Metallothionein III (MT3) is a putative tumor suppressor gene that is frequently inactivated in pediatric acute myeloid leukemia by promoter hypermethylation

Leukemia cell lines HL-60, MV4-11, U937, DAMI and K562 were obtained from the American Type Culture Collection (ATCC). CCRF, Raji, Jurkat, 697 and SHI-1 cell lines (gifts from Professor Wang Jian-Rong, The Cyrus Tang Hematology center of Soochow University). All cell lines were maintained at 37°C in the RPMI 1640 (GibcoR, Life Technologies, Carlsbad, CA) supplemented with 10% fetal bovine serum (Invitrogen, Life Technologies, Carlsbad, CA).

Bone marrow specimens were obtained at the time of diagnosis during routine clinical assessment of 41 pediatric patients with AML, who presented at the Department of Hematology and Oncology, Children’s Hospital of Soochow University between 2000 and 2010. Ethical approval was provided by the Children’s Hospital of Soochow University Ethics Committee (No. SUEC2000-021), and informed consent was obtained from the parents or guardians. AML diagnosis was made in accordance with the revised French–American–British (FAB) classification. The main clinical and laboratory features of the patient cohort are summarized in Table 1. Additionally, bone marrow samples from 12 healthy donors and 8 patients with Idiopathic thrombocytopenic purpura (ITP) were analyzed as controls. Bone marrow mononuclear cells (BMNCs) were isolated using Ficoll solution within 2 h after bone marrow samples harvested and immediately subjected for the extraction of total RNA and genomic DNA.

For CD34 ⁺cell selection, the Miltenyi immunoaffinity device (VarioMACS 130-046-703) was used according to the manufacturer’s instructions (Miltenyi Biotech, Auburn, CA). Briefly, the CD34⁺ cells are magnetically labeled with CD34 MicroBeads. Then, the cell suspension is loaded onto a MACSR Column which is placed in the magnetic field of a MACS Separator. The magnetically labeled CD34⁺ cells are retained within the column. The unlabeled cells run through; CD34⁺ cells were adsorbed on the magnetic poles. After removing the column from the magnetic field, the magnetically retained CD34⁺ cells can be eluted as the positively selected cell fraction.

High-molecular-weight genomic DNA was extracted from cell lines and biopsies by a conventional phenol/chloroform method. The sodium bisulphite modification procedure was as described [27] with slight modification. In brief, 600 ng of genomic DNA was denatured in 3 M NaOH for 15 min at 37°C, then mixed with 2 volumes of 2% low-melting-point agarose. Agarose/DNA mixtures were then pipetted into chilled mineral oil to form agarose beads. Aliquots of 200 μl of 5 M bisulphite solution (2.5 M sodium metabisulphite, 100 mM hydroquinone, both Sigma, USA) were added into each tube containing a single bead. The bisulphite reaction was then carried out by incubating the reaction mixture for 4 h at 50°C in the dark. Treatments were stopped by equilibration against 1 ml of TE buffer, followed by desulphonation in 500 μl of 0.2 M NaOH. Finally, the beads were washed with 1 ml of TE buffer and directly used for PCR.

The methylation status of the MT-3 promoter region was determined by methylation-specific PCR. Primers distinguishing unmethylated (U) and methylated (M) alleles were designed to amplify the sequence:

MT-3 M-forward: 5- TTAAGCGTATAAACGGAAAGAGC -3;

MT-3 M-reverse: 5- AAAACAAATCTCAAAATCCATATCG -3;

MT-3 U-forward: 5- TTTAAGTGTATAAATGGAAAGAGTGG -3;

MT-3 U-reverse: 5- AACAAATCTCAAAATCCATATCAAA -3.

Each PCR reaction contained 20 ng of sodium bisulphite-modified DNA, 250 pmol of each primer, 250 pmol deoxynucleoside triphosphate, 1 × PCR buffer, and one unit of ExTaq HS polymerase (Takara, Tokyo) in a final reaction volume of 20 μl. Cycling conditions were initial denaturation at 95°C for 3 min, 40 cycles of 94°C for 30 s, 60°C (M) or 58°C (U) for 30 s, and 72°C for 30 s. For each set of methylation-specific PCR reactions, in vitro-methylated genomic DNA treated with sodium bisulphite served as a positive methylation control. PCR products were separated on 4% agarose gels, stained with ethidium bromide and visualized under UV illumination. For cases with borderline results, PCR analyses were repeated.

Bisulfite genomic sequencing (BGS) was performed as previously described [28]. BGS primers were from +427 to +672 including 15 CpGs. MT-3 F: 5- AGGGAGATTTGGTATTTTATTTTTT-3 and MT-3 R: 5- ACCTAACTATCTCTCCACATCCTAC-3. Amplified BGS products were TA-cloned; and five to six randomly chosen colonies were sequenced. DNA sequences were analyzed with QUMA Analyzer. (http://​quma.​cdb.​riken.​jp/​).

De-methylation was induced with 5-aza-dC (5-Aza, Sigma-Aldrich, St Louis, MO, USA) treatment at a concentration that induced de-methylation of the DNA without killing the cells. Culture media for HL-60 and MV4-11 cells contained 5 μM 5-Aza. DNA and RNA were extracted after 72 hours of 5-Aza treatment for the following analysis.

Quantitative real-time PCR was performed to determine the expression levels of MT-3 genes. Total RNA was reverse transcribed using the Reverse Transcription Kit, according to the manufacturer’s protocol (Applied Biosystems Inc., Foster City, CA). The real time PCR primers used to quantify GAPDH expression were: F: 5′-AGAAGGCTGGGGCTCATTTG-3′ and R: 5′-AGGGGCCATCCACAGTCTTC-3′ and for MT-3 were: F: 5′-ACACACAGTCCTTGGCACAC-3′ and R: 5′-AAGTGCGAGGGATGCAAAT-3′. Expression of MT-3 was normalized to endogenous GAPDH expression.

Briefly, an approximately 250 bp fragment containing the human MT-3 gene was directly synthesized, and cloned into the pMD18-T vector. Positive clones were confirmed by sequencing and subcloned into the pLVX-IRES-ZsGreen vector (Clontech). The vector plasmids, pLVX-IRES-ZsGreen1, pLP1, pLP2 and pLP/VSVG were amplified in E.Coli and purified using the Endofree Maxiprep Kit (Qiagen). 270 μg of transfer vector, 176 μg of pLP1, 95 μg of pLP/VSVG and 68 μg of pLP2 was mixed with 0.25 M CaCl2 (Sigma) and added to same volume of 2 × HEPES (Sigma) and mixed while bubbling for 20 min to allow a precipitate to form. This was then added to a 175 cm2 flask of approximately 60% confluent 293 T cells containing 20 mL DMEM supplemented with 10% fetal calf serum, 100 U/mL penicillin, 100 μg/mL streptomycin and 2 mM glutamine and incubated for 48 h at 37°C in 5% CO2. The supernatant was centrifuged at 1,700 g for 10 min to pellet cell debris, and ultracentrifuged at 121,603 g for 2 h. The pellet containing concentrated virus was resuspended in DMEM without supplements and stored at -80°C.

Acute myeloid leukemia cells were seeded in 96-well plates at 2 × 10⁴ cells per well. 20 ul CCK-8(Dojindo Molecular Technologies, Japan) was added to each well and incubated at 37°C for a further 4 hours. The optical density (OD) values were measured at 450 nm on a scanning multi-well spectrophotometer (BioRad Model 550, USA). Compared with the control group, Cell proliferation was calculated as proliferation values. All experiments were performed in triplicate and repeated twice. The results were analyzed using ANOVA and the Student-Newman-Keuls tests, p < 0.05 were considered significant.

Apoptosis assay was according to the manual operation of BD Annexin V Staining Kit (Cat: 556420, BD Biosciences, Franklin Lakes and NJ USA). Briefly, wash cells twice with cold PBS and then resuspend cells in 1 × Binding Buffer at a concentration of ~1 × 10⁶ cells/ml. Transfer 100 μl of the solution (~1 × 10⁵ cells) to a 5 ml culture tube. Add Annexin V and PI 5 μl/test. Gently mix the cells and incubate for 15 min at RT in the dark. Add 400 μl of 1 × Binding Buffer to each tube. Analyze by flow cytometry as soon as possible (within 1 hour).

For western blot analysis, cellular proteins were extracted in 40 mM Tris–HCl (pH 7.4) containing 150 mM NaCl and 1% (v/v) Triton X-100, supplemented with a cocktail of protease inhibitors. Equal amounts of protein were resolved on 12% SDS-PAGE gels, and then transferred to a PVDF membrane (Millipore, Bedford, MA). Blots were blocked and then probed with antibodies against MT-3(1:1000, Abcam, Cambridge, MA Office, USA), PARP (1:1000, Cell Signaling Technology, Inc. Danvers, MA), FOXO1 (1:1000, Cell Signaling Technology, Inc. Danvers, MA), CDKN1A (1:1000, Cell Signaling Technology, Inc. Danvers, MA), GAPDH (1:5000, Sigma, St. Louis, MO). After washing, the blots were incubated with horseradish peroxidase-conjugated secondary antibodies and visualized by enhanced chemiluminescence kit (Pierce, Rockford, IL). Protein bands were visualized after exposure of the membrane to Kodak X-ray film.

For RNA extraction, cells were immediately submerged in 2 ml Trizol (Invitrogen Co., NY, USA), stored at -80°C until further processed. A volume of 1 ml of each sample was spun at 4°C for 15 min at 12,000 g to remove debris and DNA, 1 ml of supernatant was mixed with 200 ul chloroform, shaken for 15 seconds, incubated at Room Temperature for 2–3 minutes and spun for 10 minutes at 12,000 g at 4°C. RNA was precipitated by adding 500 ul of the aqueous phase to an equal volume of isopropanol and spun at 14,000 g at 4°C for 10 minutes. RNA was washed with 75% ethanol, spun at 14,000 g at 4°C for 10 minutes, dried and resuspended in 40 ul DEPC-treated H2O. The final RNA concentration was determined using a spectrophotometer (Nanodrop 2000) and the purity was assessed by agarose gel electrophoresis. cDNA synthesis was performed on 4 ug of RNA in a 10 ul sample volume using SuperScript II reverse transcriptase (Invitrogen Co., NY, USA) as recommended by the manufacturer. The RNA was incubated with 0.5 ug of oligo (dT)12–18mers primers (Invitrogen Co., NY, USA) for 7 minutes at 70°C and then transferred onto ice. Then, 9 ul of a master mix containing 4 ul of SuperScript II buffer, 2 ul of 0.1 M DTT, and 1 ul each of dNTPs stock (10 mM), Rnasin (40 UI) and SuperScript II were added to the RNA sample, spun and incubated at 42°C for 60 min followed by 5 min at 70°C to inactivate the enzyme. cDNA was stored at -20°C. Real-time PCR array (SABioscience Human Apoptosis PCR Array PAHS-3012) analysis was performed in a total volume of 20 ul including 2ul of cDNA, primers (0.2 mM each) and 10 ul of SYBR Green mix (Roche Co., Basel, Switzerland). Reactions were run on an Light cycler 480 using the universal thermal cycling parameters (95°C 5 min, 45 cycles of 10 sec at 95°C, 20 sec at 60°C and 15 sec at 72°C; melting curve: 10 sec at 95°C, 60 sec at 60°C and continues melting). Results were obtained using the sequence detection software Light cycler 480 and analyzed using Microsoft Excel. For all samples melting curves were acquired for quality control purposes. For gene expression quantification, we used the comparative Ct method. First, gene expression levels for each sample were normalized to the expression level of the housekeeping gene encoding Glyceraldehydes 3-phosphate dehydrogenase (GAPDH) within a given sample (-⊿Ct); the relative expression of each gene was calculated with 10⁵ *Log2(-⊿Ct). The difference between the MT-3 over-expression samples compared to the control samples was used to determine the 10⁶ *Log2(-⊿Ct). Statistical significance of the gene expression difference between the MT-3 over-expression and the control samples was calculated with the T-test using SPSS 11.5 software.

Our long-term research is focused on epigenic modification in pediatric AML and we have found a series of abnormal methylated genes related with AML [29, 30]. In this study we conducted CpG island array analysis to explore promoter methylation in pediatric AML. The hypermethylated and hypomethylated genes between AML and NBM were clustered in Figure 1 and Additional file 1. The results implied that the MT3 promoter was hypermethylated in AML. Subsequent analyses identified four CpG islands in the MT3 promoter region (Figure 2A). Therefore, we conducted an MSP assay in 11 leukemia cell lines using a primer for MSP analysis that encompassed the CpG islands in the MT3 promoter. Our results showed that the MT3 promoter was hypermethylated in 7/11 leukemia cell lines, with the highest methylation levels observed in HL-60, MV4-11 SHI-1, U937 and K562 cells; whereas it was unmethylated in 4/11 cell lines, 697, SHI-1, THP-1 and Jurkat (Figure 2B). To confirm methylation of the MT3 promoter, we treated the leukemia cell lines with 5-Aza. This demethylation reagent is an epigenetic modifier that inhibits DNA methyltransferase activity resulting in hypomethylation and gene activation. PCR analysis showed that methylation status of MT3 was decreased in leukemia cells following 5-Aza treatment compared to control cells treated with DMSO. Our results showed that MT3 expression was significantly upregulated in leukemia cells following 5-Aza treatment compared to control cells treated with DMSO (Figure 2C): MT3 expression was upregulated 39.8 fold in HL-60 cells (24.27 vs. 0.61, respectively; P = 0.013); and 26.8 fold in MV4-11 cells (34.27 vs. 1.28, respectively; P = 0.006).

In order to examine the methylation status in the MT3 promoter in pediatric AML, we obtained samples from 41 patients with pediatric AML and 20 control patients with NBM/ITP. Aberrant MT3 methylation was observed in 39.0% (16/41) of the pediatric AML samples compared to 10.0% (2/20) of the NBM control samp (Figure 3A). Six NBM samples and six AML samples were selected for further analysis by BGS (Figure 3B). Consistent with the MSP results, these confirmed that the CpG islands in the MT3 promoter were methylated in the AML samples (68%-86.7%); whereas they were unmethylated in the NBM samples (49.3%-61.3%).

Examination of the clinicopathologic characteristics in patients with pediatric AML revealed that there were no significant differences in clinical features, such as sex, age, initial hemoglobin level, white blood cell counts, platelet counts and chromosomal abnormalities between those with methylated MT3 and those with unmethylated MT3 (Table 1).

Real-time qPCR was employed to examine the transcript levels of MT3 in the 41 pediatric AML samples and 20 NBM/ITP control samples (Figure 3C; Table 1). MT3 expression was found to be significantly decreased in the AML samples compared to the control samples (16.37 ± 15.09 vs. 55.25 ± 18.34; P < 0.001). Further analysis of the AML samples showed that 16/41 patients with pediatric AML displayed methylated MT3 compared to 25/41 patients with unmethylated MT3 (Table 1). Furthermore, those with methylated MT3 showed significantly lower levels of MT3 expression compared to those with unmethylated MT3 (10.65 ± 10.19 vs. 19.23 ± 16.93; P = 0.049; Figure 3D). In summary the hypermethylation status of the MT3 promoter in samples from patients with pediatric AML was consistent with results in human myeloid leukemia cell lines.

Transfection of the PLVX-MT3 lentivirus into HL-60 and MV4-11 leukemia cells was found to significantly upregulate expression of MT3 (Figure 4A) and significantly inhibit cell proliferation (Figure 4B). A CCK-8 assay in HL-60 and MV4-11cells showed that the inhibition rate at 5 days post-transfection was 43.7 ± 30.1% and 51.1 ± 26.8% in MT3-overexpessing cells compared to the mock transfection group (P < 0.05).

To determine whether MT3 induced apoptosis in leukemia cells, we performed an Annexin V assay in HL-60 and MV4-11 leukemia cells following transfection (Figure 4C and D). The results showed that the proportion of apoptotic cells in the MT3-overexpressing cells (PLVX-MT3) was significantly greater than that in the control group (PLVX-Ve): HL-60 (8.40% ± 1.04% vs. 0.5% ± 0.3%, respectively; P = 0.003); and MV4-11 (7.53% ± 1.49% vs. 0.73 ± 0.21%, respectively; P = 0.014).To further investigate the apoptotic effect of MT3 in HL-60 and MV4-11 cells, we investigated the expression levels of cleaved PARP, a marker of apoptosis, by Western blotting. The results were consistent with the Annexin V data, confirming that MT3 induced apoptosis in leukemia cells (Figure 4A).

In order to identify the apoptosis-related genes implicated in MT3 overexpression in HL-60 cells, we analyzed expression and clustering of 370 key genes associated with apoptosis by real-time PCR array analysis, cells harboring empty vector or a vector overexpressing MT3 were subjected to real-time PCR array (Figure 5A). The genes most significantly downregulated or upregulated are shown in Figures 5B and 5C, respectively. Examination of the array data revealed that 17 genes were significantly upregulated and 17 genes were significantly downregulated in the MT3-overexpressing group compared to the control group (Tables 2 and 3, respectively). These included TNF (tumor necrosis factor) ligands and their receptors, members of the bcl-2 family, BIRC (baculoviral IAP repeat) domain proteins, CARD (caspase recruitment domain) proteins, death domain proteins, TRAF (TNF receptor-associated factor) domain proteins, and caspases. FOXO1 was found to be the most upregulated gene in MT3-overexpressing group. The up-regulation of FOXO1 and CDKN1A in MT3-overexpressing group was vivificated with western-blot analysis (Figure 6).