Background
Ovarian cancer (OC) is a frequent gynecological malignancy which accounts for 3.4% incidence and 4.4% mortality among all cancers in female with approximately 295,414 new cases and 184,799 deaths identified worldwide in 2018 [
1]. Most OCs are originated in epithelium and therapeutic strategy prioritizes surgical resection and cytoreduction followed by cytotoxic chemotherapy such as platinum and taxane [
2]. Early diagnosis is a decisive factor for better survival, since patients at advanced stages having an initial response to the conventional treatment are likely to develop recurrence during the clinical course [
2,
3]. Unfortunately, due to the lack of specific symptoms, approximately 70% of patients are diagnosed at late stages and have a less than 50% overall 5-year survival rate [
4]. Substantial efforts have been made by researchers in this field to develop new diagnostic and therapeutic tools or targets for OC control, while insightful understandings in the molecular mechanisms implicated in the disease progression are still needed.
MicroRNAs (miRNAs) have been increasingly accepted to impact cancer disease progression. They are small non-coding RNA molecules (approximately 22 nucleotides in length) abundantly existed in animals and plants with the primary function in mRNA silencing through regulation of gene expression post-transcriptionally [
5]. miRNAs are closely linked to nearly every carcinogenesis process from tumor development to drug resistance in human cancers including OC [
6]. Among the miRNAs, miR-545 has been reported with a tumor-suppressing role in another gynecological malignancy, cervical cancer, by suppressing proliferation and aggressiveness of cancer cells [
7]. Likewise, miR-545 has been reported as a potential tumor suppressor that was poorly expressed in OC tissues [
8]. These findings attracted our attention to validate the role of miR-545 in OC progression and the molecules involved. Polo-like kinase 1 (PLK1) and Lysine (K)-specific demethylase 4B (KDM4B), both of which have been reported to be highly expressed in OC cells and trigger cancer development [
9,
10], were found as mRNA targets of miR-545 according to the data on a bioinformatic system StarBase (
http://starbase.sysu.edu.cn/). KDM4B is a member of the KDM4/JMJD2 family of histone demethylases that regulate the catalytic activity against the histone residues with a preference to the H3K9me2/3 substrates which are related to gene repression [
11]. Interestingly, KDM4B was found to activate the transcription of PLK1 through the demethylation modification of H3K9me3, therefore promoting the growth of prostate tumor [
12]. This triggered us to explore if there is a similar regulatory work in OC. Hence, this study was performed to validate the potential interactions among miR-545, KDM4B and PLK1 and their functions on OC development by altering their expression in both cellular and animal experiments.
Methods
Clinical sample collection
Tumor and the adjacent normal ovarian tissues (over 1.5 cm away from the lesion sites) were obtained from 60 OC patients who were admitted into and underwent surgery in The Second Affiliated Hospital of Zhengzhou University from April 2012 to January 2014. All recruited patients were free of a history of radio- or chemo-therapy, and free of any other malignancies neither. The tissue samples were collected during surgery and then instantly preserved at − 80 °C. This study was conducted as per the Declaration of Helsinki and ratified by the Ethics Committee of The Second Affiliated Hospital of Zhengzhou University. Each eligible patient signed an informed consent.
Cell preparation
OC cell lines (Caov3, OV-90, OVCAR3 and ES-2) acquired from ATCC (Manassas, VA, USA) were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Invitrogen, Thermo Fisher Scientific, Rockford, IL, USA). A human immortalized ovarian epithelial cell line SV40 acquired from Applied Biological Materials Inc. (Richmond, Canada) was cultivated in Prigrow I medium (Abm, Richmond, Canada). All media were supplemented with 10% fetal bovine serum (FBS, Hyclone, Logan, UT, USA) and 1% penicillin/streptomycin (Gibco, Thermo Fisher) at 37 °C in air enriched by 5% CO2.
The miR-545 mimic, overexpressing vector of KDM4B (oe-KDM4B), oe-PLK1 and the corresponding negative controls (NC) used for transfection were all purchased from GenePharma Co., Ltd. (Shanghai, China). All transfections were conducted using a Lipofectamine 2000 kit (Invitrogen) in line with the manufacturer’s instructions. The transfection efficacy was determined 48 h later by reverse transcription quantitative polymerase chain reaction (RT-qPCR) or western blot assays.
RT-qPCR
The TRIzol Reagent (Invitrogen) was used for extract total RNA from tissues and cells. RNA was reversely transcribed into cDNA using a miScript II RT kit (TaKaRa, Biotechnology Ltd., Dalian, China) and then the real-time qPCR was performed using a Premix Ex TaqTM II (TaKaRa) on an ABI PRISM 7500 real-time PCR System. Relative gene expression was determined by the 2
-ΔΔCt method. The primers are listed in Table
1, in which U6 and GAPDH were set as the internal references for miRNA and mRNAs, respectively.
Table 1
Primer sequences for RT-qPCR
miR-545 | F: CGACAAGGGTCAGCAAACATT |
R: GCAGGGTCCGAGGTATTC |
Bax | F: TCAGGATGCGTCCACCAAGAAG |
R: TGTGTCCACGGCGGCAATCATC |
Bcl-2 | F: ATCGCCCTGTGGAGAACTACTGAGT |
R: GCCAGGAGAAATCAAACAGAGGC |
KDM4B | F: GCCGAGAGGAAGTTCAACGCAG |
R: TGCCTCCTTCTCAGAGTGTGTAGG |
PLK1 | F: GCACAGTGTCAATGCCTCCAAG |
R: GCCGTACTTGTCCGAATAGTCC |
U6 | F: CTCGCTTCGGCAGCACA |
R: AACGCTTCACGCATTTGC |
GAPDH | F: GTCTCCTCTGACTTCAACAGCG |
R: ACCACCCTGTTGCTGTAGCCAA |
3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT) assay
Viability of cells was evaluated by the MTT assay. In brief, the transfected cells were sorted in 96-well plates at 3000 cells per well. Forty-eight hours later, each well was loaded with 20 μL MTT solution (5 mg/mL, Solarbio Science & Technology Co., Ltd., Beijing, China). Following another 3 h of incubation at 37 °C, the supernatant was discarded and the precipitated formazan was dissolved in 150 μL dimethyl sulphoxide (DMSO) solution. Then, the optical density (OD) value was determined at 490 nm using a microplate spectrophotometer.
5-ethynyl-2′-deoxyuridine (EdU) labeling assay
A Cell-Light EdU DNA replication kit (RiboBio Co., Ltd., Guangzhou, Guangdong, China) was used to evaluate cell proliferation. In brief, cells were sorted in 96-well plates (2 × 104 cells/well). After 36 h, each well was filled with 50 μM EdU solution for another 3 h of incubation. Next, the cells were immobilized in formaldehyde and stained with Apollo solution. Hoechst 33342 was utilized to counterstain the nuclei. Images were obtained using an inverted fluorescence microscope (Olympus Optical Co., Ltd., Tokyo, Japan). The EdU-positive cells in 5 random fields were counted.
Briefly, cells were sorted in 6-well plates at 500 cells per well for 2 weeks (w). Then the cells were fixed, stained with 1% crystal violet, and counted under the microscope.
Terminal deoxynucleotidyl transferase (TdT)-mediated dUTP nick end labeling (TUNEL)
A TUNEL kit (Beyotime Biotechnology Co., Ltd., Shanghai, China) was used to measure cell apoptosis. The cells were fixed for 30 min (min) and then incubated in phosphate-buffered saline (PBS) containing 0.3% Triton X-100 for 5 min. After that, the cells were further treated with fresh TUNEL Reagent for 60 min of incubation at 37 °C without light exposure. Next, 4′, 6-diamidino-2-phenylindole (DAPI) was used for nuclear staining. Then, the cell slides were sealed by fluorescent mounting media and the relative fluorescence intensity was determined using an EVOS FL microscope (Invitrogen). The cell apoptosis rate was calculated as follows: apoptosis rate = TUNEL-positive cells (green fluorescence)/DAPI-labeled cells (blue fluorescence) × 100%.
Western blot analysis
OC cells were lysed in cell lysis buffer (Beyotime) containing protease and phosphatase inhibitors to extract the total protein. The protein concentration was evaluated by a bicinchoninic acid (BCA) kit (Thermo Fisher). Then, 30 μg protein sample was run on 12% SDS-PAGE and transferred onto PVDF membranes (Millipore, Billerica, MA, USA). After being blocked in 5% bovine serum albumin, the membranes were cultured with the primary antibodies against E-cadherin (1:50, ab1416, Abcam, Inc., Cambridge, MA, USA), N-cadherin (1:5000, ab76011, Abcam), Vimentin (1:1000, ab92547, Abcam); PLK1 (1:500, #4535, Cell Signaling Technology (CST), Beverly, MA, USA), KDM4B (1:5000, ab191434, Abcam), H3K9me3 (1:1000, ab176916, Abcam), and GAPDH (1:5000, ab8245, Abcam) at 4 °C overnight. Then, the membranes were stained with the secondary antibodies anti-mouse IgG H&L (HRP) (1:10,000, ab205719, Abcam) and goat anti-rabbit IgG H&L (HRP) (1:10,000, ab205718, Abcam) at 37 °C for 45 min. The protein blots were developed by enhanced chemiluminescence (Millipore) and examined on a gel imaging system (Bio-Rad, Hercules, CA, USA). GAPDH was set as the control, and the signal intensity was examined by Image J.
Scratch test
Transfected cells were sorted in 96-well plates with serum-free medium at 5 × 104 cells per well and cultivated overnight. A scratch was produced on the cells using pipette tips. The scratch width was evaluated on the 0 h and 24th h under the inverted microscope.
Transwell assay
A Transwell kit (Corning Incorporated, Corning, NY) was used for invasion detection. Each apical chamber pre-coated with Matrigel was loaded with 5 × 104 cells in serum-free medium, while each basolateral chamber was loaded with 500 μL complete medium. The chambers were incubated at 37 °C for 24 h, and then the cells on the upper membrane were discarded, while the invaded cells were fixed and stained by 0.1% crystal violet. Then, the staining was observed under the microscope with 5 fields included.
Angiogenesis assay
A total of 1.5 × 104 human umbilical vein endothelial cells (HUVECs, ATCC) were sorted in Matrigel-coated 24-well plates and cultured with conditioned medium (CM) of different OC cells for 6 h. Then, the cells were observed and captured under the inverted microscope, and the number of formed tubes in 5 random fields was calculated and determined using the Image J software.
Immunohistochemical (IHC) staining
Tumor tissues were fixed, embedded in paraffin, cut into 4-μm sections, dewaxed, and rehydrated. Then, the sections were soaked in 10 mmol/L prewarmed sodium citrate buffer (pH = 6.0) for 3 min of antigen retrieval, and then treated with 3% H
2O
2 for 10 min. Then, the sections were co-cultured with the primary antibodies against KDM4B (1:150, ab191434, Abcam), PLK1 (1:50, ab17056, Abcam), vascular endothelial growth factor A (VEGFA, 1:20, ab1316, Abcam) and Ki67 (1:20, ab21700, Abcam) at 4 °C overnight, and then with the goat anti-rabbit IgG H&L (HRP) (ab97051) or goat anti-mouse IgG H&L (HRP) (ab205719) at 37 °C for 45 min. Then, 3,3′-diaminobenzidine and hematoxylin reagent were used for color development. Then, the stained slides were imaged under a microscope, and the positive cells from 5 random fields were analyzed by the Image J. For the tissue samples from OC patients, the staining intensity was scored by three group-blinded pathologists according to a previous report [
13]. The percentage of positive cells was allocated into five grades (positive scores): 0–3% (0), 3–25% (1), 26–50% (2), 51–75% (3) and 76–100% (4), and the staining density was divided into four grades (intensity scores): negative (0), weak brown (1), median brown (2) and strong brown (3). The final score of IHC staining was the product of two scores, which was allocated into three grades: negative (≤ 3), weak positive (3 < score ≤ 6) and strong positive (> 6).
Dual-luciferase reporter gene assay
The wild type (WT) sequences of KDM4B mRNA (KDM4B-WT) and PLK1 mRNA (PLK1-WT) containing the putative binding site with miR-545, and the corresponding mutant type (MT) sequences (KDM4B-MT and PLK1-MT) based on the mutant binding sites were inserted into pmirGLO luciferase vectors (GeneCreate Biological Engineering Co., Ltd., Hubei, China). Then, 1 × 105 293 T cells (ATCC) were sorted in 24-well plates, and the well-constructed MT and WT vectors were co-transfected with either miR-545 mimic or NC mimic into the cells. Forty-eight hours later, the relative luciferase activity in cells was evaluated on a luciferase reporter gene system (Promega, Corp., Madison, Wisconsin, USA).
Chromatin immunoprecipitation (ChIP)
All procedures were carried out according to the instructions of a ChIP kit (Millipore). In short, 1 × 107 cells were crosslinked in 1% formaldehyde solution for 20 min. Then, the DNA fragments (200–500 bp) were obtained following ultrasonication. The lysates of OV-90 cells and ES-2 cells were precipitated by anti-KDM4B or anti-H3K9me2 with anti-IgG as control. The enrichment of PLK1 promoter in the immunoprecipitates was determined by RT-qPCR.
A total of 40 BALB/c nude mice (3–5 weeks old) from Vital River Laboratory Animal Technology Co., Ltd. (Beijing, China) were used for in vivo experiments. The animal experimental protocol was approved by the Ethics Committee of Animal Experiments of The Second Affiliated Hospital of Zhengzhou University. All animal procedures were performed in line with the Guide for the Care and Use of Laboratory Animals published by the National Institutes of Health (NIH, Bethesda, Maryland, USA). Great attempts were made to reduce the pain in animals. All animals were housed in a specific pathogen-free grade condition in a 12-h dark/light cycle at constant 22 ± 2 °C with 40% humidity. The mice were allowed to free access to water and feed. The complete formula feed sterilized via Co60 exposure and the drinking water were autoclaved. The feed and water were refreshed routinely twice a week and supplemented when necessary. The padding material was refreshed once a week. All procedures were performed by professional operators in sterile conditions.
For the tumor growth assay, 20 mice were assigned into 4 groups, and cells (1 × 105/mL) with stable transfection of miR-545 mimic or NC mimic were implanted into the ventral side of mice through subcutaneous injection. Ten days (d) after transfection, the volume (V) of xenograft tumors was evaluated every 5 d using the following formula: V = L × W2/2, where L indicates the length while W indicates the width. After 35 d, the mice were euthanized through an intraperitoneal injection of pentobarbital sodium (150 mg/kg), and the tumors were collected for weight and volume measurement. The tumor tissues were further used for IHC staining. The rest 20 mice were used for metastasis assay. In brief, cells with stable transfection (1 × 107/mL) were administrated into the mice through the caudal veins. The mice were euthanized on the 45th d, and then the lung tissues were collected for hematoxylin and eosin (HE) staining. The animal carcasses were collected as medical wastes and burned.
HE staining
The lung tissues of the nude mice were fixed in formaldehyde, dehydrated, embedded, and cut into sections. Then, the sections were dewaxed in xylene, rehydrated, and then stained with hematoxylin for 4 min and then with eosin for 1 min. After that, the sections were dehydrated, cleared, sealed, and observed under the microscope. The relative metastatic area in lung tissues was calculated using Image J.
Statistical analysis
Data were analyzed using Prism 8.0 (GraphPad, La Jolla, CA, USA). Data were presented as mean ± standard deviation (SD) from no less than three independent experiments. Differences were analyzed by t test (two groups) and one-way or two-way analysis of variance (ANOVA), followed by Tukey’s multiple test (over 2 groups). The Log-rank (Mantel-Cox) test was used to analyze the 5-year survival rate of patients. The correlations between variables were evaluated by Pearson’s correlation analysis. Clinical characteristics of patients were analyzed using Fisher’s exact test. *p < 0.05 was regarded to present statistical significance.
Discussion
Despite the surgical debulking and the administration of multiple antitumor treatment combinations, the overall 5-year survival rate of OC patients at advanced stages was no more than 40% with only modest improvement over decades [
14]. In addition, the traditional approaches of treatment largely depend on individuals’ health condition and medical history, and are often linked to side-effects including hair loss, fatigue, neuropathies, nausea, and inflammatory bowel disease [
15]. Developing less-invasive and effective options for OC control has been a crucial issue. In the current research, we identified a potent inhibitory function of miR-545 on OC cell and tumor growth through the suppression of PLK1 by direct binding or an indirect regulation by abrogating KDM4B-mediated PLK1 activation.
It has been well-established that altered expression of miRNAs is frequently associated with the ovarian tumorigenesis, leaving them as promising targets or markers for detection, prognosis and therapy [
16]. Either anti-oncogenic [
17‐
21] or oncogenic [
22‐
24] roles of miRNAs have been recognized in OC. In this study, we first noticed that miR-545 was poorly expressed in the collected tumor tissues from OC patients and the acquired OC cell lines Caov3, OV-90, OVCAR3, and ES-2 compared to the normal ones. In addition, the follow-up study indicated that patients with higher miR-545 expression showed a longer survival time. These were in concert with the finding in a previous study by Jia et al., in which they found OC patients (sample volume = 27) expressing increased levels of miR-545 in epithelial OC tissues having increased survival rates [
8]. In this study, overexpression of miR-545 suppressed viability and proliferation, migration and invasion of OC cells and angiogenesis of HUVECs, while promoted OC cell apoptosis of cells. In a molecular perspective, miR-545 overexpression led to an increase to the Bax/Bcl-2 ratio, as well as an increase in E-cadherin expression while a decline in the expression of N-cadherin and Vimentin. The tumor-suppressing role of miR-545 has been well demonstrated, such as suppressing cell proliferation and metastasis in cervical cancer [
7], gastric cancer [
25], colon adenocarcinoma [
26] and so forth, and enhancing the radiosensitivity of Lewis xenograft tumor [
27]. These reports suggested miR-545 as a promising and specific miRNA for cancer management. Here, combining with the results from animal experiments that upregulation of miR-545 suppressed the weight, volume, and lung metastasis of xenograft tumors, we reported a similar anti-tumor function of miR-545 in OC both in vitro and in vivo.
miRNAs exert their versatile functions primarily by binding to the mRNA targets to induce gene repression. In the present study, we noticed PLK1 and KDM4B as two important potential target genes of miR-545 according to the bioinformatics prediction, and the binding relationships were validated through luciferase reporter gene assays. PLK1 is a well-recognized oncogene that has been summarized in many key cellular processes from cell cycle progression, cell invasion and migration, and proliferation [
28]. As aforementioned, PLK1 has been implicated in OC progression as well [
9]. Likewise, activation of PLK1 was responsible for the oncogenic role of Aurora Borealis in OC [
29]. PLK1 inhibitors have seen potentials in the clinical management of cancers by blocking cancer cell mitosis and triggering cell apoptosis [
30]. In addition, although it has not been completedly translated to clinical trials, a specific PLK1 inhibitor, onvansertib, has shown good tolerance and efficacy in combination therapy with decitabine for leukemia treatment [
31]. High expression of PLK1 has been reported to link to poor prognosis in patients, and targeting inhibition of PLK1 in combination with paclitaxel and proTAME has shown potent effects on the reduction of chromosomal instability and the subsequent apoptosis of OC cells [
32]. These results indicated that miR-545-mediated PLK1 downregulation has potentials in OC control. In addition, epigenetic changes are well-recognized contributors to tumorigenesis and normal developmental processes [
11]. KDM4B is a member of the KDM4/JMJD2 family that target H3K9me2/3 and H3K36me3 and are frequently overexpressed in human cancer cells and neoplastic tissues [
33]. H3K9me3 is normally correlated with facultative heterochromatins, which are condensed and transcriptionally silent but can decondense upon H3K9me3 decline and become transcriptionally nonrestrictive in response to specific environmental and developmental cues [
12]. Here, we observed that a similar KDM4B-H3K9me3-PLK1 regulatory work in OC cells through a ChIP assay, which was further evidenced by the expression examination where overexpression of KDM4B led to an increase in PLK1 expression in OC cells. Intriguingly, upregulation of PLK1 in OC cells elevated KDM4B expression in a moderate extend, though not significantly. This might be caused by the increased binding between miR-545 and PLK1 mRNA, and correspondingly, reduced binding with KDM4B. Then, we found that either overexpression of KDM4B or PLK1 blocked the inhibitory roles of miR-545 on OC cells, especially the former one. Similarly, in the animal models, miR-545 upregulation led to a decline in the expression of KDM4B and PLK1 in the xenograft tumors of mice.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.