Background
Colon cancer, a malignancy of the large intestine (colon), is a clinically highly malignant tumour of the digestive tract. Colon cancer ranks third in global gastrointestinal tumour incidence and fourth in mortality [
1]. Colon cancer can cause blood in the stool, stomach pain, and changes in stool. If this disease is detected early, most patients with colon cancer can recover. However, there are more than one million new cases of colon cancer, and approximately 700,000 people die of colon cancer each year in 2013 globally [
2]. Currently, the treatments for colon cancer are unsatisfactory.
MicroRNAs (miRNAs) are small endogenous noncoding RNAs that play important roles in multiple oncogenic cellular processes [
3,
4]. In colon cancer, an increasing number of studies have shown that various miRNAs are involved in the process of colon cancer, including miR-200c [
5,
6]. The expression of miR-200c has been found to correlate with poor prognosis of colon cancer [
6]. The miR-200 family comprises 5 members, miR-200a/b/429 and miR-200c/141 [
7]. Accumulating evidence suggests that miR-200c, a tumour suppressor, has low expression in colon cancer [
8‐
11]. MiR-200c inhibitors could enhance the viability and proliferation of colorectal cancer cells (CRC), and low miR-200c expression was related to shortened survival of patients with CRC [
8,
11]. However, Chen et al. [
6] reported an opposite conclusion in colon cancer showing that miR-200c was highly expressed in colorectal cancer and functions by inhibiting protein tyrosine phosphatase gene expression and p53 phosphorylation. The regulation of colon cancer metastasis by miR-200c is mediated by a complex biological network [
9,
10]. Therefore, the regulatory mechanism of miR-200c in colon cancer metastasis deserves further study.
Wnt/β-catenin signalling controls multiple biological phenomena in early life and adult life by regulating cell proliferation and genetic stability [
12]. Studies have shown that the miR-200 family plays an important role in the regulation of cancer cell proliferation and metastasis by inhibiting Wnt/β-catenin signalling [
13,
14]. Dermani et al. found that zerumbone inhibited epithelial-mesenchymal transition and cancer stem cell properties by inhibiting the Wnt/β-catenin pathway through miR-200c [
15]. In this work, we investigated the effects of miR-200c on the proliferation of colon cancer. Furthermore, we studied whether its mechanism of action was related to the Wnt/β-catenin signalling pathway, searching for promising molecular targets to inhibit metastasis for colon cancer therapy.
Methods
Cell culture
The the human colon cancer cell lines LoVo (BNCC338601) and SW480 (BNCC288146) and human normal intestinal epithelial cell line NCM460 (BNCC353657) were obtained from the BeNa Culture Collection (
www.bnbio.com, Beijing, China). These cells were derived from ATCC (Manassas, VA, USA) and have been authenticated using short tandem repeat (STR) markers. In addition, the cells have not been tested for mycoplasma contamination. Cells were cultured in RPMI-1640 (Gibco, Rockville, MD, USA) containing 10% foetal bovine serum (FBS, Sigma-Aldrich, St. Louis, MO, USA). The cells were maintained in a humidified cell incubator (Thermo Fisher Scientific, Waltham, USA) atmosphere of 5% CO
2 at 37 °C.
Cell groups and transfection
LoVo and SW480 cells were divided into (1) blank control group (BC): no treatment; (2) miR-200c overexpression group: cells were transfected with 100 nM miR-200c mimic (5′-TCCATCATTACCCGGCAGTA-3′) lentiviral vector; (3) fucosyltransferase 4 (FUT4) silencing group (si-FUT4): cells were transfected with 50 nM FUT4 siRNA (5′-GUUUGGAUGAACUUCGAGUTT-3′, 5′-ACUCGAAGUUCAUCCAAACTT-3′;) lentiviral vector; (4) miR-200c + FUT4 overexpression negative control group (miR-200c + NC1): cells were transfected with 100 nM miR-200c mimic and 50 nM pcDNA3.1 empty vector; (5) miR-200c + FUT4 overexpression group (miR-200c + FUT4): cells were transfected with 100 nM miR-200c mimic and 50 nM pcDNA3.1 FUT4 plasmid. Cells were transfected using Lipofectamine® 2000 (11,668,019, Invitrogen, Shanghai, China) according to the manufacturer’s protocols. In each group, there were three replicates.
LoVo and SW480 cells in logarithmic growth phase were selected for subsequent experiments. The cells were passaged 1 day before transfection and cultured in a 6-well plate. When the confluence reached 70%, transfection was performed according to the lentiviral transfection instructions. Lentiviral particles were constructed by Shanghai Jikai Biotechnology Co., Ltd. (Shanghai, China). MiR-200c mimic, FUT4 siRNA, pcDNA3.1 FUT4 and negative control lentiviral vectors were purchased from Shanghai GenePharm Pharmaceutical Technology Co., Ltd. (Shanghai, China). The expression of miR-200c and FUT4 mRNA in transfected cells was detected by real-time quantitative polymerase chain reaction (RT-qPCR) at 72 h after transfection. Each experiment was repeated three times.
RT-qPCR
A total RNA extraction kit (A27828, MagMAX™ MiRVana™ Total RNA Isolation Kit, Thermo Fisher Scientific, Waltham, USA) was used to extract total RNA from the cells. cDNA was synthesized by a reverse transcription kit (Applied Biosystems, Waltham, MA, USA), and SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA USA) was used for RT-qPCR. The miR-200c primer was synthesized by Shanghai Shengong Biotechnology Co., Ltd. (Shanghai, China), and the reaction was performed under the following conditions (40 cycles): 95 °C for 10 min, 95 °C for 15 s, and 60 °C for 1 min. The miR-200c and FUT4 mRNA compared with the endogenous controls U6 and GAPDH, respectively, and the data were processed by the 2
-ΔΔCt method. The sequences of the primers were showed in Table
1.
Table 1
Primers used in RT-qPCR
MiR-200c | CCTATGTAAACAGCCTCGACTG | CTGGCGTATCGTGAGTCG |
U6 | GACCTCTATGCCAACACAGT | AGTACTTGCGCTCAGGAGGA |
FUT4 | AAGGTCCAGGCCCACTGAAG | CAGTTCAGGTGACAGAGGCTCA |
GAPDH | ATGGGGAAGGTGAAGGTCG | GGGGTCATTGATGGCAACAATA |
Double luciferase reporter assay
Target gene prediction between miR-200c and FUT4 was performed using TargetScan software (
www.targetscan.org). Wild-type and mutant 3′-UTRs of FUT4 were amplified in the pGL3/luciferase vector (Promega, Madison, WI, USA) and cloned downstream of the luciferase gene. The constructed luciferase reporter plasmid (wt-FUT4 or mut-FUT4) was separately co-transfected with miR-200c or NC into LoVo and SW480 cells using Lipofectamine 2000 (Invitrogen, Thermo Fisher Scientific, China) for 24 h. The luciferase activity of the cells was detected with the dual luciferase reporter system (Promega) at 48 h after transfection according to the instructions.
Cell counting kit (CCK)-8 assay
Cells at logarithmic growth phase were plated into 96-well plates at a density of 2 × 104 cells/mL, 100 μL per well. According to the manufacturer’s instructions (G021–1-1, Nanjing Jiancheng Bioengineering Institute, China), cells viabilities were analyzed. The optical density (OD) of each well at 450 nm was measured by a microplate reader (HBA-1096A, DeTie, Shanghai, China).
Logarithmic growth phase cells were digested with 0.25% trypsin and adjusted to 250 cells/mL. Cells (2 mL/well) were cultured in a 6-well plate at 37 °C and 5% CO2 for 2–3 weeks, and the fresh medium was added every 3 days. Methanol was used to fix the cells, and 1 ml of Giemsa working fluid (48,900, Sigma-Aldrich, Shanghai, China) was used to stain the cells for 30 min. After two washes with ultrapure water, filter paper was used to remove the water around the dish, and the cells were imaged by a camera (Eos RP, Canon, Japan).
Transwell assay to analyse cell migration and invasion
Cell invasion experiment: After digestion, centrifugation and resuspension, the cells were adjusted to 4 × 105 cells/mL. Fifty microlitres of 1640 medium containing Matrigel (1:1) without FBS was added to the transwell upper chamber and incubated at 37 °C for 1 h. Then, 100 μL of cell suspension was added to the upper compartment of the chamber, while 600 μL of complete medium containing 10% FBS was added to the lower chamber. After incubation at 37 °C and 5% CO2 for 24 h, the membranes were fixed with methanol for 30 min and stained with crystal violet for 15 min. The non-migrated cells in the upper layer were gently wiped with cotton swabs. The results were observed under a inverted microscope (BDS400, Aote, China) and assessed by ImageJ software 6.0 (National Institutes of Health, USA).
For the cell migration experiment, Matrigel was not required, and the other experimental steps were the same as those for the invasion experiment.
Immunofluorescence
The cells in coverslips were treated differently as required and fixed with 4% paraformaldehyde. With 0.2% Triton X-100 cell permeabilization, the cells were blocked with 5% bovine serum albumin (BSA) and incubated in an incubator for 30 min at 37 °C. Then, the cells were incubated with primary antibodies against Ki67 (1:600, orb69312, Biorbyt, Cambridge, UK) at 4 °C overnight. After the cells were rinsed with phosphate-buffered saline (PBS), they were incubated with FITC-labelled lgG1(1:800, 11–4015-82, ThermoFisher, Shanghai, China) at 37 °C for 30 min in the dark. Subsequently, the cells were rinsed with PBS, stained with 4′,6-diamidino-2-phenylindole (DAPI, orb90525, Biorbyt, Cambridge, UK) and mounted with glycerol. The fluorescence was observed under an inverted laser confocal microscope (FV1200; New Discovery Technology (China) Co., Ltd., Shanghai, China).
Western blot
The cells or tumor tissues were split using lysozyme solution (90,082, ThermoFisher, Shanghai, China), and the protein concentration of the cells was measured using a BCA kit (Solarbio, Beijing, China). Then, the protein samples were transferred to sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) electrophoresis (Mini-Protean-3, Bio-Rad, Hercules, CA, USA) and transferred onto a polyvinylidene difluoride (PVDF) membrane (Millipore, Massachusetts, USA). After the membranes were blocked with 5% skim milk, they were incubated with primary rabbit anti-human antibodies against β-catenin (1:2000, ab16051, Abcam), CyclinD1 (1:200, ab16663, Abcam), GSK-3β (1:5000, ab32391, Abcam), p-GSK-3β (1:1000, ab131097, Abcam), and β-actin(1:2500, ab8227, Abcam, UK) and mouse anti-human FUT4 (1:1000, sc-19,648, Santa Cruz Biotechnology, Beijing, China). After three washes with TBST (TBS, 1 ml/L Tween-20), the membranes were incubated with horseradish peroxidase-conjugated goat anti-rabbit (1:2000, ab6721, Abcam) and goat anti-mouse immunoglobulin G secondary antibodies (1:2000, sc-2354, Santa Cruz Biotechnology). Finally, the enhanced chemiluminescence (ECL) method was used for detecting signals, and greyscale scanning and quantification of the protein bands were performed by ImageJ (NIH) software 6.0. The expression levels of proteins were normalized to β-actin.
Animals
Thirty SPF grade BALB/C female nude mice, body weight 16–18 g, 4 weeks old, were purchased from Beijing Weitong Lihua Experimental Animal Technology Co., Ltd. (license no. scxk (Jing) 20,160,006). The animals were raised at 26–28 °C and a humidity of 40–60%. The feed, drinking water and bedding materials were sterilized. Animal experiments followed the national institutes of health guidelines (NIH pub. no. 85–23, revised 1996) and were approved by the Animal Protection and Use Committee of Shengjing Hospital.
Xenograft tumour model
Thirty mice were randomly divided into 5 groups (
n = 6): the model group: mice were subcutaneously injected with 200 μL of normal saline; the miR-200c group: mice were subcutaneously injected with 200 μL (5 × 10
6 cells/100 μL) of LoVo and SW480 cells [
16], which were transfected with miR-200c mimic; the si-FUT4 group: mice were subcutaneously injected with 200 μL (5 × 106 cells/100 μL) of LoVo and SW480 cells, which were transfected with siRNA FUT4 lentiviral vector; the miR-200c + NC1 group: mice were subcutaneously injected with 200 μL (5 × 106 cells/100 μL) of LoVo and SW480 cells, which were transfected with miR-200c mimic and pcDNA3.1 empty vector; the miR-200c + FUT4 group: mice were subcutaneously injected with 200 μL (5 × 106 cells/100 μL) of LoVo and SW480 cells, which were simultaneously transfected with miR-200c mimic and pcDNA3.1 FUT4 plasmid.
Tumour volume
The long diameter (L) and short diameter (W) of the tumour were measured every 7 days, and the tumour volume was calculated. Tumour volume (V) = (long diameter × short diameter 2)/2. After 28 days, the nude mice were anaesthetized by intraperitoneal injection of 3% pentobarbital sodium (40 mg/kg) and then sacrificed by cervical dislocation. The tumour tissues were weighed. The positive expression of Ki-67 was detected by immunohistochemistry and immunofluorescence staining.
Immunohistochemistry
The tumour tissue was heated, dewaxed with xylene, and then hydrated with gradient ethanol solution. A 3% H2O2 methanol solution was added for inactivation for 20 min, high temperature antigen in citrate buffer solution (pH 6.0) was used for thermal repair for 10 min, and 5% BSA was used for blocking treatment for 20 min. Rabbit anti-human Ki67 (1:200, ab15580, Abcam) polyclonal antibody was added and incubated overnight at 4 °C. After rewarming, goat anti-rabbit IgG labelled with horseradish peroxidase (1:1000, abin101988, Antibodies Online, Germany) was incubated with the secondary antibody, and DAB staining was performed. The cells were observed under an optical microscope at 400× magnification (Olympus, Japan). The results are expressed as the percentage of positive cells (%).
Statistical analysis
SPSS 19.0 statistical analysis software was used for data processing, and the results of data analysis are expressed as the mean ± standard deviation (mean ± SD). The t-test was used for data analysis between two groups, and one-way analysis of variance (ANOVA) with Turkey’s t test was used for data analysis of multiple-group comparisons. The difference was statistically significant at p < 0.05.
Discussion
The biological function of miR-200c in human colorectal cancer remains controversial. Roh MS et al. found that miR-200c was upregulated in 109 paired colorectal cancer patients and increased in colorectal cancer with a higher grade, advanced stage and lymphovascular invasion [
18]. Yu et al. [
19] reviewed the prognostic value of the miR-200 family in 1882 patients with colorectal cancer showing that high expression of miR-200c was associated with improved colorectal cancer or was related to poor outcomes of colorectal cancer. In colorectal cancer patients, FUT4 was overexpressed in most metastatic colorectal cancer patients (43%) and associated with higher systemic inflammation and poor outcomes [
20].
In the present study, the regulatory mechanism of miR-200c in colon cancer metastasis was evaluated by targeting FUT4. We found that miR-200c expression was substantially lower and FUT4 expression was clearly higher in LoVo and SW480 cells than in NCM460 cells. Furthermore, FUT4 is a target gene of miR-200c in colon cancer cells, which negatively regulates miR-200c. In vitro and in vivo, miR-200c overexpression inhibited the proliferation of LoVo and SW480 cells, and FUT4 silencing suppressed the proliferation of LoVo and SW480 cells. These results indicated that miR-200c plays a positive role and FUT4 plays a negative role in the treatment of colon cancer.
The miR-200 family includes five members: miR-200a, miR-200b, miR-200c, miR-429 and miR-141 [
21]. In breast cancer, miR-200b was negatively correlated with FUT4, and miR-200b inhibited the proliferation and invasion of breast cancer cells by downregulating FUT4, which inactivated the PI3K/Akt signalling pathway [
22]. The FUT family is a class of glycosyltransferase molecules that are involved in the synthesis of glycoproteins and glycolipid sugar chains on the cell surface, which play important roles in a variety of physiological processes [
23]. FUT4 has been observed in many cancers, such as breast cancer [
22] and colon cancer [
20]. In the present study, CCK-8 and plate colony formation assays confirmed that miR-200c overexpression could inhibit the proliferation of LoVo and SW480 cells by targeting FUT4. Furthermore, transwell and immunofluorescence assays suggested that miR-200c overexpression could inhibit the invasion and migration of LoVo and SW480 cells by targeting FUT4. In vivo
, immunohistochemistry demonstrated that miR-200c overexpression suppressed tumour growth by targeting FUT4.
The Wnt signalling pathway is widely present in invertebrates and vertebrates and is a class of highly conserved signalling pathways during species evolution [
12]. A number of studies have shown that the Wnt/β-catenin signalling pathway is associated with a wide variety of human diseases, and miR-200c can inhibit tumour cell migration and invasion by inhibiting Wnt/β-catenin signalling [
14,
15]. In acute myeloid leukaemia, silencing FUT4 enhanced the inhibitory effects on p-GSK-3-3β, β-catenin, and CyclinD1 protein expression but not total GSK-3β [
24]. Interestingly, the protein expression of β-catenin, CyclinD1, and p-GSK-3β was downregulated after miR-200c overexpression or silencing of FUT4 in this study. However, simultaneous treatment with miR-200c and FUT4 upregulated the expression of the above proteins.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.