Background
Bladder cancer (BCa) is the most common malignant tumor of the urogenital tract. It ranks as the 7th most common cancer in men and 17th most common cancer in women [
1,
2]. In the United States, BCa ranks as the 4th among all malignant tumors. Approximately 76,960 new BCa cases (58,950 males and 18,010 females) and 16,390 deaths of BCa (11,820 males and 4570 females) were expected in 2016 [
3]. Although 75% of newly diagnosed bladder cancers are noninvasive [
1], and localized BCa can be managed by surgery, there are one-third of BCa cases still recurring and progressing to locally invasive or metastatic stages [
4]. In patients with progressed bladder cancer, the therapeutic prognosis remains unstatisfactory. The lack of effective therapies for the progression of bladder cancer urges for studies on the molecular etiology and identification of novel therapeutic targets including non-coding RNAs.
MicroRNAs (miRNAs) are a family of short (20 ~ 24 nucleotides), endogenous noncoding RNAs which are vital gene regulators binding to partially complementary sequences at the 3′ untranslated regions (3′-UTR) of mRNAs and directing post-transcriptional modulation [
5]. It has been reported that more than 1000 miRNAs are encoded by the mammalian genome [
6], and all the miRNAs are estimated to target over 5300 human genes representing 30% of the human gene set [
7]. The dysregulation of miRNAs has been discovered in multiple cancers, and is involved in various physiological and pathological processes of tumor cells, such as proliferation, differentiation, apoptosis, metabolism, metastasis and cell signaling [
8‐
12]. Recent studies have indicated that the abnormal expression of miRNAs also plays an important role in the tumorigenesis and development of bladder cancer [
13‐
16]. Our previous studies have identified various miRNAs functioning as tumor suppressors in bladder cancer, including miR-101, miR-124-3p, miR-320c, miR-433, miR-409-3p, miR-490-5p, and miR-576-3p, which regulate the proliferation, migration and invasion of bladder cancer cells by down-regulating various oncogenes [
17‐
23].
MicroRNA-608 is a newly identified miRNA transcribed from the genetic locus located at human chromosome 10q24.31, and this locus also lies in an intron of the SEMA4G gene. Current evidence indicates that miR-608 is widely down-regulated in various malignant tumors including liver cancer, colon cancer, lung cancer and glioma and acts as a tumor suppressor by inhibiting cell proliferation, invasion, migration or by promoting apoptosis [
24‐
27]. The specific biological function of miR-608 in bladder cancer is still unknown. In our research, for the first time, we discovered the widespread down-regulation of miR-608 in human bladder cancer tissues. Furthermore, we revealed that miR-608 could suppress the proliferation and tumorigenesis of bladder cancer cells via targeting FLOT1.
Discussion
Lately, a growing number of studies revealed the potency of microRNAs as significant diagnostic or prognostic biomarkers and promising therapeutic targets in the treatment of malignant tumors. Meanwhile, the dysregulations of miRNAs in BCa have been extensively profiled as well, but the actual functions of most abnormally expressed miRNAs in the proliferation, progression and metastasis of BCa are still unclear. Human miR-608 is transcribed from 10q24.31 chromosomal locus which belongs to the non-coding region of SEMA4G gene. Although it has been reported that miR-608 is widely down-regulated and acts as a crucial tumor suppressor in multiple malignant tumors such as liver cancer, colon cancer, lung cancer and glioma [
24‐
27], the expression pattern of miR-608 and its role in the tumorigenesis of BCa haven’t been verified yet.
In our study, we found that the basic expression levels of miR-608 in BCa tissues and BCa cell lines were drastically down-regulated as expected, compared with adjacent normal urothelial tissues and the normal urothelial cell line respectively. However, the mechanism of miR-608 down-regulation in various human tumors remains unknown. We are the first to report that the methylation status of CpG islands was involved in the epigenetic regulation of miR-608 expression in BCa cells.
Gain-of-function and loss-of-function studies of miR-608 were both conducted in BCa cell lines. The results revealed that miR-608 could suppress the proliferation and tumorigenesis of BCa cells in vitro and in vivo
, which suggested miR-608 as a tumor suppressor in BCa. The mechanism of miR-608 induced inhibition of cell proliferation could at least partially be due to the G1 phase arrest caused by the activation of AKT/FOXO3a signaling pathway. Previous studies have proved that PI3K/AKT pathway played a key role in the regulation of G1 phase cell cycle progression [
40]. As an important transcription factor, FOXO3a is a major downstream effector which is negatively regulated by PI3K/AKT signaling in various human cancers, and the phosphorylation of FOXO3a catalyzed by p-AKT will markedly suppress its (FOXO3a) transcriptional activity [
36,
37,
41]. Inhibition of PI3K/AKT signaling pathway by down-regulating the level of p-AKT significantly activates FOXO3a which suppresses the expression of CCND1 and other related cell cycle regulators by inducing the up-regulation of tumor suppressing genes (p21 and p27) and finally inhibits the proliferation of cancer cells [
33‐
35,
42]. In our study, we discovered that the overexpression of miR-608 could down-regulate the level of p-AKT and strongly enhance the transcriptional activity of FOXO3a in BCa cells, which revealed a new mechanism in the regulation of BCa cells proliferation.
Based on the basic principles of interactions between miRNA and mRNA and the effect of miR-608 on AKT/FOXO3a pathway, we then investigated the exact mechanism of miR-608 in regulating the proliferation of BCa cells. Finally, we identified flotillin-1 (FLOT1) as a key target of miR-608 responsible for its role in growth inhibition. FLOT1 was reported as a scaffolding protein of lipid raft microdomains and a highly conserved lipid raft maker, furthermore, it widely existed in cell membranes of different tissues and played important roles in signaling transduction, cell adhesion, cytoskeleton remodeling and endocytosis [
43‐
47]. In addtion, FLOT1 was primarily known as a cell signaling mediator by anchoring various receptors of signaling pathways onto cell membrane [
48,
49]. Previous studies showed that FLOT1 was constantly overexpressed in various cancers such as colorectal tumor, esophageal squamous carcinoma, tongue squamous carcinoma, prostate cancer, bladder transitional cell carcinoma, renal cell carcinoma and breast cancer [
31,
38‐
40,
50‐
52]. Moreover, the overexpression of FLOT1 could dramatically promote the proliferation of prostate and bladder cancer cells, and also accelerate the invasion, migration of bladder cancer cells [
38,
52]. The expression levels of FLOT1 in bladder and breast cancers were negatively correlated with the prognosis of patients [
38,
39]. Further in vitro experiments proved that the down-regulation of FLOT1 in renal and breast cancers could inhibit the proliferation of cancer cells via activating AKT/FOXO3a signaling pathway [
31,
39], which is consistent with the results of our study in bladder cancer cells. All these evidences suggested that FLOT1 acted as an oncogene in the tumorigenesis in many kinds of cancers, and might be a novel therapeutic target in the treatment of malignant tumors.
In our study, we also found the overexpression of FLOT1 in BCa tissues in contrast with paired adjacent non-tumor tissues, and the down-regulation of FLOT1 could sharply inhibit the proliferation of BCa cells via activating AKT/FOXO3a signaling pathway. Moreover, in BCa cells, we proved that the expression of FLOT1 was directly inhibited by miR-608, the down-regulation of FLOT1 and the G1 phase arrest induced by siFLOT1 could be significantly reversed by miR-608 inhibitor. Similarly, the suppression of cell proliferation caused by miR-608 could also be reversed by the overexpression of FLOT1. In conclusion, all the findings implied that miR-608 suppressed the tumorigenesis and proliferation of BCa cells in vitro and vivo by directly targeting the 3′-UTR of FLOT1 mRNA, and revealed a new downstream regulatory pathway of FLOT1 in BCa cells.
Methods
Cell lines and cell culture
Two human bladder cancer cell lines (T24 and UM-UC-3) and one non-tumor urothelial cell line (SV-HUC-1) were purchased from the Shanghai Institute of Cell Biology, Shanghai, China. All the cell lines were cultured in RPMI-1640 medium supplemented with 10% heat-inactivated fetal bovine serum in a humidified atmosphere with 5% CO2 at 37 °C.
Clinical tissue samples
Paired BCa tissues and adjacent non-tumor bladder mucosal tissues were obtained from patients undergoing radical cystectomy. The samples were collected between January 2011 and June 2011 at the First Affiliated Hospital of Zhejiang University, after informed consent and Ethics Committee’s approval. The clinical data of the patients has been listed in Additional file
1: Table S1. Tissue samples were snap frozen in liquid nitrogen until RNA extraction.
Chromogenic in Situ Hybridization (CISH) staining
Chromogenic in situ hybridization (CISH). A 5′-DIG and 3′-DIG-labeled, locked nucleic acid-incorporated miRNA probe (miRCURY LNATM Detection probe, Exiqon, Woburn, MA, USA) was used for the visualization of miR-608 in the bladder cancer TMAs which contained 46 cases with paired tumor and adjacent non-tumor tissues and 13 cases without corresponding non-tumor tissues were analyzed in this study. TMA was obtained from Xinchao Biotech, Shanghai, China. Paraffin tissue slides were deparaffinized and digested with proteinase K for 6.5 min (15 μg/ml). The slides were then prehybridized in a hybridization solution at 50 °C for 1 h. Tissues were hybridized for 2 days in the presence of 10 ng, 3′-5′ DIG-labeled miR-608 LNA probes at 4 °C (500 nM). Slides were washed stringently for 20 min at 50 °C, and an immunological reaction was conducted using anti-DIG-AP Fab fragments according to the manufacturer’s protocol. The miR-608 expression was detected by the BCIP/NBT substrates (Boster Biological Technology, Wuhan, China). The strength of positivity was semi-quantified by considering both the intensity and proportion of positive cells. The sequence of miR-608 probe used in CISH staining are listed in Table
1.
Table 1
The oligonucleotides used in this study
miR-608 mimics (Sense) | AGGGGUGGUGUUGGGACAGCUCCGU |
NC (Sense) | ACUACUGAGUGACAGUAGA |
miR-608 Inhibitor | ACGAGCUGUCCCAACACCACCCCU |
Inhibitor NC | CAGUACUUUUGUGUAGUACAA |
miR-608 F | AGGGGTGGTGTTGGGACAGCTCCGT |
miR-608 probec
| ACGGA GCTGT CCCAA CACCA CCCCT |
U6 F | TGCGGGTGCTCGCTTCGGCAGC |
CDK4 F | ATGGCTACCTCTCGATATGAGC |
CDK4 R | CATTGGGGACTCTCACACTCT |
CCND1 F | GCTGCGAAGTGGAAACCATC |
CCND1 R | CCTCCTTCTGCACACATTTGAA |
FLOT1 F | CCCATCTCAGTCACTGGCATT |
FLOT1 R | CCGCCAACATCTCCTTGTTC |
GAPDH F | AAGGTGAAGGTCGGAGTCA |
GAPDH R | GGAAGATGGTGATGGGATTT |
FLOT1 UTR Wt-1 F | CTGTCCATTGACAGTGAGGTCCCACCCCTCATCTCTCCTTGCCAAATAG |
FLOT1 UTR Wt-1 R | TCGACTATTTGGCAAGGAGAGATGAGGGGTGGGACCTCACTGTCAATGGACAGAGCT |
FLOT1 UTR Mut-1 F | CTGTCCATTGACAGTGAGGTCGGTGGGGTCATCTCTCCTTGCCAAATAG |
FLOT1 UTR Mut-1 R | TCGACTATTTGGCAAGGAGAGATGACCCCACCGACCTCACTGTCAATGGACAGAGCT |
FLOT1 UTR Wt-2 F | CAGCCTTCTGATGATCCCACTCCACCCCACCTCAACTTATTTAACTTCG |
FLOT1 UTR Wt-2 R | TCGACGAAGTTAAATAAGTTGAGGTGGGGTGGAGTGGGATCATCAGAAGGCTGAGCT |
FLOT1 UTR Mut-2 F | CAGCCTTCTGATGATCCCACTGGTGGGGACCTCAACTTATTTAACTTCG |
FLOT1 UTR Mut-2 R | TCGACGAAGTTAAATAAGTTGAGGTCCCCACCAGTGGGATCATCAGAAGGCTGAGCT |
Immunohistochemistry (IHC) staining
Tissue sections of xenograft tumors in nude mice and the same bladder cancer TMAs used in CISH staining were analyzed in this study. TMA was obtained from Xinchao Biotech, Shanghai, China. All the paraffin tissue sections were dewaxed and rehydrated. Antigen retrieval was performed by heating the slides in sodium citrate buffer (10 mM, pH 6.0). After blocking with bovine serum albumin (Sango Biotech, Shanghai, China), the slides were incubated with anti-Ki-67 (Cell Signaling Technology, Beverly, MA, USA), or anti-FLOT1 (Epitomics, Burlingame, CA, USA) overnight at 4 °C. The slides were then incubated with a secondary antibody of goat anti-rabbit HRP conjugate (Cell Signaling Technology, Beverly, MA, USA) for 1 h at room temperature. A DAB solution was used for brown color development. The strength of positivity was semi-quantified by considering both the intensity and proportion of positive cells.
Transient transfection of miRNA mimic, inhibitor and small interfering RNA
The miR-608 mimic (named as miR-608) and the negative control duplex (named as NC) which was non-homologous to all human gene sequences were used for transient gain of function study. The mir-608 inhibitor oligo (named as miR-608 inhibitor) and inhibitor negative control oligo (named as inhibitor NC) were used for transient loss of function study. A small interfering RNA duplex (siRNA) targeting human FLOT1 mRNA was used for RNAi study (named as siFLOT1). All the RNA duplexes and RNA oligos were synthesized by Gene Pharma (Shanghai, China). The Lipofectamine 2000 reagent (Invitrogen, USA) was used for transient transfection following the manufacturer’s instructions. The RNA duplexes and RNA oligos used in transfection are listed in Table
1.
RNA isolation and quantitative real-time PCR
MircoRNAs were extracted from cultured cell lines with the RNAiso kit for small RNA (Takara, China) and reversely transcribed into cDNA with the One Step PrimeScript miRNA cDNA Synthesis Kit (Takara, China). Total RNA was isolated with TRIzol reagent (Takara, China) and reversely transcribed into cDNAs with the PrimeScript RT reagent Kit (Takara, China). The resulting cDNAs were quantified with SYBR Green reagent (Takara, China) by using the ABI 7500 fast real-time PCR System (Applied Biosystems, USA). The relative expression levels of miRNAs (miR-608) and mRNAs (FLOT1, CDK4 and CCND1) normalized by small nuclear RNA U6 and GAPDH mRNA respectively were calculated with the 2
-ΔΔCt method. All the qPCR primers were provided by Sango Biotech (Shanghai, China). All primers used are listed in Table
1.
Cell growth and cell viability assay
Bladder cancer cells (T24 and UM-UC-3) were plated in 96-well plates at the density of 5000 cells per well. After an overnight cultivation, all the cells were incubated with RNA duplexes (NC, miR-608 or siFLOT1) or RNA oligos (inhibitor NC or miR
-608 inhibitor) for 48-72 h. The concentration of RNA duplexes ranged from 25 to 75 nM, and the concentration of RNA oligos was 100 nM. As soon as reached the time limit of incubation, the medium were removed and a Cell Counting solution (WST-8, Dojindo Laboratories, Japan) was added to each well and incubated at 37 °C for another 2 h. The absorbance of the solution was measured at 450 nm with MRX II absorbance reader (Dynex Technologies, USA).
T24 and UM-UC-3 cells were harvested 24 h after transfected with RNA duplexes (50 nM of NC, miR-608 or siFLOT1) or RNA oligos (100 nM of inhibitor NC or mir-608 inhibitor). All the cells were resuspended in RPMI-1640 medium supplemented with 10% FBS and seeded in 6-well plates at a density of 400 cells per well. After 10 days of culture under standard conditions, the colonies on the plates were fixed with absolute methanol for 15 min and stained with 0.1% crystal violet for 20 min. The colonies with diameters greater than 2 mm were counted.
Cell cycle analysis by flow cytometry
48 h after the transfection of RNA duplexes (50 nM of NC, miR-608 or siFLOT1) or RNA oligos (100 nM of inhibitor NC or miR-608 inhibitor), or after the co-transfection of RNA duplexes and RNA oligos (FLOT1 rescue experiment), bladder cancer cells were harvested and washed with PBS and fixed with 75% ethanol at -20 °C. After 24 h fixation, the cells were washed with PBS again and stained with propidium iodide using the cell cycle and apoptosis analysis kit (Beyotime, China) for 30 min. Cell cycle features were analyzed by BD LSRII Flow cytometry system with FACSDiva software (BD Bioscience, USA). The data were analyzed by ModFit LT 3.2 software (Verity Software House, USA).
In vivo tumorigenicity assays
Animal studies were carried out according to institutional guidelines. Male BALB/c-nude mice (4 weeks old) were purchased from Shanghai Experimental Animal Center, Chinese Academy of Sciences, Shanghai, China. UM-UC-3 cells (1 × 106 in 100 μl PBS) were subcutaneously injected into the right flank of each mouse. When tumors were first palpable, the mice were intratumorally injected with 30 μg of Lipofectamine 2000-encapsulated miR-608 or NC every 3 days for 18 days. Tumor size was measured every 3 days. Tumor growth was monitored by caliper measurements of the two perpendicular diameters every 3 days, and the volume of the tumor was calculated with the formula V = (width2 × length × 0.5).
5-aza-dc treatment and DNA methylation analysis
T24 and UM-UC-3 cells were first treated with 5 μM 5-aza-2′-deoxycytidine (5-aza-dc) (Sigma, St Louis, MO, USA) for 4 days. Bisulfite-sequencing PCR (BSP) was used to assess the methylation levels of the CpG islands located near the TSS of miR-608 in these two BCa cell lines, before or after the treatment of 5-aza-dc. The primers (forward) 5′- ATTTTATTTTTTAAGTTGGGTTAGG -3′ and (reverse) 5′- CTAACCTCAATCTCTACTACTACAACTC -3′ were used to amplify the DNA sequences of CpG islands in PCR procedure. The PCR products were separated by 3% agarose gel electrophoresis, extracted and then cloned into the pUC18 T-vector (Sangon, Shanghai, China). After bacterial amplification of the cloned PCR fragments by standard procedures, 10 clones were subjected to DNA sequencing (Sangon, Shanghai, China).
Western blot analysis
All the cells were gathered and lysed in cell lysis buffer 48 h after the transfection. The BCA Protein Assay kit (Thermo Scientific, USA) was used to calculate the total protein concentration in every lysate. The same amounts of protein samples were separated by 10% SDS-polyacrylamide gels and transferred to polyvinylidene fluoride (PVDF) membranes. The membranes were blocked with 5% non-fat milk for 1 h, and incubated overnight with primary antibodies including anti-GAPDH, anti-FLOT1, anti-FOXO3a, anti-p-FOXO3a (Ser253), anti-AKT, anti-p-AKT (Ser473), anti-CCND1, anti-CDK4, anti-E2F1, anti-Rb, anti-p-Rb (Epitomics, Burlingame, CA). After being washed in TBS-T for three times, PVDF membranes were incubated with horseradish peroxidase (HRP)-conjugated goat anti-rabbit secondary antibody at a 1:5000 dilution for 1 h. The binding secondary antibody was detected by the enhanced chemiluminescence (ECL) system (Pierce Biotechnology, Rockford, USA).
Dual-luciferase reporter assay
The 3′-UTR segments of FLOT1 including the wild type or the mutant type of miR-608 binding sites were cloned into the downstream of the luciferase reporter, the pmirGLO Dual-Luciferase miRNA Target Expression Vector (Promega, Madison, USA), between the SacI and SalI sites and verified by sequencing. HEK 293 T cells were plated into a 24-well plates and transfected with 50 nM miR-608 or NC and 100 ng of the luciferase vector (pmirGLO). Cells were harvested 48 h after the transfection. The relative luciferase activity was measured by the Dual-Glo luciferase assay kit (Promega).
FLOT1 rescue experiment
miR-608 inhibitor or inhibitor NC were co-transfected with siFlot1 or NC in UM-UC-3 cells to evaluate whether the inhibition of miR-608 could offset the suppression of FLOT1 expression induced by siFLOT1. The FLOT1 overexpression plasmid (pFLOT1) was constructed by inserting the human FLOT1 complementary DNA lacking the 3′-UTR into the pIRES2-EGFP (Clontech, USA). miR-608 or NC was co-transfected with pFLOT1 or empty vector (pNull) in UM-UC-3 cells to assess whether overexpression of FLOT1 could reverse the suppression of cell proliferation caused by miR-608. The cells were harvested 48 h after the transfection and analyzed by subsequent Western blotting and cell cycle analysis.
Statistical analysis
The experimental data were presented as the mean ± SD. Kolmogorov-Smirnov test was firstly used to determine the normality of the distribution of data in each group. Differences between two normal distribution groups were estimated using Student’s t-test. Differences among three or more normal distribution groups were analyzed using ANOVA test. Differences between abormal distribution groups were analyzed using non-parametric test (rank sum test, χ
2-test). All analyses were performed by using SPSS16.0 software (IBM, Armonk, NY, USA) and a two-tailed P-value < 0.05 was considered statistically significant.
Acknowledgements
Not applicable.