hepatic metabolic gene transcription via DNA methylation and the modification of histones, including H3K4me3, H3K27me3 and H3K9me1 [28, 29]. Moreover, modifications of H3K14ac and H3K9me3 are found to occur in fetal liver lipid metabolism when exposed to a high-fat diet in utero [30].

Intriguingly, genes involved in the liver cell cycle and growth in newborn piglets are downregulated by histone modification when the dams are exposed to dietary supplementation with methyl donors [31]. Building upon these studies, we hypothesized that epigenetic events during maternal nutrition programming may play a crucial role in modifying the liver IGF-I/IGFBP-3 growth axis in offspring.

Meishan (MS), a Chinese indigenous pig breed, pigs were used in the present study as an animal model to delineate the impact of a maternal high-protein diet on the hepatic IGF axis of offspring piglets at different life stages. Blood and liver samples were taken from sows at 70 days gestation, from piglets at birth, from weaned piglets at 35 days, and from fattened pigs at 180 days. We aimed to explore the possible epigenetic mechanisms on the regulation of specific genes involved in the IGF-I/IGFBP-3 pathway in the liver.

Methods

Animals and sampling

The experimental protocol was approved by the Animal Ethics Committee of Northwest A & F University. All procedures complied with the ‘Guidelines for the Ethical Treatment of Experimental Animals’ (2006) No. 398 set by the Ministry of Science and Technology, China. Eighteen primiparous purebred Meishan gilts were obtained from the National Meishan Pig Preservation and Breeding Farm at Jiangsu Polytechnic College of Agriculture and Forestry, Jurong, Jiangsu Province, P. R. China. They were assigned randomly to a high-protein (HP) or standard-protein (SP) group.

Sows were fed diets containing either 14% crude protein in the HP group or 7% crude protein in the SP group (Table 1). The dietary treatment started from the first observation of estrus and artificial insemination was performed at the second estrus. A mixture of semen samples obtained from two littermate boars was used for artificial insemination, and the fertilization rate was not influenced by maternal dietary treatment. Sows were fed twice daily (0800 and 1400 h) with rations of 1.8 kg/day during gestation. As shown in Fig. 1, we randomly selected piglets on day 70 of the embryonic stage (E70) and on the 1st (D1), 35th (D35) and 180th (D180) days. At each stage, one male (n = 7) and one female (n = 7) piglet (per experimental group) with a mean body weight ± 10% were selected from each litter and killed. Blood was collected, followed by immediate serum preparation, and the liver (without the gall bladder) samples were snap frozen in liquid nitrogen immediately and stored at − 80 °C for further analysis.

Table 1

Composition and nutrient content of the experimental diet

Ingredient %	HP	SP
Corn	61	55.8
Soybean meal	17
Bran	12	15
Bone meal	1	0.5
Corn sugar	5	22
CaSPO₄		0.7
Fiber^a		1
Attapulgite		1
Premix^b	4	4
Calculated composition
Digestible energy, MJ/kg	13.1	13.1
Crude protein %	14	6.9
Crude fiber %	2.8	2.6
Ca %	1.2	1.2
P %	0.4	0.4

^aThe fiber concentrate ARBOCEL was purchased from JRS (Germany)

^bThe premix contains (per kilogram): vitamin A: 240,000 IU; vitamin D3: 60,000 IU; vitamin E: 720 IU; vitamin K3: 30 mg; vitamin B1: 30 mg; vitamin B2: 120 mg; vitamin B6: 60 mg; vitamin B12: 360 mg; niacin: 600 mg; pantothenic acid: 300 mg; folic acid: 6 mg; manganese sulfate: 1.0 g; zinc oxide: 2.5 g; iron sulfate: 4.0 g; copper sulfate: 4.0 g; sodium selenite: 6 mg; calcium: 150 g; phosphorus: 15 g; sodium chloride: 40 g

Tch, insulin and IGFBP-3 in serum

Serum concentrations of insulin (F01PZB), T3 (A01PZB) and T4 (A02PZB) were measured using specific commercial RIA kits (Beijing North Institute of Biological Technology) with assay sensitivities of 5 μIU/L, 0.25 mg/L and 5 mg/L, respectively. The intra- and inter-assay variations were either 10% or 15% for the kit used. Serum IGFBP-3 levels were measured using a commercial ELISA kit (Abcam, ab100541) following the manufacturer’s instructions.

Total RNA isolation and mRNA quantification

Total RNA was isolated from liver samples using TRIzol reagent (Tiangen Biotech Co., Ltd., Beijing, China). The iScript cDNA Synthesis Kit (Promega, Madison, WI, USA) was used to synthesize cDNA from 2 μg of total RNA from each sample according to the manufacturer’s instructions. Two microliters of diluted cDNA (1:50) was used for quantitative real-time PCR. The primer sequences are shown in Table 2 and were synthesized by Invitrogen (Shanghai, China). Real-time PCR was performed with Mx3000P (Stratagene, USA). The technical variations were normalized to GAPDH as an internal control. The specificity of amplification was determined by melting curve analysis and PCR product sequencing.

Table 2

Nucleotide sequences of specific primers

Gene name	Accession no.	Primer sequence (5′ → 3′)	Size (bp)
GAPDH	AF017079	F^: GGACTCATGACCACAGTCCAT R^: TCAGGTCCACAACCG ACACGT	220
IGF-I	DQ784687	F: ATTTCTTGAAGGTAAAGATGCA R: CAGCCCCACAGAGGGTCTCA	117
IGFBP-3	AF085482	F: GACACGCTGAACCACCTCA R: CGTACTTATCCACGCACCAG	151
IGFBP-3 Promoter	NM_001005156.1	F: AAATGGAGGACACGCTGAAC R: TACTTATCCACGCACCAGCA	157

^*F forward, R reverse

Tissue protein extraction and Western blot analysis

Total cellular protein and nuclear protein were extracted from 100 mg frozen liver tissue as described previously [32, 33]. The protein concentration was measured with a Pierce BCA Protein Assay Kit (Thermo Scientific, USA). Western blot analysis for IGF-1R (ab226871, Abcam, UK, diluted 1:100), IGFBP-3 (ab231034, Abcam, UK, diluted 1:100) and GHR (ab202964, Abcam, UK, diluted 1:200) was carried out according to the recommended protocols provided by the manufacturer.

Methylated DNA immunoprecipitation (MeDIP)

Methylated DNA immunoprecipitation (MeDIP) analysis was performed as previously described with some modifications [12]. Briefly, genomic DNA of the liver was sonicated and heat denatured to generate single- stranded DNA. A mouse monoclonal antibody against 5-methyl cytosine (ab10805, Abcam) was used for immune-precipitating methylated DNA segments. Pretreated G protein agarose beads (40 μL, 50% slurry, sc-2003, Santa Cruz Biotechnology) were used to capture the precipitated immune complexes, and purified MeDIP DNA was used to amplify the proximal promoter sequences of the target genes by RT-PCR. The CpG islands on the promoter of the IGFBP-3 gene was assessed by Methyl Primer Express v1.0 (Applied Biosystems, USA) using the following criteria: %GC > 50%, length > 200 bp, and CpG observed/CpG expected > 0.6. A pair of negative control primers was used to amplify a promoter region without CpG sites as the internal control, and the MeDIP results were calculated relative to the internal control. The specific primers are shown in Table 2.

Chromatin immunoprecipitation (ChIP)

ChIP analysis was performed according to previous publications with some modifications [34]. Briefly, 200 mg frozen liver samples were ground in liquid nitrogen, resuspended in PBS containing a protease inhibitor cocktail (Roche Diagnostics GmbH, Mannheim, Germany) and cross-linked in 1% formaldehyde for 10 min at room temperature. The cross-linking reaction was stopped by 2.5 M glycine while rotating for 10 min at room temperature. The pellets were washed using PBS and rinsed with sodium dodecyl sulfate (SDS) lysis buffer (50 M Tris–HCl pH 8.1, 10 mM EDTA, 1% SDS) containing protease inhibitors. The cross-linked samples were sonicated for 10 min on ice with 10 s on/off intervals (Sonics Vibra, USA). The samples were then centrifuged at 12,000 rpm for 10 min at 4 °C to remove cell debris from the crude chromatin preparations. The average length of the sonicated chromatin was approximately 500 bp, as determined by 1% agarose gel. The protein–DNA complex was diluted in ChIP dilution buffer, precleared with salmon sperm DNA/G protein agarose beads (60 μl, 50% slurry, Biyuntian, Biotechnology, China) and incubated with 2 μg of the respective antibody [histone H3 antibody, ab1791, Abcam; anti-acetyl-histone H3, 06-599, Millipore; trimethyl -histone H3K9, ab8898, Abcam; trimethyl-histone H3K27 (Lys27), 17-622, Millipore; trimethyl-histone H3K4 antibody, ab1012, Abcam] overnight at 4 °C. A negative control was included without adding an antibody. G protein agarose beads (120 μl, 50% slurry) were added to capture the immunoprecipitated chromatin complexes. The pellets containing immunoprecipitated complexes were sequentially washed, and the antibody/protein/DNA complexes were eluted from protein G agarose beads. Finally, reverse cross-linking was performed at 65 °C for 5 h to release DNA fragments from the immunoprecipitated complex, and the ChIPed-DNA was purified.

Statistical analysis

All data are presented as the mean ± S.E.M. and were analyzed using an independent-samples t test with SPSS 22.0. The 2 − ΔΔCt method was used to analyze the RT-PCR data expressed as the fold change relative to the SP group. Since none of the detected parameters showed sex disparities, males and females were grouped together, resulting in n = 14 in each group. The numbers of piglets for the different measurements achieved statistical power of 0.95 (using the t test) between the groups, with the relevant standard errors. Differences were considered significant at p < 0.05.

Results

A maternal high-protein diet increases the body and liver weight of piglets and alters serum parameters

As shown in Table 3, piglets derived from HP diet-fed sows exhibited significantly higher body weight (p < 0.01) and liver weight (p < 0.01) at birth and at weaning than the piglets in the SP group. The adult body weight was similar between treatments. Additionally, a significantly increased serum concentration of T3 and T4 was observed at weaning (Fig. 2a, b, p < 0.05). However, the maternal HP diet did not affect serum insulin levels in offspring at any stage (Fig. 2c).

Table 3

Body weight, liver weight and liver index of the offspring piglets at embryonic 70 (E70), postnatal 1 (D1), 35 (D35) and 180 (D180) days

Parameter	D1		D35		D180
Parameter	SP	HP	SP	HP	SP	HP
BW kg	0.84 ± 0.02	0.97 ± 0.03^**	5.02 ± 0.35	6.62 ± 0.46^*	61.42 ± 2.39	66.98 ± 2.03
LW g	21.6 ± 0.66	26.8 ± 1.84^**	130.8 ± 5.70	172.5 ± 7.25^**	966.1 ± 75.72	951.2 ± 62.23
Liver index g/kg	27.4 ± 1.57	25.1 ± 0.98	26.6 ± 1.52	26.7 ± 1.30	14.0 ± 1.02	15.9 ± 1.40

Values are mean ± S.E.M., n = 14. ^*p < 0.05. ^**p < 0.01 compared to SP

A maternal high-protein diet reduces liver IGFBP-3 protein content and serum IGFBP-3 level in weaning piglets

To identify the possible events that caused the growth effects in piglets, we performed Western blotting to detect the key proteins involved in the liver growth axis. IGF-1R protein content was significantly elevated at birth, whereas IGFBP-3 protein content was markedly reduced at weaning in the HP-exposed piglets (Fig. 3a–c). The GHR protein content was unaltered at any of these time points in the offspring’s life (Fig. 3a and d). Furthermore, consistent with the decreased IGFBP-3 protein content, we revealed that the serum IGFBP-3 level was also decreased in HP-exposed weaning piglets, as well as in adult offspring (Fig. 4).

Maternal high-protein diet downregulates liver IGFBP-3 transcript

Given the significant changes in hepatic protein contents of IGF-1R and IGFBP-3 in HP-exposed piglets, qRT-PCR was conducted to validate the transcriptional level of these two genes. IGFBP-3 mRNA was significantly downregulated in the livers of weaning and adult piglets as a result of HP treatment (Fig. 5a). In contrast, IGF-I gene expression at the transcriptional level in piglets was not affected by treatments at any time point (Fig. 5b).

Epigenetic regulation of the IGFBP-3 gene in HP-exposed weaning piglets

To determine the underlying mechanisms involved in the downregulated IGFBP-3 gene expression in HP-exposed weaning piglets, MeDIP and ChIP-qPCR were performed to measure the methylation status of the promoter region of the IGFBP-3 gene. In line with the change in the transcript level, DNA hypermethylation of the IGFBP-3 gene was observed (Fig. 6). In addition, the repressive histone marks H3K27me3 and H3K9me3 were more highly enriched on the IGFBP-3 promoter in the livers of weaning piglets (Fig. 7a, b). Notably, the binding enrichment of the active histone mark H3K4me3 was also reduced when normalized to H3. Although histone acetylation is critical to regulate gene expression, H3AC was not significantly changed in response to HP exposure.

Discussion

In this study, we presented evidence demonstrating that a high-protein diet during pregnancy led to higher body and liver weights in newborns, as well as in weaning piglets. Endocrine factors such as insulin, sex hormones and thyroid hormones play important roles in fetal development and growth. One study demonstrated that a maternal high-protein/low-carbohydrate diet increases the insulin resistance of animals to maintain glucose homeostasis without affecting the basal insulin level [35]. Accordingly, we reported that serum insulin levels were not changed in HP-exposed piglets. Sex hormones are considered an important factor and are thought to influence animal growth differently between males and females under maternal nutrition programming, but no sex disparity in body weight or hepatic growth axis was observed in our study regardless of treatment. Similarly, a human clinical trial revealed that postnatal diet affects sex steroid levels independent of infant size, differing from the prenatal nutrition intervention [36]. This finding suggests that neonatal growth after birth may not be mediated directly by sex hormones. Rather, we postulate that the changed IGF axis may be more sensitive to thyroid hormones. It has been reported that hypothyroidism is closely linked to body weight and the growth rate of offspring in early life [37‐39]. Indeed, a recent study revealed that maternal high-protein diet consumption during pregnancy causes elevated body weight of offspring at birth without changing the IGF-I pathway [21]. Similarly, we demonstrated that T3 and T4 levels in the serum were higher in the HP-exposed piglets with higher body weight. We found that the increased body weight tended to diminish toward adulthood. This finding might be explained by the adaptation response, i.e., slower growth rate in the growing stage/fattening period of pigs [21]. Furthermore, we found that the IGF-1R protein content was increased, which was associated with elevated serum T3 levels at birth due to HP exposure. These results suggest that maternal high-protein intake promotes the activation of the IGF-I growth axis in the early life of offspring.

The IGF-IGFBP pathway is one of the most essential parts of growth axis regulation. Indeed, the regulation of IGF-dependent growth via maternal nutrition programming has been underlined, especially in IGUR models. In the current study, we demonstrated that liver IGF-1R protein content was increased at birth in response to high-protein exposure, indicating a stimulatory effect during the early life of offspring. This finding may explain the increased liver and body weights of neonatal and weaning piglets from the HP diet-fed sows compared to the weights of the control piglets. Interestingly, we found that at the weaning period (day 35), the IGFBP-3 levels in the serum and livers of the HP piglets were decreased. High-protein intake in pregnant women has been reported to be associated with reduced levels of IGF-II and IGFBP-3 in cord blood but to not affect IGF-I [40]. In contrast, it is demonstrated that nutrition restriction during pregnancy in ewes tended to decrease IGFBP-3 expression in the fetus while lowering plasma IGF levels [41, 42]. It is noteworthy that although IGFBP-3 was inclined to decrease, the IGFBP-2 level in fetal plasma was significantly increased due to maternal energy restriction [12]. Importantly, it has been described that during fetal life, the predominant IGFBPs are IGFBP-1 and IGFBP-2, whereas IGFBP-3 becomes the most abundant protein later in life, accounting for 80% of all IGF binding. Thus, this may explain the different results of our study on sows and the previous studies on dams and women compared to the nutrition restriction study in ewes [12].

On the other hand, it is widely accepted that poor fetal growth is associated with postnatal growth acceleration as a compensatory response and is linked to an increased risk of metabolic disorders in the long term [43, 44]. The early growth retardation and later life compensatory growth have also been observed after weaning and in adulthood [44, 45]. In this regard, the reduced IGFBP-3 expression reprogrammed by maternal high dietary protein may be an adaptation reaction to slow down growth from weaning to adult life. It is worth mentioning that the IGFBP-3 gene, but not the protein content, was still downregulated until adulthood in our study. This implies that post-transcriptional regulation may be involved. One possibility is that microRNAs target mRNA degradation and/or translational repression. Numerous studies have reported that maternal dietary supplementation regulates gene translation by modifying microRNA function [31, 46]. However, whether the dissociation of the decreased IGFBP3 mRNA and the unchanged IGFBP-3 protein expression in the liver of piglets is induced by a post-transcriptional mechanism is beyond the focus of the present study and may warrant future investigations.

The postnatal stage, especially the weaning period, is of critical importance for animal growth and for health in adult life [47, 48]. Based on our data and data from other studies, maternal nutrition programming modulates liver growth and function in offspring predominantly via epigenetic regulation [33, 49, 50]. Intriguingly, we demonstrated that the downregulated mRNA level of IGFBP-3 in the liver was associated with protein content. Cancer research has shown evidence that the IGFBP-3 gene is vulnerable to epigenetic regulation, including DNA methylation and histone modification [26]. However, the understanding of the maternal–offspring IGFBP-3 gene expression regulation is limited. To support the notion that DNA methylation functions on the IGF axis in fetal growth [27], our data revealed that CpG methylation was enhanced on the promoter of IGFBP-3 in HP piglets at weaning, thus blocking transcription to decrease IGFBP-3 mRNA expression.

Having described the altered DNA methylation status, we further studied the mechanisms by conducting ChIP analysis of the IGFBP-3 gene. We identified histone modification of the IGFBP-3 gene promoter in the offspring exposed to maternal high-protein intake in pigs for the first time. Total histone H3 status represents a whole genomic histone methylation; however, it was not changed in the liver of weaning HP piglets. It is known that maternal nutrition supplementation modifies liver metabolic genes via the modification of histones, including H3K4me3, H3K27me3 and H3k9me1, in the offspring [29, 51]. For the specific gene IGFBP-3, enrichment changes in histone marks on the gene promoter region were in line with decreased IGFBP-3 transcription. Higher enrichment levels of H3K9me3 and H3K27me3 were associated with DNA hypermethylation in the H piglets at weaning. This suggests that high protein content in the maternal diet plays a dominant role in gene methylation to epigenetically modulate the hepatic growth axis in offspring. Furthermore, histone acetylation is a pivotal factor that regulates fetal gene expression [52]. Although our data show that H3AC enrichment was not changed in this model, specific marks such as H3K27ac and H3K9ac should be measured in the future to confirm acetylation status in the offspring exposed to high-protein diet in pregnant dams.

In conclusion, our study reveals that a maternal high-protein diet given during gestation modulates the hepatic growth axis in weaning piglets. This may, at least partly, be attributed to the reprogramming of IGFBP-3 function by DNA methylation and histone modification. Our findings of epigenetic regulation of the IGFBP-3-mediated liver growth axis being involved in maternal nutrition programming provide an underlying mechanism of how dietary protein modulates fetal growth. Given that weaning is a critical period of life, a healthy growth pattern built from early life may reduce the risk of developing obesity in adulthood.

Acknowledgements

Open access funding provided by Uppsala University. This research was funded by the Shaanxi Province Agricultural Programs for Science and Technology Development: Sow welfare aquaculture technology research and application, grant number K3310215109.

Compliance with ethical standards

Conflict of interest

The authors declare no conflicts of interest.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made.

Unsere Produktempfehlungen

Neuer Inhalt

Jetzt informieren

e.Med Interdisziplinär

Kombi-Abonnement

Für Ihren Erfolg in Klinik und Praxis - Die beste Hilfe in Ihrem Arbeitsalltag

Mit e.Med Interdisziplinär erhalten Sie Zugang zu allen CME-Fortbildungen und Fachzeitschriften auf SpringerMedizin.de.

Jetzt testen ¹

Denley A, Cosgrove LJ, Booker GW, Wallace JC, Forbes BE (2005) Molecular interactions of the IGF system. Cytokine Growth Factor Rev 16(4–5):421–439. https://doi.org/10.1016/j.cytogfr.2005.04.004 PubMedCrossRef

Kaplan SA, Cohen P (2007) The somatomedin hypothesis 2007: 50 years later. J Clin Endocrinol Metab 92(12):4529–4535. https://doi.org/10.1210/jc.2007-0526 PubMedCrossRef

Grimberg A, Cohen P (2000) Role of insulin-like growth factors and their binding proteins in growth control and carcinogenesis. J Cell Physiol 183(1):1–9PubMedPubMedCentralCrossRef

Khandwala H, Mccutcheon I, Flyvbjerg A (2000) The effects of insulin-like growth factors on tumorigenesis and neoplastic growth. Endocr Rev 21(3):215–244PubMedCrossRef

Pollak MN, Schernhammer ES, Hankinson SE (2004) Insulin-like growth factors and neoplasia. Nat Rev Cancer 4(7):505–518. https://doi.org/10.1038/nrc1387 PubMedCrossRef

Simmen FA, Badinga L, Green ML, Kwak I, Song S, Simmen RC (1998) The porcine insulin-like growth factor system: at the interface of nutrition, growth and reproduction. J Nutr 128(2 Suppl):315SPubMedCrossRef

Brameld JM, Atkinson JL, Saunders JC, Pell JM, Buttery PJ, Gilmour RS (1996) Effects of growth hormone administration and dietary protein intake on insulin-like growth factor I and growth hormone receptor mRNA Expression in porcine liver, skeletal muscle, and adipose tissue. J Anim Sci 74(8):1832–1841PubMedCrossRef

Oliver MH, Harding JE, Breier BH, Evans PC, Gluckman PD (1993) Glucose but not a mixed amino acid infusion regulates plasma insulin-like growth factor-I concentrations in fetal sheep. Pediatr Res 34:62. https://doi.org/10.1203/00006450-199307000-00015 PubMedCrossRef

Osborn BH, Fowlkes J, Han VK, Freemark M (1992) Nutritional regulation of insulin-like growth factor-binding protein gene expression in the ovine fetus and pregnant ewe. Endocrinology 131(4):1743–1750. https://doi.org/10.1210/endo.131.4.1382960 PubMedCrossRef

10.

Olausson H, Sohlstrom A (2003) Effects of food restriction and pregnancy on the expression of insulin-like growth factors-I and -II in tissues from guinea pigs. J Endocrinol 179(3):437–445PubMedCrossRef

11.

Verkauskiene R, Jaquet D, Deghmoun S, Chevenne D, Czernichow P, Lévy-Marchal C (2005) Smallness for gestational age is associated with persistent change in insulin-like growth factor I (IGF-I) and the ratio of IGF-I/IGF-binding protein-3 in adulthood. J Clin Endocr Meta 90(10):5672–5676. https://doi.org/10.1210/jc.2005-0423 CrossRef

12.

El-Khattabi I, Gregoire F, Remacle C, Reusens B (2003) Isocaloric maternal low-protein diet alters IGF-I, IGFBPs, and hepatocyte proliferation in the fetal rat. Am J Physiol Endocrinol Metab 285(5):E991–E1000. https://doi.org/10.1152/ajpendo.00037.2003 PubMedCrossRef

13.

McNeil CJ, Hay SM, Rucklidge GJ, Reid MD, Duncan GJ, Rees WD (2009) Gene and protein expression profiles in the foetal liver of the pregnant rat fed a low protein diet. Genes Nutr 4(3):189–194. https://doi.org/10.1007/s12263-009-0125-6 PubMedPubMedCentralCrossRef

14.

Straus DS, Ooi GT, Orlowski CC, Rechler MM (1991) Expression of the genes for insulin-like growth factor-I (IGF-I), IGF-II, and IGF-binding proteins-1 and -2 in fetal rat under conditions of intrauterine growth retardation caused by maternal fasting. Endocrinology 128(1):518PubMedCrossRef

15.

Woodall SM, Breier BH, Johnston BM, Gluckman PD (1996) A model of intrauterine growth retardation caused by chronic maternal undernutrition in the rat: effects on the somatotrophic axis and postnatal growth. J Endocrinol 150(2):231–242PubMedCrossRef

16.

Woodall SM, Bassett NS, Gluckman PD, Breier BH (1998) Consequences of maternal undernutrition for fetal and postnatal hepatic insulin-like growth factor-I, growth hormone receptor and growth hormone binding protein gene regulation in the rat. J Mol Endocrinol 20(3):313–326PubMedCrossRef

17.

El-Khattabi I, Grégoire F, Remacle C, Reusens B (2003) Isocaloric maternal low-protein diet alters IGF-I, IGFBPs, and hepatocyte proliferation in the fetal rat. Am J Physiol Endocrinol Meta 285(5):E991CrossRef

18.

Denisenko O, Lin B, Louey S, Thornburg K, Bomsztyk K, Bagby S (2011) Maternal malnutrition and placental insufficiency induce global downregulation of gene expression in fetal kidneys. J Dev Orig Health Dis 2(2):124–133PubMedPubMedCentralCrossRef

19.

Micke G, Sullivan T, Gatford K, Owens J, Perry V (2010) Nutrient intake in the bovine during early and mid-gestation causes sex-specific changes in progeny plasma IGF-I, liveweight, height and carcass traits. Anim Reprod Sci 121(3–4):208–217PubMedCrossRef

20.

Kalbe C, Lösel D, Block J, Lefaucheur L, Brüssow KP, Bellmann O, Pfuhl R, Puppe B, Otten W, Metges CC (2017) Moderate high or low maternal protein diets change gene expression but not the phenotype of skeletal muscle from porcine fetuses. Domest Anim Endocrinol 58:63–75PubMedCrossRef

21.

Geraghty AA, O’Brien EC, Alberdi G, Horan MK, Donnelly J, Larkin E, Segurado R, Mehegan J, Molloy EJ, McAuliffe FM (2018) Maternal protein intake during pregnancy is associated with child growth up to 5 years of age, but not through insulin-like growth factor-1: findings from the ROLO study. Br J Nutr 120(11):1252–1261. https://doi.org/10.1017/S0007114518002611 PubMedCrossRef

22.

Vitale G, Pellegrino G, Vollery M, Hofland LJ (2019) Role of IGF-1 system in the modulation of longevity: controversies and new insights from a centenarians’ perspective. Front Endocrinol (Lausanne) 10:27. https://doi.org/10.3389/fendo.2019.00027 CrossRef

23.

Tsukada A, Ohkubo T, Sakaguchi K, Tanaka M, Nakashima K, Hayashida Y, Wakita M, Hoshino S (1998) Thyroid hormones are involved in insulin-like growth factor-I (IGF-I) production by stimulating hepatic growth hormone receptor (GHR) gene expression in the chicken. Growth Horm IGF Res 8(3):235–242PubMedCrossRef

24.

Saenz de Miera C, Bothorel B, Jaeger C, Simonneaux V, Hazlerigg D (2017) Maternal photoperiod programs hypothalamic thyroid status via the fetal pituitary gland. Proc Natl Acad Sci USA 114(31):8408–8413. https://doi.org/10.1073/pnas.1702943114 PubMedCrossRefPubMedCentral

25.

Micke GC, Sullivan TM, Kennaway DJ, Hernandez-Medrano J, Perry VE (2015) Maternal endocrine adaptation throughout pregnancy to nutrient manipulation: consequences for sexually dimorphic programming of thyroid hormones and development of their progeny. Theriogenology 83(4):604–615. https://doi.org/10.1016/j.theriogenology.2014 PubMedCrossRef

26.

Perks CM, Holly JM (2015) Epigenetic regulation of insulin-like growth factor binding protein-3 (IGFBP-3) in cancer. J Cell Commun Signal 9(2):159–166. https://doi.org/10.1007/s12079-015-0294-6 PubMedPubMedCentralCrossRef

27.

Nawathe AR, Christian M, Kim SH, Johnson M, Savvidou MD, Terzidou V (2016) Insulin-like growth factor axis in pregnancies affected by fetal growth disorders. Clinical epigenetics 8:11. https://doi.org/10.1186/s13148-016-0178-5 PubMedCrossRefPubMedCentral

28.

Jia Y, Cong R, Li R, Yang X, Sun Q, Parvizi N, Zhao R (2012) Maternal low-protein diet induces gender-dependent changes in epigenetic regulation of the glucose-6-phosphatase gene in newborn piglet liver. J Nutr 142(9):1659–1665. https://doi.org/10.3945/jn.112.160341 PubMedCrossRef

29.

Cong R, Jia Y, Li R, Ni Y, Yang X, Sun Q, Parvizi N, Zhao R (2012) Maternal low-protein diet causes epigenetic deregulation of HMGCR and CYP7alpha1 in the liver of weaning piglets. J Nutr Biochem 23(12):1647–1654. https://doi.org/10.1016/j.jnutbio.2011.11.007 PubMedCrossRef

30.

Suter MA, Ma J, Vuguin PM, Hartil K, Fiallo A, Harris RA, Charron MJ, Aagaard KM (2014) In utero exposure to a maternal high-fat diet alters the epigenetic histone code in a murine model. Am J Obstet Gynecol 210 (5):463 e461-463 e411, 10.1016/j.ajog.2014.01.045

31.

Cai D, Yuan M, Jia Y, Liu H, Hu Y, Zhao R (2015) Maternal gestational betaine supplementation-mediated suppression of hepatic cyclin D2 and presenilin1 gene in newborn piglets is associated with epigenetic regulation of the STAT3-dependent pathway. J Nutr Biochem 26(12):1622–1631. https://doi.org/10.1016/j.jnutbio.2015.08.007 PubMedCrossRef

32.

Cai D, Li H, Zhou B, Han L, Zhang X, Yang G (2012) Conjugated linoleic acid supplementation caused reduction of perilipin1 and aberrant lipolysis in epididymal adipose tissue. Biochem Biophys Res Commun 422(4):621–626. https://doi.org/10.1016/j.bbrc.2012.05.038 PubMedCrossRef

33.

Cai D, Wang J, Jia Y, Liu H, Yuan M, Dong H, Zhao R (2016) Gestational dietary betaine supplementation suppresses hepatic expression of lipogenic genes in neonatal piglets through epigenetic and glucocorticoid receptor-dependent mechanisms. Biochem Biophys Acta 1861(1):41–50. https://doi.org/10.1016/j.bbalip.2015 PubMedCrossRef

34.

Jia Y, Gao G, Song H, Cai D, Yang X, Zhao R (2016) Low-protein diet fed to crossbred sows during pregnancy and lactation enhances myostatin gene expression through epigenetic regulation in skeletal muscle of weaning piglets. Eur J Nutr 55(3):1307–1314. https://doi.org/10.1007/s00394-015-0949-3 PubMedCrossRef

35.

Metges CC, Gors S, Lang IS, Hammon HM, Brussow KP, Weitzel JM, Nurnberg G, Rehfeldt C, Otten W (2014) Low and high dietary protein:carbohydrate ratios during pregnancy affect materno-fetal glucose metabolism in pigs. J Nutr 144(2):155–163. https://doi.org/10.3945/jn.113.182691 PubMedCrossRef

36.

Thompson AL, Lampl M (2013) Prenatal and postnatal energetic conditions and sex steroids levels across the first year of life. Am J Hum Biol 25(5):643–654. https://doi.org/10.1002/ajhb.22424 PubMedPubMedCentralCrossRef

37.

Reinehr T (2010) Obesity and thyroid function. Mol Cell Endocrinol 316(2):165–171. https://doi.org/10.1016/j.mce.2009.06.005 PubMedCrossRef

38.

Mullur R, Liu YY, Brent GA (2014) Thyroid hormone regulation of metabolism. Physiol Rev 94(2):355–382. https://doi.org/10.1152/physrev.00030.2013 PubMedPubMedCentralCrossRef

39.

Liu G, Liang L, Bray GA, Qi L, Hu FB, Rood J, Sacks FM, Sun Q (2017) Thyroid hormones and changes in body weight and metabolic parameters in response to weight loss diets: the pounds lost trial. Int J Obes (Lond) 41(6):878–886. https://doi.org/10.1038/ijo.2017.28 CrossRef

40.

Switkowski KM, Jacques PF, Must A, Hivert M-F, Fleisch A, Gillman MW, Rifas-Shiman S, Oken E (2017) Higher maternal protein intake during pregnancy is associated with lower cord blood concentrations of insulin-like growth factor (IGF)-II, IGF binding protein 3, and insulin, but not IGF-I, in a cohort of women with high protein Intake. J Nutr 147(7):1392–1400. https://doi.org/10.3945/jn.117.250589 PubMedPubMedCentralCrossRef

41.

Osgerby JC, Wathes DC, Howard D, Gadd TS (2002) The effect of maternal undernutrition on ovine fetal growth. J Endocrinol 173(1):131–141PubMedCrossRef

42.

Igwebuike UM (2010) Impact of maternal nutrition on ovine foetoplacental development: a review of the role of insulin-like growth factors. Anim Reprod Sci 121(3–4):189–196. https://doi.org/10.1016/j.anireprosci.20 PubMedCrossRef

43.

Singhal A (2017) Long-term adverse effects of early growth acceleration or catch-up growth. Ann Nutr Metab 70(3):236–240. https://doi.org/10.1159/000464302 PubMedCrossRef

44.

Silveira PP, Pokhvisneva I, Gaudreau H, Rifkin-Graboi A, Broekman BFP, Steiner M, Levitan R, Parent C, Diorio J, Meaney MJ (2018) Birth weight and catch up growth are associated with childhood impulsivity in two independent cohorts. Sci Rep 8(1):13705. https://doi.org/10.1038/s41598-018-31816-5 PubMedPubMedCentralCrossRef

45.

Zhang DL, Du Q, Djemli A, Julien P, Fraser WD, Luo ZC (2017) Early and late postnatal accelerated growth have distinct effects on metabolic health in normal birth weight infants. Front Endocrinol (Lausanne) 8:340. https://doi.org/10.3389/fendo.2017.00340 CrossRef

46.

Zheng J, Xiao X, Zhang Q, Wang T, Yu M, Xu J (2017) Maternal low-protein diet modulates glucose metabolism and hepatic microRNAs expression in the early life of offspring dagger. Nutrients. https://doi.org/10.3390/nu9030205 PubMedPubMedCentralCrossRef

47.

Brown A, Lee MD (2015) Early influences on child satiety-responsiveness: the role of weaning style. Pediatr Obes 10(1):57–66. https://doi.org/10.1111/j.2047-63 PubMedCrossRef

48.

McOrist S, Mellits KH (2010) The important lifetime effects of intestinal gut health of pigs at weaning. Vet J 184(3):253–254. https://doi.org/10.1016/j.tvjl.2009.06.021 PubMedCrossRef

49.

Cai D, Yuan M, Liu H, Pan S, Ma W, Hong J, Zhao R (2016) Maternal betaine supplementation throughout gestation and lactation modifies hepatic cholesterol metabolic genes in weaning piglets via AMPK/LXR-mediated pathway and histone modification. Nutrients. https://doi.org/10.3390/nu8100646 PubMedPubMedCentralCrossRef

50.

Ocklenburg S, Schmitz J, Moinfar Z, Moser D, Klose R, Lor S, Kunz G, Tegenthoff M, Faustmann P, Francks C, Epplen JT, Kumsta R, Gunturkun O (2017) Epigenetic regulation of lateralized fetal spinal gene expression underlies hemispheric asymmetries. eLife. https://doi.org/10.7554/elife.22784 PubMedPubMedCentralCrossRef

51.

Cai D, Jia Y, Lu J, Yuan M, Sui S, Song H, Zhao R (2014) Maternal dietary betaine supplementation modifies hepatic expression of cholesterol metabolic genes via epigenetic mechanisms in newborn piglets. Br J Nutr 112(9):1459–1468. https://doi.org/10.1017/S0007114514002402 PubMedCrossRef

52.

Lee HS (2015) Impact of maternal diet on the epigenome during in utero life and the developmental programming of diseases in childhood and adulthood. Nutrients 7(11):9492–9507. https://doi.org/10.3390/nu7115467 PubMedCrossRefPubMedCentral

Titel: Maternal high-protein diet modulates hepatic growth axis in weaning piglets by reprogramming the IGFBP-3 gene
verfasst von: Rihua Cong
Xiaoli Qu
Hui Zhang
Yongling Hu
Silin Ye
Demin Cai
Xian Li
Hao-Yu Liu
Publikationsdatum: 30.09.2019
Verlag: Springer Berlin Heidelberg
Erschienen in: European Journal of Nutrition / Ausgabe 6/2020
Print ISSN: 1436-6207
Elektronische ISSN: 1436-6215
DOI: https://doi.org/10.1007/s00394-019-02097-z

Leitlinien kompakt für die Innere Medizin

Mit medbee Pocketcards sicher entscheiden.

^{Seit 2022 gehört die medbee GmbH zum Springer Medizin Verlag}

Kostenlos registrieren

Neu im Fachgebiet Innere Medizin

Echinokokkose medikamentös behandeln oder operieren?

06.05.2024 DCK 2024 Kongressbericht

Die Therapie von Echinokokkosen sollte immer in spezialisierten Zentren erfolgen. Eine symptomlose Echinokokkose kann – egal ob von Hunde- oder Fuchsbandwurm ausgelöst – konservativ erfolgen. Wenn eine Op. nötig ist, kann es sinnvoll sein, vorher Zysten zu leeren und zu desinfizieren.

Umsetzung der POMGAT-Leitlinie läuft

03.05.2024 DCK 2024 Kongressbericht

Seit November 2023 gibt es evidenzbasierte Empfehlungen zum perioperativen Management bei gastrointestinalen Tumoren (POMGAT) auf S3-Niveau. Vieles wird schon entsprechend der Empfehlungen durchgeführt. Wo es im Alltag noch hapert, zeigt eine Umfrage in einem Klinikverbund.

Proximale Humerusfraktur: Auch 100-Jährige operieren?

01.05.2024 DCK 2024 Kongressbericht

Mit dem demographischen Wandel versorgt auch die Chirurgie immer mehr betagte Menschen. Von Entwicklungen wie Fast-Track können auch ältere Menschen profitieren und bei proximaler Humerusfraktur können selbst manche 100-Jährige noch sicher operiert werden.

Die „Zehn Gebote“ des Endokarditis-Managements

30.04.2024 Endokarditis Leitlinie kompakt

Worauf kommt es beim Management von Personen mit infektiöser Endokarditis an? Eine Kardiologin und ein Kardiologe fassen die zehn wichtigsten Punkte der neuen ESC-Leitlinie zusammen.

Update Innere Medizin

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.

Newsletter bestellen

Springer Medizin

Abstract

Purpose

Methods

Results

Conclusions

Introduction

Methods

Animals and sampling

Tch, insulin and IGFBP-3 in serum

Total RNA isolation and mRNA quantification

Tissue protein extraction and Western blot analysis

Methylated DNA immunoprecipitation (MeDIP)

Chromatin immunoprecipitation (ChIP)

Statistical analysis

Results

A maternal high-protein diet increases the body and liver weight of piglets and alters serum parameters

A maternal high-protein diet reduces liver IGFBP-3 protein content and serum IGFBP-3 level in weaning piglets

Maternal high-protein diet downregulates liver IGFBP-3 transcript

Epigenetic regulation of the IGFBP-3 gene in HP-exposed weaning piglets

Discussion

Acknowledgements

Compliance with ethical standards

Conflict of interest

Unsere Produktempfehlungen

Neuer Inhalt

e.Med Interdisziplinär

Weitere Artikel der Ausgabe 6/2020

Saturated and monounsaturated fatty acids in membranes are determined by the gene expression of their metabolizing enzymes SCD1 and ELOVL6 regulated by the intake of dietary fat

Creatinine, total cysteine and uric acid are associated with serum retinol in patients with cardiovascular disease

Is there a soft drink vs. alcohol seesaw? A cross-sectional analysis of dietary data in the Australian Health Survey 2011–12

Modelling the impact of mandatory folic acid fortification of bread or flour in Ireland on the risk of occurrence of NTD-affected pregnancies in women of childbearing age and on risk of masking vitamin B12 deficiency in older adults

Co-ingestion of whey protein hydrolysate with milk minerals rich in calcium potently stimulates glucagon-like peptide-1 secretion: an RCT in healthy adults

Metabolically and immunologically beneficial impact of extra virgin olive and flaxseed oils on composition of gut microbiota in mice

Leitlinien kompakt für die Innere Medizin

Neu im Fachgebiet Innere Medizin

Echinokokkose medikamentös behandeln oder operieren?

Umsetzung der POMGAT-Leitlinie läuft

Proximale Humerusfraktur: Auch 100-Jährige operieren?

Die „Zehn Gebote“ des Endokarditis-Managements

Update Innere Medizin