Background
Colorectal cancer is one of the most common malignant tumors in the gastrointestinal tract, and there are about 1.2 million new CRC cases have been reported worldwide every year [
1]. During the last decade, the mortality of CRC had reduced by more than 20% because of the advance in diagnosis and management of CRC [
2]. Unfortunately, CRC still causes more than 600,000 deaths per year [
1]. The high mortality of CRC is closely correlated with the tumor metastasis, especially the liver metastasis [
3]. It has been reported that nearly 25% CRC patients were with metastatic disease at the time of initially diagnosed and approximately half of them will ultimately develop the metastases [
4,
5]. With the objective of improving the overall survival of CRC patients, it is urgent to seek new biomarkers in the metastatic CRC and find the interventions.
The microRNAs (miRNAs) are a class of small non-coding RNAs with about 22 nucleotides length [
6]. A growing number of studies confirmed that miRNAs played an essential role during the progression of cancer via regulating gene expression by a direct interaction with the 3′ untranslated regions of the targeted mRNAs [
7]. For instance, miR-4775 was a risk factor for CRC metastasis and it promoted the invasion, metastasis and EMT of CRC cells by activation of the Smad7/TGFβ signaling cascade [
8]. Strikingly, one clinical study showed that miR-196a-5p was in a significantly higher level than the normal adjacent colorectal mucosa and its high expression was associated with the lymph node metastasis and poor prognosis of the CRC patients [
9]. In addition, an in vitro study demonstrated that miR-196a promoted CRC cells proliferation and prevented the apoptosis [
10]. The above researches indicated that miR-196a-5p was participated in the pathological process of colorectal cancer, while its role and potential regulatory mechanisms in CRC metastasis need to be elucidated.
NF-κB proteins are transcriptional factors which binding to the target genes to regulate their expression [
11]. Activation of NF-κB pathway has been reported to be involved in the metastasis of different type of cancers recently. One study from Wang et al indicated that STX2 formed a positive signaling loop with NF-κB that STX2 enhance its own expression by activating the NF-κB pathway and ultimately facilitate the CRC metastasis [
12]. Moreover, it has been elucidated that deactivation of the NF-κB signaling pathway by Lipocalin2 suppressed the invasion, metastasis and EMT of the CRC cells [
13]. These studies inspired us that activation of the NF-κB pathway may make great contribution to the metastatic process of CRC.
In present work, we employed the SW480 cells with miR-196-5p over-expressed plus SW620 and HCT116 cells with miR-196a-5p knockdown to explore the role of miR-196a-5p on CRC migration, invasion and liver metastasis. We further investigated whether miR-196a-5p exert its pro-metastatic effects via facilitating the EMT by a direct inhibition of the IκBα.
Methods
Cell culture
The human colorectal cancer (CRC) cell lines of SW480, SW620 and HCT116 were obtained from Shanghai Zhong Qiao Xin Zhou Biotechnology Co., Ltd. and cultured in DMEM medium (Gibco, USA) supplemented with 10% fetal bovine serum (BI, USA) at 37 °C in 5%CO2. In order to evaluate the influence of NF-κB pathway on the migration, invasion and EMT of CRC cells, cells were treated with NF-κB pathway inhibitor BAY 11–7082 (10 μM, medchemexpress, USA) for 48 h before following experiments.
IκBα plasmid construction and cell transfection
In order to construct the IκBα expression plasmid, the full-length cDNA of IκBα was amplified and inserted into pcDNA3.1 vector with HindIII and BamHI sites. Lipofectamine 2000 (Invitrogen, USA) was employed to transfect IκBα plasmid into SW480 cells. Further, miR-196a-5p mimics, NC mimics, miR-196a-5p inhibitor and NC inhibitor purchased from Shanghai GenePharma Co., Ltd. were transfected into CRC cells using the Lipofectamine® RNAiMAX (Invitrogen, USA) following the manufacturer’s protocol.
Lentivirus infection
The lentiviral (LV) particles that over-expressing miR-196a-5p (LV-miR-196a-5p) and its negative control (LV-NC) or silencing miR-196a-5p (LV-anti miR-196a-5p) and its negative control (LV-anti NC) were purchased from Wanleibio Co., Ltd. CRC cells were seeded in 6-well plates at a density of 4 × 105/well. 24 h latter, the lentivirus was added into the culture medium to infect the CRC cells. After screening with Purine toxin (Solarbio, China), CRC cells with stable miR-196a-5p over-expressed or knockdown were obtained.
Dual luciferase reporter assay
The 3′-UTR region of wide-type of IκBα was amplified and inserted into pmirGLO plasmid at Nhe I and Sal I sites. Furthermore, miR-196a-5p mimics or the miR-196a-5p mutant was cotransfected with Luc-IκBα or the control into HEK 293 T cells using the Lipofectamine 2000 (Invitrogen, USA). Luciferase assays were carried out with the Dual-Luciferase Reporter Assay System (Promega, USA) referring to the instructions.
Real-time PCR
The total RNA from CRC cells in different conditions was extracted using the TRIpure kit (BioTeke, China). After quantization of concentration, RNA was reversely transcribed into cDNA by the Super M-MLV reverse transcriptase (BioTeke). Quantitative PCR was carried out to determine the expression levels of miR-196a-5p and IκBα using 2 × Power Taq PCR MasterMix (BioTeke) and SYBR Green (Solarbio, China). The procedure for IκBα was as follows: first cycle including 94 °C for 5 min, 94 °C for 10 s, 60 °C for 20 s, 72 °C for 30 s, and then 40 cycles of 72 °C for 2 min 30 s, 40 °C for 1 min 30 s, melting from 60 °C to 94 °C for 1 s every 1 °C. While the miR-196a-5p expression level was measured under following condition: 94 °C for 2 min, 94 °C for 15 s, 60 °C for 15 s, 72 °C for 15 s followed with 40 cycles of 72 °C for 2 min 30 s, 40 °C for 5 min 30 s, melting from 60 °C to 94 °C for 1 s every 1 °C. The data were calculated by 2
-ΔΔCt or 2
-ΔCt method and sequences information was shown in Table
1.
Table 1
Primers used in Real-time PCR
hsa-miR-196a-5p | F: CCGACGTAGGTAGTTTCATGTT |
R: GTGCAGGGTCCGAGGTATTC |
RT:GTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCAACCCCAAC |
hsa-U6 | F: CTCGCTTCGGCAGCACA |
R: AACGCTTCACGAATTTGCGT |
RT:GTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCAACAAAATATGG |
IκBα | F: CATCCTGAAGGCTACCAACTAC |
R: CATCAGCACCCAAGGACAC |
β-actin | F: CTTAGTTGCGTTACACCCTTTCTTG |
R: CTGTCACCTTCACCGTTCCAGTTT |
CCK-8 assay
CRC cells were seeded into 96-well plates at 3 × 103/well. The cell viability was measured at 12 h, 24 h, 48 h and 72 h after transfection. CCK-8 regent (KeyGEN BioTECH, China) was added into culture medium 10 μl per well. After 1 h incubation, the optical density of solution was measured using a microplate reader at 450 nm.
Wound healing assay
The transfected or infected CRC cells were cultured in serum-free DMEM containing mitomycin C (Sigma, USA) for 1 h. Subsequently, a sterile 200 μl pipette tip was employed to cause scratches. Representative images of cells migrating into wounds were taken at 0 h, 24 h or 12 h after the scratch.
Cell invasion assay
Cell invasion assay was performed on 24-well transwell chambers coated with Matrigel (BD, USA). In brief, the upper chamber was added into 200 μl DMEM containing 1 × 104 CRC cells and the lower chambers were filled with 800 μl culture medium containing 30% FBS. After 24 h incubation, migrated cells were fixed with 4% paraformaldehyde for 20 min and stained with the crystal violet (Amresco, USA) for 5 min. Cells on lower surface were counted with an inverted microscope.
To assess the effects of miR-196a-5p on tumor metastasis, we employed 4-week-old BALB/c nude mice to establish in vivo metastasis models. The thymic aplasia of the nude mice results in immunodeficiency and could avoid interference from host immune system. The nude mice used in present study were obtained from Beijing HFK Bioscience Co., Ltd. (Beijing, China; License number: SCXK (Jing) 2014–0004) and housed in a standard laboratory environment (12 h day-night cycle; temperature: 25 ± 1 °C; humidity: 50 ± 5%). During the experiments, mice were free access to the water and food and no adverse events were observed. In present work, 24 mice were randomly divided into four groups: SW480-LV-NC group (n = 6); SW480-LV-miR-196a-5p group (n = 6); HCT116-LV-anti NC group (n = 6); HCT116-LV-anti miR-196a-5p group (n = 6). According to the experimental group dividing, 2 × 106 transfected CRC cells were injected into spleens of the anesthetized nude mice and the spleens were resected 48 h latter. All mice were sacrificed 7 weeks after the injection and the hepatic metastases have been evaluated.
H&E staining
The fixed liver tissues were embedded in paraffin followed with slicing into 5 μm sections. After dewaxing, the sections were stained with hematoxylin (Solarbio, China) and eosin (Sangon, China). The metastatic foci were observed under the OLYMPUS DP73 microscope.
Western blot assay
CRC cells or liver metastatic tissues were lysed with RIPA Lysis Buffer (Beyotime, China) containing 1% PMSF (Beyotime). Besides, the nuclear protein was isolated by the Nuclear and Cytoplasmic Protein Extraction Kit (Beyotime). Protein from different conditions were separated by 6–14% SDS-PAGE and then transferred to PVDF membranes. After blocking with 5% non-fat milk or 1% BSA, the membranes were incubated with following primary antibodies at 4 °C overnight: anti-E-cadherin (1:1000, 60,335–1-Ig, Proteintech, China), anti-N-cadherin (1:1000, 66,219–1-Ig, Proteintech, China), anti-fibronectin (1:500, 15,613–1-AP, Proteintech, China), anti-p-IκBα (1:500, bs-2513R, Bioss, China), anti-IκBα (1:500, bs-1287R, Bioss, China), anti-p65 (1:500, 10,745–1-AP, Proteintech, China), anti-β-actin (1:500, KGAA001, KeyGen, China) and Histone H3 (1:2000, AM8433, ABGENT, USA). After rinsed with TSBT, the membranes were incubated with their corresponding secondary antibodies at 37 °C for 45 min. The protein bands were visualized using the ECL reagent (Beyotime).
Immunofluorescence staining
The CRC cells were seeded on slides and then fixed in 4% paraformaldehyde for 15 min. After permeabilized with 0.1% tritonX-100 (Beyotime, China) for 30 min at room temperature, the slides were blocked with goat serum (Solarbio, China). Subsequently, cells were incubated with antibodies of E-cadherin (1:100, 60,335–1-Ig, Proteintech, China), N-cadherin (1:100, 66,219–1-Ig, Proteintech, China), Fibronectin (1:50, 15,613–1-AP, Proteintech, China) overnight at 4 °C. Then CRC cells were incubated with the goat anti-rabbit Cy3-conjugated IgG (1:400, A0516, Beyotime) or goat anti-mouse Cy3-conjugated IgG (1:400, A0521, Beyotime). Lastly, cells were counterstained with DAPI (Sigma, USA) before capturing images using the fluorescence microscope (Olympus, Japan).
Statistical analysis
The data were presented as mean ± SD and were obtained from at least three individual experiments. One-way or two-way ANOVA test followed with post hoc Bonferroni’s test were used to analyze data. While the statistical difference between two groups were analyzed by student t test. Correlations were analyzed using Pearson’s correlation test. A P < 0.05 was seen as statistically significant.
Discussion
Tumor metastasis seriously affects the prognosis of CRC patients [
16]. While several studies indicated that miR-196a-5p was involved in the pathological process of CRC, the clear regulatory mechanisms of miR-196a-5p in CRC metastatic process have yet to be elucidated. The merit of our present work was firstly indicated that miR-196a-5p may target the IκBα to regulate the EMT process and finally promoted CRC cells invasion and metastasis.
The miR-196a-5p was initially identified as an oncogenic miRNA which direct targeted annexin A1 to promote proliferation and prevent apoptosis of esophageal cancer cells [
17]. With further investigations, researchers found that miR-196a-5p was aberrant expression in various cancer tissues such as cervical cancer and non-small cell lung cancer, and its expression level was correlated with the progression of these cancers [
18,
19]. For instance, miR-196a-5p was significantly over-expressed in the oral cancer tissues and it accelerated the cell migration and invasion of oral cancer cells through the NME4-JNK-TIMP1-MMP axis [
20]. Intriguingly, one study from Schimanski [
21] and his colleagues demonstrated that miR-196a-5p was up-regulated in CRC samples and it played a pro-oncogenic role by reinforcing CRC cells invasion and their sensitivity to the platinum derivatives. They also observed that over-expression of miR-196a-5p enhanced the lung metastases of CRC in vivo. In line with these, our work demonstrated that over-expression of miR-196a-5p promoted the proliferation, migration, invasion and the liver metastasis of CRC cells, indicating that hyper proliferated CRC cells by miR196 may show an increase in cell migration and liver metastasis, while miR-196a-5p knockdown attenuated the cell viability, invasion and metastasis of CRC cells. These results confirmed the oncogenic effects of miR-196a-5p, especial the pro-metastatic effects.
Epithelial-mesenchymal transition is a reversible process which is been considered as a critical program during the metastatic cascade in several types of cancers including the CRC [
22,
23]. During this process, cells suppressed the E-cadherin and expressed the mesenchymal proteins such as N-cadherin, fibronectin to loss the cell-cell adhesion and acquire migratory and invasive abilities [
24,
25]. Inspired by these, we evaluated the effects of miR-196a-5p on the EMT process of CRC. As expected, inducing expression of miR-196a-5p in CRC cells promoted the EMT by down-regulating E-cadherin while up-regulating N-cadherin and fibronectin, whereas silencing of miR-196a-5p exerted opposite effects. The above investigations suggested that promoting the EMT contributed a lot to the pro-metastatic effects of miR-196a-5p in CRC.
It is worth mentioning that several literatures demonstrated that IκBα may work as a downstream target of miR-196a-5p during cancer progression. One study from Yang et al showed that miR-196a took an oncogenic role in glioblastoma multiforme by targeting IκBα [
26]. The IκBα is a negative regulator of the NF-κB signaling pathway. After being phosphorylated and degraded by stimulation, IκBα lose the bind with NF-κB and let NF-κB translocate to nucleus to activate the target genes [
27,
28]. Moreover, it has been showed that suppressing the phosphorylation of IκBα may partially inhibit the invasion and EMT of gastric cancer cells [
29]. In non-small cell lung cancer cells, preventing the phosphorylation of IκBα and the subsequently activation of NF-κB was benefit for suppressing the EMT process [
30].
Consideration of above observations, we speculated miR-196a-5p may also facilitate the EMT of CRC via regulating the IκBα expression. By performing the dual luciferase reporter assay, we verified that miR-196a-5p directly bound to the IκBα gene. We also investigated the effects of miR-196a-5p on the expression of IκBα pathway. As expected, miR-196a-5p over-expression decreased the expression of IκBα and increased the level of nuclear p65, while miR-196a-5p knockdown up-regulated the IκBα and down-regulated the nuclear p65 in CRC cells. The data suggested that IκBα may be a target of the miR-196a-5p in CRC cells.
We further evaluated that whether inhibition of the NF-κB pathway attenuated the EMT of CRC. The results demonstrated that deactivation of NF-κB pathway increased epithelial markers E-cadherin but decreased the mesenchymal markers N-cadherin and fibronectin. As IκBα is the natural inhibitor of NF-κB signaling pathway, these findings implied that miR-196a-5p and IκBα may take opposite roles in the EMT of CRC. Additionally, over-expression of IκBα in CRC cells attenuated miR-196a-5p induced-migration, invasion and EMT of CRC cells, which further confirmed that miR-196a-5p exerted its pro-metastatic effects by facilitating the EMT process via targeting IκBα. In order to further clarify the pro-metastatic effects and the potential mechanisms of miR-196a-5p in CRC, we will perform clinical studies to analyze the correlation between miR-196a-5p levels and liver metastasis. The relationship between the expression of miR-196a-5p and IκBα in the clinical CRC tissues will also be investigated in future.